December 2001
Volume 42, Issue 13
Free
Glaucoma  |   December 2001
Prostanoid Receptor Gene Expression Profile in Human Trabecular Meshwork: A Quantitative Real-Time PCR Approach
Author Affiliations
  • Willem Kamphuis
    From the Glaucoma Research Group, Netherlands Ophthalmic Research Institute (NORI)-KNAW, and the
  • Andrea Schneemann
    From the Glaucoma Research Group, Netherlands Ophthalmic Research Institute (NORI)-KNAW, and the
  • Luc M. van Beek
    Department of Ophthalmology, Leiden University Medical Centre, The Netherlands.
  • August B. Smit
    Department of Molecular and Cellular Neurobiology, Research Institute of the Neurosciences Vrije Universiteit, Graduate School of the Neurosciences, Amsterdam, The Netherlands; and the
  • Philip F. J. Hoyng
    From the Glaucoma Research Group, Netherlands Ophthalmic Research Institute (NORI)-KNAW, and the
  • Eisuke Koya
    Department of Molecular and Cellular Neurobiology, Research Institute of the Neurosciences Vrije Universiteit, Graduate School of the Neurosciences, Amsterdam, The Netherlands; and the
Investigative Ophthalmology & Visual Science December 2001, Vol.42, 3209-3215. doi:
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Willem Kamphuis, Andrea Schneemann, Luc M. van Beek, August B. Smit, Philip F. J. Hoyng, Eisuke Koya; Prostanoid Receptor Gene Expression Profile in Human Trabecular Meshwork: A Quantitative Real-Time PCR Approach. Invest. Ophthalmol. Vis. Sci. 2001;42(13):3209-3215.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To assess the expression pattern of prostanoid receptor–encoding genes in trabecular meshwork (TM) of human donor eyes.

methods. Disposed human donor eyes (n = 10) were obtained from the Cornea Bank, Amsterdam. The TM was dissected from the scleral tissue and homogenized in lysis buffer, and total RNA was isolated. The RNA was converted into cDNA and used as a template for noncompetitive quantitative real-time polymerase chain reaction (PCR) using green fluorescent dye to quantify the accumulation of double-stranded PCR product. Specific primers for four housekeeping genes and DP, EP1, EP2, EP3, EP4, FP, IP, and TP receptor–encoding transcripts were developed and tested for their efficiency.

results. The characterized expression profile was highly reproducible in all samples, with the EP2 receptor–encoding transcript in the highest abundance, followed by FP, TP, IP, and EP4 at levels that were approximately 10 to 15 times lower than that of the EP2 subtype. DP and EP3 were at the lowest levels, which were, on average, 45 times and 228 times lower than EP2, respectively.

conclusions. These data show that all prostanoid receptors are expressed at different levels in human TM tissue. Because the gene expression of the EP2 receptor is, on average, 15 times more abundant than that of the EP4 receptor, it may be expected that the increase in flow and cAMP levels in response to the activation of the EP receptors by application of prostaglandin E1 (PGE1), is primarily mediated by the EP2 receptor. These data should be considered when designing prostanoid receptor mimetics intended to enhance the aqueous humor outflow through the TM and Schlemm’s canal.

