March 2012
Volume 53, Issue 14
Free
ARVO Annual Meeting Abstract  |   March 2012
Protective role of microRNA 146a and 155 in experimental autoimmune uveitis
Author Affiliations & Notes
  • Sindhu Saraswathy
    Ophthalmology, Doheny Eye Institute, Los Angeles, California
  • Narsing A. Rao
    Ophthalmology, Doheny Eye Institute, Los Angeles, California
  • Footnotes
    Commercial Relationships  Sindhu Saraswathy, None; Narsing A. Rao, None
  • Footnotes
    Support  NIH grants: EY017347, EY019506, EY03040 and RPB.
Investigative Ophthalmology & Visual Science March 2012, Vol.53, 1212. doi:
  • Views
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Sindhu Saraswathy, Narsing A. Rao; Protective role of microRNA 146a and 155 in experimental autoimmune uveitis. Invest. Ophthalmol. Vis. Sci. 2012;53(14):1212.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose: : MicroRNAs, the small non-coding RNAs, regulate gene expression involved in immune responses and apoptosis and play a significant role in the pathogenesis of disease states. Our previous findings have shown that microRNAs, mir146a and 155 were significantly upregulated by αA crystallin treatment in experimental autoimmune uveitis (EAU). Furthermore, treatment with these microRNAs ameliorated EAU. In this study, we investigated modulation of adaptive immune response and apoptosis by the treatment of microRNA 146a and 155 in EAU

Methods: : EAU was induced in three groups of B10RIII mice and was treated by intravenous injection of miRIDIAN microRNA mimics for mmu-miR-146a (UGAGAACUGAAUUCCAUGGGUU) and mmu-miR-155 (UUAAUGCUAAUUGUGAUAGGGGU). Control group mice were injected with miRIDIAN microRNA negative control mimics. Enucleated eyes were analyzed by qPCR for Th1/Th2/Th17- related cytokines. Cytokine protein expression was assayed by MultiAnalyte Elisarray kit. TUNEL assay was used to detect apoptosis

Results: : On postimmunization day 21, Th1 cytokines TNF-α and IL-12 and Th17 cytokine IL-17 were significantly upregulated in the retinas of EAU mice treated with scrambled microRNA sequences, whereas the levels of these cytokines were significantly reduced in the mice treated with the microRNA mimics 146a and 155. The Th17 cytokines Il-6, Il-17 and Il-23 and TGF-β were also downregulated, whereas the Th2 cytokine IL-10 was elevated in these treatment groups. Treatment with mir146a and mir155 prevented apoptosis of photoreceptor cells in EAU, whereas there was significant apoptotic cells in the scrambled microRNA-treated mice.

Conclusions: : Treatment of EAU by miR-146a and miR-155 suppressed the local immune response by downregulating the Th1- and Th17-related cytokines in the retina. Mir-146a and mir-155 treatment may prevent photoreceptor degeneration by modulating innate and adaptive immune responses and the apoptosis pathway. Thus, systemic microRNA-based treatment may offer a novel approach for suppressing uveitis and preventing the accompanying photoreceptor damage

Keywords: crystallins • photoreceptors • uveitis-clinical/animal model 
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×