May 2003
Volume 44, Issue 13
Free
ARVO Annual Meeting Abstract  |   May 2003
Application of Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) to Determine the Drug Sensitivity of Chlamydia trachomatis
Author Affiliations & Notes
  • H.N. Madhavan
    L & T Microbiology Res Ctr, Vision Research Foundation, Chennai, Tamil Nadu, India
  • J. Malathi
    L & T Microbiology Res Ctr, Vision Research Foundation, Chennai, Tamil Nadu, India
  • G. Shyamala
    L & T Microbiology Res Ctr, Vision Research Foundation, Chennai, Tamil Nadu, India
  • Footnotes
    Commercial Relationships  H.N. Madhavan, None; J. Malathi, None; G. Shyamala, None.
  • Footnotes
    Support  Vision Research Foundation, Chennai, India
Investigative Ophthalmology & Visual Science May 2003, Vol.44, 1431. doi:
  • Views
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to Subscribers Only
      Sign In or Create an Account ×
    • Get Citation

      H.N. Madhavan, J. Malathi, G. Shyamala; Application of Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) to Determine the Drug Sensitivity of Chlamydia trachomatis . Invest. Ophthalmol. Vis. Sci. 2003;44(13):1431.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Abstract: : Purpose: Since the results of conventional micro-immunoflourescence method was difficult to interpret, Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) - based method was applied to determine minimum inhibitory concentration (MIC) of drugs against Chlamydia trachomatis . Methods: Minimal Inhibitory concentrations of Ciprofloxacin, Erythromycin, Roxithromycin and Sparfloxacin was determined by exposure of varying concentrations of the drugs on the growth of C. trachomatis in stationary McCoy cell line.The inoculum of the bacterium contained 150 elementary bodies (EBs) per 100 microliters. Both micro-immunofluorescence and RT-PCR were done on the standard ATCC strains of C. trachomatis A, B, Ba, C serovars and 3 laboratory isolates. RT-PCR was performed for the gene coding for Dna K protein (Forward primer -5' CCTGCAAAACGTCAAGCAGT 3' & Reverse primer - 5' AATGCGTCCAGCATCTTTTG 3'). Controls included were shell vials inoculated with the respective serovars of the standard strains of C. trachomatis and the 3 laboratory isolates without exposure to the drugs and uninoculated shell vial cell cultures. Results were observed indepentantly by the authors. The tests were performed thrice. Results: MIC ranges of ciprofloxacin, roxithromycin and sparfloxacin against the standard strains & laboratory isolates were within the acceptable ranges as per literature. ATCC strain of C. trachomatis Ba showed profound resistance to erythromycin (MIC of 160 microgram / ml). MIC of the drugs were interpreted as significantly higher by micro-immunofluorescence compared to RT-PCR. This was probably due to the presence EBs of the inoculum leading to subjective errors of observations. Sparfloxacin showed autofluorescence in the micro-immunofluorescence method. The results of RT-PCR were accurate, as they were reproducible. Conclusion: RT-PCR method of MIC determination of drugs against C. trachomatis is reproducible and more accurate than micro-immunofluorescence method which was prone to observer variations of the results.

Keywords: conjunctivitis • antibiotics/antifungals/antiparasitics • bacterial disease 
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×