The relationship between intraocular pressure (IOP) and the process of retinal ganglion cell loss in glaucoma remains to be established, but an increased pressure is considered to be at least a significant risk factor for the impairment of the visual field. Elevated IOP levels may result from reduced outflow of aqueous humor through the trabecular meshwork (TM) and Schlemm’s canal, 1 2 for which a mechanical obstruction may be the cause, but, in most cases, the reason for the functional impairment of outflow is unclear. To regulate elevated IOP levels, prostaglandin (PG) receptor agonists are frequently applied as a means of pharmacologic intervention. 3 4 For instance, the prostaglandin PGF analogue latanoprost, has been shown to reduce the IOP by 27% to 35% by facilitating uveoscleral outflow. 3 5 6 7 Furthermore, in diverse experimental models, agonists for other prostanoid receptors have also been shown to reduce the IOP. 8 9 10 11 12  
Prostaglandins are arachidonic acid metabolites that have an important auto- and paracrine role in both physiological and pathophysiological processes. 13 Human TM cells in culture produce PGE2 and PGF, and these prostaglandins may therefore play a role in IOP regulation. 14 Prostaglandins exert their effects through activation of different prostaglandin receptors, which are classified according to their endogenous ligands: DP, EP, FP, IP, and TP receptors. The EP receptor is further subdivided into EP1, EP2, EP3, and EP4 subtypes, with additional heterogeneity created by alternative splicing of the EP3 transcript. 15 Each of these receptors has been cloned, expressed, and characterized. 13  
Recently, we reported that the flow through the TM of perfused human anterior segments is increased by 26% after application of PGE1. The simultaneous increase of cAMP levels in the perfusate indicates that the effect of PGE1 is mediated through an adenyl cyclase–dependent pathway activated by either EP2 or EP4 receptors present in the TM. 16 Various techniques have shown the presence of prostanoid receptors in the TM. Immunoreactivity against EP3 and EP4 receptors was localized in porcine TM. 17 FP receptor mRNA and protein were found in monkey, 18 and human TM. 19 Furthermore, in isolated bovine TM strips, AH13205, an EP2 receptor agonist, had a relaxant effect that may be related to the described effect of PGE1 on outflow. 16 20 In contrast, activation of TP receptors induces a contraction of TM. 20 21  
The purpose of the present study was to determine, using reverse transcription (RT)–quantitative polymerase chain reaction (PCR), which of the known prostanoid receptor–encoding genes is expressed in the human TM and to assess the relative level of the genes’ expression. 
Materials and Methods
TM Tissue
Human donor eyes, rejected for corneal transplantation because of corneal opacities or abnormalities of corneal endothelium, were obtained from the Cornea Bank, Amsterdam. No animals were used in this study, and no donor details were revealed other than age, sex, and time of death. Details about the donors (n = 10) are given in Table 1 . TM tissue was obtained as follows: The eye was bisected at the equator and the lens and iris were removed from the anterior segment. The segment was placed in a dish with the inner side up, and the surface over the TM was carefully wiped clean from adherent uveal tissue if still present. Under a dissecting microscope and using fine forceps, TM tissue strips were gently pulled from the corneoscleral cap. To verify whether this preparation procedure yielded clean TM tissue samples, some specimens of the corneoscleral cap were prepared for histologic inspection before and after isolation of the TM. Tissue was fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2), cryoprotected with 30% sucrose in buffer, and frozen. Cryosections were cut and stained with hematoxylin-eosin for light-microscopic inspection. 
cDNA from Human TM
Isolated TM tissue was homogenized, and total RNA was isolated by a single-step method, based on guanidine thiocyanate extraction, according to the manufacturer’s instructions (Ultraspec; Biotecx Laboratories, Inc., Houston, TX). The isolated RNA was dissolved in a volume of 10 μl diethylpyrocarbonate-treated water. In a series of preliminary trials, the concentration of RNA was spectrophotometrically determined and was found to be on the order of 1 to 2 μg total RNA per isolated TM. To enhance the yield of total RNA, 20 μg yeast transfer (t)RNA was added to facilitate precipitation of the RNA. Because of the limited amount of RNA, the total yield of RNA was transcribed immediately into cDNA without quantification of the RNA concentration. Total RNA was reverse transcribed to cDNA using 100 ng of random primers and 200 U reverse transcriptase (Superscript RT; Life Technologies, Gaithersburg, MD) for 1 hour at 37°C. The cDNA (final volume, 50 μl in 10 mM Tris and 1 mM EDTA) was stored at −20°C until analysis. 
A series of PCRs was performed on TM cDNAs with an intron-spanning primer pair for actin and quantitative real-time PCR–dedicated primers for the detection of the eight different prostanoid receptors. Primer pairs were designed on computer (Primer Express software; Applied Biosystems, Inc., Nieuwekerk aan de IJssel, The Netherlands). The length of the amplicons was kept as close as possible to 80 bp, and the melting temperature of the primers was set at 58°C to 60°C. 22 Details of the primers and the GenBank Accession Numbers are given in Table 2 (GenBank is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD, and is available at http://www.ncbi.nlm.nih.gov/genbank/). Specificity was checked in a BLAST search. For the EP1, EP3, FP, and TP receptors, alternative splicing has been described in the C-terminal region, 13 and primer design was therefore avoided in these regions. The conventional end-point PCR for β-actin was performed under the following conditions: annealing at 60°C, elongation at 74°C, and denaturing at 94°C, at 90 seconds for each step. Mg2+ concentration (1.5 mM), and 0.75 U Taq DNA polymerase (Qiagen-Westburg, Leusden, The Netherlands). The resultant PCR products were analyzed by agarose gel electrophoresis, and single bands of the anticipated size were found. For control purposes, mock cDNA samples without total RNA were prepared and subjected to PCR amplification. These samples yielded no PCR products. 
Quantitative Real-Time PCR
Principles of Quantitative Real-Time PCR.
The quantitative assessment of mRNA levels is performed using a detection system (Prism 7700 Sequence Detection System; Applied Biosystems Inc.) dedicated to the real-time monitoring of nucleic acid green dye fluorescence (SYBR Green I; Applied Biosystems Inc.). This dye is added to the PCR mixture and is fluorescent only when bound to double-stranded (ds)DNA, allowing measurement of the progressive accumulation of the specifically amplified product in the course of the PCR. A passive reference dye (ROX) is included in the PCR buffer providing an internal reference to which the fluorescent green dsDNA complex signal is normalized. This reference dye allows a correction for fluorescent fluctuations caused by non-PCR–related variations in concentration or volume. 
During PCR amplification, the number of molecules synthesized (X n ) depends on the number of template molecules present at the start of the reaction (X 0), the reaction efficiency (E; ideally equal to 2), and the number of amplification rounds (n): X n = X 0 · E n . In quantitative real-time PCR, the parameter cycle threshold (C t) is defined as the fractional cycle number at which the green fluorescence passes the statistically significant level of 10 times the SD of the baseline emission during the first 10 cycles of the PCR. This point is reached during the exponential phase of amplification and is not affected by accumulated PCR product or the reaction components’, such as dNTPs, becoming limited. The number of molecules synthesized at C t is constant (C) despite different starting amounts 23 : X C t = X 0 · E C t X 0 = C · E C t . To facilitate presentation of the results on absolute amounts, we set C at 1010
