May 2007
Volume 48, Issue 13
Free
ARVO Annual Meeting Abstract  |   May 2007
Exogenous Ciliary Neurotrophic Factor Receptor (CNTFR) Restored CNTF Signaling Pathway in Corneal Endothelial (CE) Cells in Donor Human Corneas
Author Affiliations & Notes
  • S.-W. M. Koh
    Ophthalmology & Visual Sciences, Univ of Maryland Sch of Medicine, Baltimore, Maryland
  • J. Celeste
    Ophthalmology & Visual Sciences, Univ of Maryland Sch of Medicine, Baltimore, Maryland
  • P. Ku
    Ophthalmology & Visual Sciences, Univ of Maryland Sch of Medicine, Baltimore, Maryland
  • Footnotes
    Commercial Relationships S.M. Koh, None; J. Celeste, None; P. Ku, None.
  • Footnotes
    Support NIH Grant RO1EY-11607; Research to Prevent Blindness, Inc.
Investigative Ophthalmology & Visual Science May 2007, Vol.48, 2695. doi:
  • Views
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      S.-W. M. Koh, J. Celeste, P. Ku; Exogenous Ciliary Neurotrophic Factor Receptor (CNTFR) Restored CNTF Signaling Pathway in Corneal Endothelial (CE) Cells in Donor Human Corneas. Invest. Ophthalmol. Vis. Sci. 2007;48(13):2695.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose:: While CNTF for the treatment of human retinal degeneration in a phase I clinical trial has been concluded (1), the importance of the receptor for CNTF (CNTFRα) in the CNTF therapy has not been investigated. Using human donor corneas, the present study demonstated that the presence of CNTFRα is critical and that the recombinant CNTFRα restored functional CNTF receptor inducing connexin-43 gene expression (2) in corneal endothelial(CE) cells with diminished CNTFRα.

Methods:: Donor human corneas that were determined not suitable for transplantation were obtained from Maryland Eye Bank (fresh corneas) and Central Florida Eye Bank (corneas in storage in Optisol). Stored corneas were divided into three groups: in storage for one to 14 days, 15-30 days, 31 days and longer. CNTFRα in CE cells was demonstrated by Western blot analysis using an affinity-purified antibody (R& D Systems). In those with intact CNTFRα the CNTF-induction of connexin-43 was first established. To test the effectiveness of recombinant CNTFRα, paired donor corneas were treated with 0.83 nM CNTF (OS) and 0.83 nM CNTF plus 8.3 nM CNTFRα (OD) for 24 h at 37oC, followed by analysis of connexin-43 mRNA and protein levels. Connexin-43 mRNA levels were determined by semi-quantitative RT-PCR using primers (Forward: CCTTCTTGCTGATCCAGTGGTAC, Reverse: ACCAAGGACACCACCAGCAT) and kits containing 18S rRNA primers (for internal standard) from Ambion (Austin, TX). Connexin-43 protein levels were determined by Western blot analysis.

Results:: CE cell CNTFRα was persistently present in fresh donor human corneas as a 50 kDa molecule and continued to be present in those stored for less than one month. In donor human corneas that have been stored in Optisol for approximately one month, the effectiveness of the recombinant CNTFRα was most apparent: higher levels of CE cell connexin-43 mRNA expression in OD (CNTF plus CNTFRα-treated) than OS (CNTF-treated). CE cell connexin-43 mRNA was equally expressed in OD and OS corneas that have been stored for up to two weeks, whereas CE cells in those corneas that have been in Optisol for one and a half months did not express connexin-43 mRNA in either CNTF plus CNTFRα-treated or CNTF-treated corneas. Western blot analysis for connexin-43 showed that the protein levels correlated with those of mRNA.

Conclusions:: Our study implied that inclusion of CNTFRα may further the effectiveness of CNTF therapy.1.Sieving et al. 2006 PNAS, USA 103:3896-3901. 2. Ozog et al. 2004 Mol Biol Cell 15:4761-74.

Keywords: cornea: endothelium • cell survival 
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×