Preliminary experiments were performed to establish the amplification efficiency (E) for each of the primer pairs, to allow a direct comparison of the expression levels of the different prostaglandin receptor genes. 23 A dilution range in water of a cDNA sample, prepared by pooling a fraction of the cDNAs of all individual samples included in this study, was subjected to PCR. C t is related to the logarithm of the dilution factor, and the slope of the best-fit line is a measure for the reaction efficiency E = 10−(1/slope) according to the manufacturer’s instructions. These preliminary experiments were also performed to determine the optimal dilution of the cDNA to position the C t between 15 and 30 cycles, as recommended by the manufacturer. 
To correct for differences in cDNA load between the different TM samples, the target PCR may be normalized to a reference PCR, involving a selected endogenous housekeeping gene. From the C t obtained from the individual donors, E C t is calculated for target and reference. When the PCR reaches C t, the number of amplified molecules for the target PCR and reference PCR are equal: X C t = X 0,target · E C t,target = X 0,reference · E C t,reference . From this, it follows that the ratio of the number of cDNA target molecules over the number of cDNA reference molecules at starting conditions: X 0,target/X 0,reference = E C t,target /E C t . 23  
Detection of Prostanoid Receptor Expression by Quantitative Real-Time PCR.
The final reaction conditions were in 20 μl 1× fluorescent green dye PCR buffer (SYBR Green I; Applied Biosystems Inc.), 3 mM MgCl2, 200 μM dATP, 200 μM dGTP, 200 μM dCTP, 400μ M dUTP, 0.5 U Taq polymerase (AmpliTaq Gold; Roche Molecular Systems Inc., Mannheim, Germany), 0.2 U uracil-N-glycosylase (UNG, AmpErase; Roche Molecular Systems Inc.), 6 pmol primers, and 0.375 μl cDNA, in a total volume of 20 μl. An initial step of 50°C for 2 minutes was used for AmpErase incubation followed by 10 minutes at 95°C to inactivate the AmpErase and to activate the Taq polymerase. Cycling conditions were: melting step at 95°C for 15 seconds and annealing-extension at 59°C for 1 minute, with 43 cycles. All reactions were performed at least in duplicate, and a maximum difference of 0.3 cycles between the C t of the duplicate samples was considered acceptable. When this criterion was not fulfilled, the PCR was repeated. Nontemplate controls were included for each primer pair to check for significant levels of any contaminants. These samples always resulted in a difference of at least eight cycles of the C t, compared with the template-containing samples. 
The samples were subjected to a series of PCRs against four different housekeeping genes. The analyses of these data provide information on the influence of age, enucleation time, postmortem time, and the variation in total amount of cDNA. Subsequently, the samples were analyzed in PCRs, performed in parallel on 96-well plates against the prostaglandin receptors and β-actin gene, which was selected as the reference gene. Data are presented as absolute amount C· E C t with C = 1010. The ratio of the prostaglandin subtypes over β-actin (E C t,target /E C t,β-actin ) was calculated to account for variability in the initial concentration of the total RNA and the conversion efficiency of the RT step. 
Results
The total number of studied donors was 10 (6 male and 4 female). Mean age of the donors was 68.6 years (range, 54–79). The mean interval between time of death and enucleation of the eyes (ENT) was 6.40 hours (range, 3.55–10.45); the mean interval between time of death and start of RNA isolation in the laboratory (PMT) was 18.50 hours (range, 9.45–30). Details are given in Table 1
Histologic examination of the isolated TM tissue and of the scleral cap after removing the TM tissue showed that most of the uveal, corneoscleral, and juxtacanicular regions were removed as illustrated in Figure 1 . The scleral lining of Schlemm’s canal was not isolated nor were parts of the anterior nonfiltering region of the TM near Schwalbe’s line. 
In a preliminary series of RT-PCR experiments on cDNA samples prepared from isolated total RNA from TMs, the scores for each transcript were found to be erratic (data not shown). We reasoned that a possible explanation for the inconsistent results was a low yield of total RNA. To improve the amount of isolated RNA, tRNA was added as a precipitation carrier during the isolation procedure. As a result, the amount of amplified product increased for all prostanoid receptors and a consistent PCR pattern was observed. All 10 cDNA samples to be analyzed by quantitative real-time PCR, were first subjected to an actin-specific PCR with intron-spanning primers. All cases showed a single amplification product, which confirmed the absence of contaminating genomic DNA. The results are shown in Figure 2 . The specific amplification products of prostanoid receptors that could be obtained from a cDNA sample, prepared by pooling a fraction of the cDNAs of all individual samples included in this study, are presented in Figure 2 . Moreover, the real-time detection of dsDNA allows construction of a dissociation curve at the end of the PCR run by ramping the temperature of the sample from 60°C to 95°C while continuously collecting fluorescence data. The curves of the melting profiles of prostanoid receptors and housekeeping genes did not reveal an accumulation of primer dimers (data not shown). 
The selection of the housekeeping gene to be used as the reference gene in a quantitative real-time PCR approach is a matter of ongoing debate. 22 We set out to test four different housekeeping genes that are often used for normalization 22 : glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, hypoxanthine phosphoribosyltransferase (HPRT), and major histocompatibility complex (MHC) class 1. 24 The amplification efficiency of the different PCRs was established on a dilution range of the pooled cDNA. C t was highly correlated with the dilution factor. The reaction efficiency (E) was derived from these data for all primer combinations, and all had values close to 2 (Table 3)
The absolute amount (E C t ) of each housekeeping gene in all individual samples was determined. The mean of the 10 samples is presented in Figure 3 . The order of abundance was identical in all 10 TM cDNA samples: HPRT had the lowest abundance; the level of MHC was, on average, 98 times that of HPRT; the level of β-actin was 145 times that of HPRT; and the abundance of GAPDH was 459 times more than that of HPRT. These levels are in agreement with the frequency with which MHC (1×),β -actin (2×), and GAPDH (11×) were encountered in a screening of a human TM cDNA bank. 24 Levels were significantly different from each other (paired Student’s t-test; β-actin versus MHC, P ≤ 0.037; all other comparisons, P < 0.001). For all levels of housekeeping genes, there was a trend between age and decreasing amounts present at higher age: HPRT, R 2 = 0.41; MHC, R 2 = 0.35; β-actin, R 2 = 0.58 (P < 0.02); GAPDH, R 2 = 0.58 (P < 0.02). The coefficient of variance (SD/mean · 100%) for the amount of housekeeping genes was 91% for HPRT, 61% for MHC, 45% forβ -actin, and 106% for GAPDH. The levels of the housekeeping genes showed a trend for a correlation in expression level among each other (R 2 = 0.33–0.87), and the level of variance was indeed reduced by normalization to any of the housekeeping genes within each sample. These results show that the expression profile of the studied housekeeping genes is similar between the samples. However, it must be emphasized that a relatively large variation in the amounts is present, partly explained by the age of the donor, and that normalization to a reference gene has only a limited effect on the variation. We decided to perform the quantitative real-time PCR runs on the prostanoid receptor genes in parallel with a PCR on β-actin, which was selected for use as an optional reference gene for normalization. 
The expression profile of the prostanoid receptors and β-actin genes in terms of absolute amounts (Table 4) revealed a rather uniform expression profile in the TM samples. In all samples β-actin was the most abundant (mean amount, 4660) followed in all samples by EP2 (1674) and at lower levels FP (175), TP (156), EP4 (136), IP (134), EP1 (105), DP (40), and EP3 (9). The levels of β-actin again showed a significant inverse correlation with age (R 2 = 0.68; P < 0.05; Fig. 4 ), but the prostanoid receptor levels showed no such correlation. As would be expected from these data, normalizing to the β-actin levels enhanced the coefficient of variation, making such an approach ineffective. For the final analysis, the total expression of the prostanoid receptor genes was calculated (Table 4) and set at 100%. This total did not correlate with age (R 2 = 0.17). Subsequently, the relative contributions as a fraction of this total of each prostanoid receptor subtype were determined for each sample. This calculation resulted in a clear reduction of the coefficient of variation. The outcome of this analysis is presented in Figure 5 . Statistical analysis showed significant differences in expression between EP3 and DP (0.4% ± 0.2% [mean ± SD] vs. 1.8% ± 0.7%; P < 0.00001, paired Student’s t-test), DP and EP1 (1.8%± 0.7% vs. 4.4% ± 1.6%; P < 0.00003), and EP1 and EP4 (4.4% ± 1.6% vs. 5.6% ± 2.2%; P < 0.024). The levels of EP4 (5.6% ± 2.2%), IP (6.4% ± 2.6%), TP (6.5% ± 3.3%), and FP (7.4% ± 2.7%) were not significantly different from each other. The EP2 levels (67.6%± 10.7%) were, on average, 10 times of that of FP, a highly significant difference from all other prostanoid receptors (P < 0.00001). 
Discussion
The main result of this study using quantitative real-time PCR was the finding that all the cloned prostanoid receptors were expressed in human TM tissue in a reproducible pattern that was observed in all samples. The expression profile shows differential gene expression levels with the EP2 receptor–encoding transcript present in the highest abundance, followed by FP, TP, IP, and EP4, at levels that were approximately 10 to 15 times lower than that of EP2. DP and EP3 were present at the lower levels, which were on average 45 times and 228 times lower than EP2, respectively. 
Quantitative real-time PCR was performed on random primer–generated cDNA, which allows a greater freedom of primer design that is not limited to the 3′ end of the mRNA. The interpretation of the data in terms of expression levels of different transcripts assumes the same efficiency of the RT reaction for each of the transcripts. This premise is difficult to deal with in a completely satisfactory way, but we obtained similar prostanoid receptor expression profiles from TM cDNA primed with oligo dT (data not shown). Calibration strategies in quantitative real-time PCR often rely on normalization against the levels of a housekeeping gene, and we set out to use this approach. It has been reported that postmortem interval has, at most, only a modest effect on RNA levels 25 and, in line with this view, no effects were found of either enucleation or postmortem interval on prostanoid receptor gene expression. However, for two of the investigated housekeeping genes, β-actin and GAPDH, there was a significant correlation between age and decreasing levels. Age-dependent shifts in specific protein concentration in human TM tissue have been reported, with the decrease of a protein tentatively identified as actin with increasing age. 26 Normalization against our housekeeping gene of choice (β-actin) was ineffective. No correlation with age was found for the prostanoid receptor subtype–encoding genes, and we therefore normalized against the total level of the eight prostanoid receptor genes. 
We conclude that the steady state transcript levels of the prostanoid receptor genes are set at different levels, and that the pattern of expression does not alter with age in the range included in our study (54–79 years). Because the gene expression of the EP2 receptor was, on average, 15 times (range, 6–25) more than that of the EP4 receptor, it may be concluded that the increase in flow and cAMP levels in response to the activation of the EP receptors by application of PGE1 is primarily mediated by the EP2 receptor. 16 The relatively high expression levels in the TM of EP2 mRNA compared with EP4 mRNA in the TM may be an exceptional situation, because in most tissues of the mouse, EP2 mRNA is expressed at much lower levels than EP4 mRNA, which may be related to the fact that the TM is a nonvascularized tissue. 27 It is also interesting to note that the EP4 receptor was sensitive for agonist-induced desensitization, but that the EP2 receptor was not—a physiological difference that may be of importance for designing pharmacologic intervention strategies to improve outflow through the TM. 28  
The presence in the TM of several prostanoid receptors has been shown by using different morphologic techniques. Immunoreactivity against the EP2 and EP3 receptors has been localized in porcine TM, 17 and the EP3 receptor has been detected in human TM. 4 Immunoreactivity and in situ hybridization have shown the presence of FP in monkey 18 and human TM. 19 A preliminary report on the immunolocalization of EP1 through EP4 and FP describes the expression of all these receptors in human TM. 29 Recently, the pharmacologic profile of the prostanoid receptors positively coupled to stimulation of cAMP levels in immortalized cultured human TM cells has been described. 30 Butaprost, a selective EP2 receptor agonist, is the most potent and efficacious. Because the PGE2-mediated response is inhibited by 20% by the EP4-specific receptor antagonist AH23848B, a small contribution of EP4 receptors is implied. 30 This pharmacologic result corroborates our finding of the predominant contribution of the EP2 receptors to the prostanoid receptors positively coupled to adenylyl cyclase. In the same study, DP and IP receptor agonists were weak or inactive, 30 and to our knowledge, no reports have been published on the localization of DP or IP in TM. Nevertheless, in our current results both genes were expressed in TM. The gene expression of the IP receptor indicates that prostacyclin or prostacyclin analogues may also exert an effect on human TM function by raising the cAMP levels. Topical application of iloprost, a stable prostacyclin analogue, reduces the IOP in rabbits and beagles and increases tonographic outflow facilitation in rabbits. 8  
Functional tests on isolated bovine TM strips have provided additional insight regarding which of the prostanoid receptors is present in this tissue. A relaxing effect of AH13205, an EP2 receptor agonist, has been described that may be related to the described effect of PGE1 on outflow enhancement. 16 20 In contrast, activation of TP receptors induces a contraction of TM. 20 21 Although an extrapolation of PCR data to the protein level has to be made with restraint, the results described herein indicate that the density of the EP2 receptors, with a relaxant flow-enhancing effect, dominates the contraction-mediating TP receptors. 
The ocular hypotensive effect of FP receptor agonists (PGF and latanoprost) is well known. Their effect is based on the increase of flow through the uveoscleral route, with a small effect on the outflow through the TM. 31 32 It has been suggested that the activation of the FP and EP2 receptors in the ciliary muscle leads to cAMP formation, protein kinase activation, and the induction of transcription factors. These responses lead to an increased synthesis of various matrix metalloproteinases (MMPs) and a reduction of extracellular matrix resistance in the uveoscleral outflow pathway. 31 However, in the anterior chamber perfusion model, the ciliary muscle is not present, and PGF has no detectable effect on the flow or cAMP production within the time frame of several hours during which we observed the outflow. 16 33 34 In addition, PGF did not increase adenylyl cyclase activity in membrane fractions of human TM, whereas PGE1 and PGE2 did. 33 This indicates that an activation of FP receptors, implicated from our PCR data and morphologic studies to be present in the TM, 18 19 29 will probably lead to the activation of the phospholipase C pathway, but this does not seem to result in a rapid increase of TM outflow. The precise localization in the human TM and the function of the FP receptors in this tissue remains to be established. 
In conclusion, our studies have provided a characterization of the gene expression profile of the different prostanoid receptor genes in the human TM. The predominant presence of EP2 receptor transcript may provide a basis for a better understanding of the effects of prostaglandin receptor agonists and antagonist on the outflow of aqueous humor through the TM and the regulation of IOP in glaucoma. 
 
Table 1.
 
Details on Studied Donors
Table 1.
 
Details on Studied Donors
Sample Donor Age/Sex ENT (h.min) PMT (h.min)
1 68 F 5.50 22.50
2 75 M 5.00 23.30
3 70 M 3.55 20.55
4 54 M 6.35 9.45
5 63 F 10.45 15.15
6 70 M 7.15 9.45
7 69 F 8.45 30.00
8 79 F 4.40 17.40
9 66 M 7.30 20.00
10 72 M 6.30 19.00
Table 2.
 
GenBank Accession Code, Sequence of PCR Primer Pairs, and Anticipated Size of the Amplified Product for the Prostanoid Receptor Types and Housekeeping Genes
Table 2.
 
GenBank Accession Code, Sequence of PCR Primer Pairs, and Anticipated Size of the Amplified Product for the Prostanoid Receptor Types and Housekeeping Genes
Receptor Subtype Accession Code Upstream Primer Downstream Primer Amplicon Length (bp)
actin XM010801 CTGGAGAAGAGCTATGAGCTG ATCTCCTTCTGCATCCTGTC 245
DP U31332 TCTGCGCGCTACCTTTCATG TCCTCGTGGACCATCTGGATA 85
EP1 L22647 GATGGTGGGCCAGCTTGTC GCCACCAACACCAGCATTG 72
EP2 U19487 GTGCTGACAAGGCACTTCATGT TGTTCCTCCAAAGGCCAAGTAC 87
EP3 U13214 AAGGCCACGGCATCTCAGT TGATCCCCATAAGCTGAATGG 76
EP4 NM000958 CTTGGAGGCAGGAATTTGCTT AAAGTCCTCAGTGAGGTGGTGTCT 96
FP L24470 GCACATTGATGGGCAACTAGAA GCACCTATCATTGGCATGTAGCT 90
IP L29016 GCCGATCAGCTGCTGTTTCT TTTCCTCTGTCCCTCACTCTCTTC 74
TP D38081 ACGGAGAAGGAGCTGCTCATC GCGGCGGAACAGGATATACA 84
GAPDH M33197 TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGA 87
β-actin XM004814 GCTCCTCCTGAGCGCAAG CATCTGCTGGAAGGTGGACA 75
HPRT M31642 ATGGGAGGCCATCACATTGT ATGTAATCCAGCAGGTCAGCAA 77
MHC class 1 BC004489 CACACCTCTCCTTTGTGACTTCAA CCACCTCCTCACATTATGCTAACA 98
Figure 1.
 
Photomicrograph of cryosections from the corneoscleral cap, with intact TM (A) and after isolation (B). The relatively large diameter of Schlemm’s canal and the loose arrangement of the trabecular lamellae in the donor tissue may be because immersion fixation was used, and thus the normally present IOP was lost. 35 ACh, anterior chamber; C, cornea; Sc, sclera; SSP, scleral spur; SCa, Schlemm’s canal; and SLi, Schwalbe’s line. Bar, 200 μm.
Figure 1.
 
Photomicrograph of cryosections from the corneoscleral cap, with intact TM (A) and after isolation (B). The relatively large diameter of Schlemm’s canal and the loose arrangement of the trabecular lamellae in the donor tissue may be because immersion fixation was used, and thus the normally present IOP was lost. 35 ACh, anterior chamber; C, cornea; Sc, sclera; SSP, scleral spur; SCa, Schlemm’s canal; and SLi, Schwalbe’s line. Bar, 200 μm.
Figure 2.
 
Top: the results for all 10 TM cDNA samples of a conventional endpoint PCR against actin, using intron-spanning primers. Note the presence of a single band demonstrating the absence of contaminating genomic DNA. Lane 11: nontemplate control, using a sample that underwent all procedures, except the presence of isolated TM tissue in the homogenization buffer. Bottom: the results of a PCR using the different prostaglandin receptor primer pairs and one housekeeping gene (MHC) on a pooled sample of the 10 TM cDNAs. Lane bl: nontemplate control run.
Figure 2.
 
Top: the results for all 10 TM cDNA samples of a conventional endpoint PCR against actin, using intron-spanning primers. Note the presence of a single band demonstrating the absence of contaminating genomic DNA. Lane 11: nontemplate control, using a sample that underwent all procedures, except the presence of isolated TM tissue in the homogenization buffer. Bottom: the results of a PCR using the different prostaglandin receptor primer pairs and one housekeeping gene (MHC) on a pooled sample of the 10 TM cDNAs. Lane bl: nontemplate control run.
Table 3.
 
Amplification Efficiency Constant (E) for the PCRs and Corresponding Correlation Coefficients
Table 3.
 
Amplification Efficiency Constant (E) for the PCRs and Corresponding Correlation Coefficients
PCR E R 2
DP 1.91 0.998
EP1 1.87 0.980
EP2 1.78 0.973
EP3 1.89 0.968
EP4 1.85 0.993
FP 1.92 0.991
IP 1.88 0.996
TP 1.82 0.966
β-actin 1.93 0.997
HPRT 2.00 0.965
MHC class 1 1.99 0.994
GAPDH 2.00 0.999
Figure 3.
 
Mean levels ± SD of housekeeping genes in the 10 TM cDNA samples. Vertical axis is a log scale.
Figure 3.
 
Mean levels ± SD of housekeeping genes in the 10 TM cDNA samples. Vertical axis is a log scale.
Table 4.
 
Absolute Expression Levels (C · E −C t ) of β-Actin, Prostanoid Receptor Subtypes, and the Total Expression of All Prostanoid Receptor Subtypes
Table 4.
 
Absolute Expression Levels (C · E −C t ) of β-Actin, Prostanoid Receptor Subtypes, and the Total Expression of All Prostanoid Receptor Subtypes
β-Actin DP EP1 EP2 EP3 EP4 FP IP TP Total Receptors
1 3783 106 275 3057 33 427 429 380 443 5150
2 1909 25 74 893 5 87 97 88 37 1305
3 3935 39 116 1009 10 175 187 164 226 1927
4 9353 57 145 2970 10 202 300 164 231 4080
5 4937 13 31 475 4 33 39 56 76 726
6 7018 51 169 2894 7 113 212 123 221 3790
7 6550 36 98 2820 9 154 187 102 110 3516
8 1249 35 75 529 7 81 146 99 96 1068
9 4357 30 51 1445 5 57 96 83 100 1866
10 3507 9 19 646 2 36 55 85 22 875
Mean± SD 4660 ± 2430 40 ± 28 105 ± 76 1674 ± 1121 9 ± 9 136 ± 117 175 ± 119 134 ± 93 156 ± 127 2430 ± 1569
CV (%) 52 69 72 67 95 86 68 69 81 65
Figure 4.
 
Linear correlation between the age of the donor and the amount ofβ -actin levels in the cDNA sample. Spearman correlation coefficient, R 2 = 0.68 (P < 0.05).
Figure 4.
 
Linear correlation between the age of the donor and the amount ofβ -actin levels in the cDNA sample. Spearman correlation coefficient, R 2 = 0.68 (P < 0.05).
Figure 5.
 
Mean ± SD contribution of the prostaglandin receptor subtypes to the total expression level of the prostanoid receptors set at 100%. Statistical analysis with paired Student’s t-test showed significant differences in expression between EP3 and DP (P < 0.00001), DP and EP1 (P < 0.00003), and EP1 and EP4 (P < 0.024). The levels of EP4, IP, TP, and FP were not significantly different from each other. The EP2 levels (67.6%) were, on average, 10 times of that of FP (P < 0.00001).
Figure 5.
 
Mean ± SD contribution of the prostaglandin receptor subtypes to the total expression level of the prostanoid receptors set at 100%. Statistical analysis with paired Student’s t-test showed significant differences in expression between EP3 and DP (P < 0.00001), DP and EP1 (P < 0.00003), and EP1 and EP4 (P < 0.024). The levels of EP4, IP, TP, and FP were not significantly different from each other. The EP2 levels (67.6%) were, on average, 10 times of that of FP (P < 0.00001).
The authors thank the collaborators at the Cornea Bank, Amsterdam, for their crucial contribution. 
Lütjen-Drecoll E. Functional morphology of the trabecular meshwork in primate eyes. Prog Retinal Eye Res. 1998;18:91–119.
Francis BA, Alvarado J. The cellular basis of aqueous outflow regulation. Curr Opin Ophthalmol. 1997;8:19–27.
Hoyng PFJ, Van Beek LM. Pharmacological therapy for glaucoma: a review. Drugs. 2000;59:411–434. [CrossRef] [PubMed]
Woodward DF, Regan JW, Lake S, Ocklind A. The molecular biology and ocular distribution of prostanoid receptors. Surv Ophthalmol. 1997;41:S15–S21. [CrossRef] [PubMed]
Camras CB, Alm A, Watson P, Stjernschantz J. Latanoprost, a prostaglandin analog, for glaucoma therapy: efficacy and safety after 1 year of treatment in 198 patients.Latanoprost Study Groups. Ophthalmology. 1996;103:1916–1924. [CrossRef] [PubMed]
Rulo AH, Greve EL, Hoyng PF. Additive effect of latanoprost, a prostaglandin F analogue, and timolol in patients with an elevated intraocular pressure. Br J Ophthalmol. 1994;78:899–902. [CrossRef] [PubMed]
Lindén C, Alm A. Prostaglandin analogues in the treatment of glaucoma. Drug Aging. 1999;14:387–398. [CrossRef]
Hoyng PF, De Jong N. Iloprost, a stable prostacyclin analog, reduces intraocular pressure. Invest Ophthalmol Vis Sci. 1987;28:470–476. [PubMed]
Bhattacherjee P, Williams BS, Paterson CA. Responses of intraocular pressure and the pupil of feline eyes to prostaglandin EP1 and FP receptor agonists. Invest Ophthalmol Vis Sci. 1999;40:3047–3053. [PubMed]
Wang R-F, Lee P-Y, Podos SM, Serle JB, Becker B. Effect of 8-iso prostaglandin E2 on aqueous humor dynamics in monkeys. Arch Ophthalmol. 1998;116:1213–1216. [CrossRef] [PubMed]
Waterbury LD, Eglen RM, Taurot GF, Cooper GF. EP3, but not EP2, FP, or TP prostanoid-receptor stimulation may reduce intraocular pressure. Invest Ophthalmol Vis Sci. 1990;31:2560–2567. [PubMed]
Woodward DF, Hawley SB, Williams LS, et al. Studies on the ocular pharmacology of prostaglandin D2. Invest Ophthalmol Vis Sci. 1990;31:138–146. [PubMed]
Breyer RM, Bagdassarian CK, Myers SA, Breyer MD. Prostanoid receptors: subtypes and signaling. Annu Rev Pharmacol Toxicol. 2001;41:661–690. [CrossRef] [PubMed]
Polansky JR, Kurtz RM, Alvarado JA, Weinreb RN, Mitchell MD. Eicosanoid production and glucocorticoid regulatory mechanisms in cultured human trabecular meshwork cells. Prog Clin Biol Res. 1989;312:113–138. [PubMed]
Coleman RA, Smith WL, Narumiya S., VIII. International union of pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol Rev. 1994;46:205–229. [PubMed]
Dijkstra BG, Schneemann A, Hoyng PF. Flow after prostaglandin E1 is mediated by receptor-coupled adenylyl cyclase in human anterior segments. Invest Ophthalmol Vis Sci. 1999;40:2622–2626. [PubMed]
Zhao C, Fujimoto N, Shichi H. Immunocytochemical localization of prostaglandin E2 receptor subtypes in porcine ocular tissues. I: uveal tissues. J Ocul Pharmacol Ther. 1995;11:421–435. [CrossRef] [PubMed]
Ocklind A, Lake S, Wentzel P, Nistér M, Stjernschantz J. Localization of the prostaglandin F receptor messenger RNA and protein in the cynomolgus monkey eye. Invest Ophthalmol Vis Sci. 1996;37:716–726. [PubMed]
Anthony TL, Pierce KL, Stamer WD, Regan JW. Prostaglandin F receptors in the human trabecular meshwork. Invest Ophthalmol Vis Sci. 1998;39:315–321. [PubMed]
Krauss AH, Wiederholt M, Woodward DF. Prostaglandin effects on the contractility of bovine trabecular meshwork and ciliary muscle. Exp Eye Res. 1997;64:447–453. [CrossRef] [PubMed]
Wiederholt M, Thieme H, Stumpff F. The regulation of trabecular meshwork and ciliary muscle contractility. Prog Retinal Eye Res. 2000;19:271–295. [CrossRef]
Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol. 2000;25:169–193. [CrossRef] [PubMed]
Meijerink J, Mandigers C, van De Locht L, Tonnissen E, Goodsaid F, Raemaekers J. A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR. J Mol Diagn. 2001;3:55–61. [CrossRef] [PubMed]
Gonzalez P, Epstein DL, Borrás T. Characterization of gene expression in human trabecular meshwork using single-pass sequencing of 1060 clones. Invest Ophthalmol Vis Sci. 2000;41:3678–3693. [PubMed]
Barton AJL, Pearson RCA, Najlerahim A, Harrison PJ. Pre- and postmortem influences on brain RNA. J Neurochem. 1993;61:1–11. [PubMed]
Millard CB, Tripathi BJ, Tripathi RC. Age-related changes in protein profiles of the normal human trabecular meshwork. Exp Eye Res. 1987;45:623–631. [CrossRef] [PubMed]
Katsuyama M, Nishigaki N, Sugimoto Y, et al. The mouse prostaglandin E receptor EP2 subtype: cloning, expression, and northern blot analysis. FEBS Lett. 1995;372:151–156. [CrossRef] [PubMed]
Nishigaki N, Negishi M, Ichikawa A. Two Gs-coupled prostaglandin E receptor subtypes, EP2 and EP4, differ in desensitization and sensitivity to the metabolic inactivation of the agonist. Mol Pharmacol. 1996;50:1031–1037. [PubMed]
Schloetzer-Schrehardt UM, Nuesing RM, Naumann GOH. Immunolocalization of prostaglandin E2 and F2 alpha receptor proteins in human ocular tissues. Invest Ophthalmol Vis Sci. 2000;41(4)S250.Abstract nr 1315
Crider JY, Sharif NA. Functional pharmacological evidence for EP2 and EP4 prostanoid receptors in immortalized human trabecular meshwork and non-pigmented ciliary epithelial cells. J Ocul Pharmacol Ther. 2001;17:35–46. [CrossRef] [PubMed]
Schachtschabel U, Lindsey JD, Weinreb RN. The mechanisms of action of prostaglandins on uveoscleral outflow. Curr Opin Ophthalmol. 2000;11:112–115. [CrossRef] [PubMed]
Mishima HK, Kiuchi Y, Takamatsu M, Racz P, Bittigau P. Circadian intraocular pressure management with latanoprost: diurnal and nocturnal intraocular pressure reduction and increased uveoscleral outflow (review). Surv Ophthalmol. 1997;41:S139–S144. [CrossRef] [PubMed]
Dijkstra BG, Ruijter JM, Hoyng PF. Outflow characteristics of isolated anterior segments of human eyes. Invest Ophthalmol Vis Sci. 1996;37:2015–2021. [PubMed]
Busch MJWM, Kobayashi K, Hoyng PFJ, Mittag TW. Adenylyl cyclase in human and bovine trabecular meshwork. Invest Ophthalmol Vis Sci. 1993;34:3028–3034. [PubMed]
Ten Hulzen RD, Johnson DH. Effect of fixation pressure on juxtacanalicular tissue and Schlemm’s canal. Invest Ophthalmol Vis Sci. 1996;37:114–124. [PubMed]
Figure 1.
 
Photomicrograph of cryosections from the corneoscleral cap, with intact TM (A) and after isolation (B). The relatively large diameter of Schlemm’s canal and the loose arrangement of the trabecular lamellae in the donor tissue may be because immersion fixation was used, and thus the normally present IOP was lost. 35 ACh, anterior chamber; C, cornea; Sc, sclera; SSP, scleral spur; SCa, Schlemm’s canal; and SLi, Schwalbe’s line. Bar, 200 μm.
Figure 1.
 
Photomicrograph of cryosections from the corneoscleral cap, with intact TM (A) and after isolation (B). The relatively large diameter of Schlemm’s canal and the loose arrangement of the trabecular lamellae in the donor tissue may be because immersion fixation was used, and thus the normally present IOP was lost. 35 ACh, anterior chamber; C, cornea; Sc, sclera; SSP, scleral spur; SCa, Schlemm’s canal; and SLi, Schwalbe’s line. Bar, 200 μm.
Figure 2.
 
Top: the results for all 10 TM cDNA samples of a conventional endpoint PCR against actin, using intron-spanning primers. Note the presence of a single band demonstrating the absence of contaminating genomic DNA. Lane 11: nontemplate control, using a sample that underwent all procedures, except the presence of isolated TM tissue in the homogenization buffer. Bottom: the results of a PCR using the different prostaglandin receptor primer pairs and one housekeeping gene (MHC) on a pooled sample of the 10 TM cDNAs. Lane bl: nontemplate control run.
Figure 2.
 
Top: the results for all 10 TM cDNA samples of a conventional endpoint PCR against actin, using intron-spanning primers. Note the presence of a single band demonstrating the absence of contaminating genomic DNA. Lane 11: nontemplate control, using a sample that underwent all procedures, except the presence of isolated TM tissue in the homogenization buffer. Bottom: the results of a PCR using the different prostaglandin receptor primer pairs and one housekeeping gene (MHC) on a pooled sample of the 10 TM cDNAs. Lane bl: nontemplate control run.
Figure 3.
 
Mean levels ± SD of housekeeping genes in the 10 TM cDNA samples. Vertical axis is a log scale.
Figure 3.
 
Mean levels ± SD of housekeeping genes in the 10 TM cDNA samples. Vertical axis is a log scale.
Figure 4.
 
Linear correlation between the age of the donor and the amount ofβ -actin levels in the cDNA sample. Spearman correlation coefficient, R 2 = 0.68 (P < 0.05).
Figure 4.
 
Linear correlation between the age of the donor and the amount ofβ -actin levels in the cDNA sample. Spearman correlation coefficient, R 2 = 0.68 (P < 0.05).
Figure 5.
 
Mean ± SD contribution of the prostaglandin receptor subtypes to the total expression level of the prostanoid receptors set at 100%. Statistical analysis with paired Student’s t-test showed significant differences in expression between EP3 and DP (P < 0.00001), DP and EP1 (P < 0.00003), and EP1 and EP4 (P < 0.024). The levels of EP4, IP, TP, and FP were not significantly different from each other. The EP2 levels (67.6%) were, on average, 10 times of that of FP (P < 0.00001).
Figure 5.
 
Mean ± SD contribution of the prostaglandin receptor subtypes to the total expression level of the prostanoid receptors set at 100%. Statistical analysis with paired Student’s t-test showed significant differences in expression between EP3 and DP (P < 0.00001), DP and EP1 (P < 0.00003), and EP1 and EP4 (P < 0.024). The levels of EP4, IP, TP, and FP were not significantly different from each other. The EP2 levels (67.6%) were, on average, 10 times of that of FP (P < 0.00001).
Table 1.
 
Details on Studied Donors
Table 1.
 
Details on Studied Donors
Sample Donor Age/Sex ENT (h.min) PMT (h.min)
1 68 F 5.50 22.50
2 75 M 5.00 23.30
3 70 M 3.55 20.55
4 54 M 6.35 9.45
5 63 F 10.45 15.15
6 70 M 7.15 9.45
7 69 F 8.45 30.00
8 79 F 4.40 17.40
9 66 M 7.30 20.00
10 72 M 6.30 19.00
Table 2.
 
GenBank Accession Code, Sequence of PCR Primer Pairs, and Anticipated Size of the Amplified Product for the Prostanoid Receptor Types and Housekeeping Genes
Table 2.
 
GenBank Accession Code, Sequence of PCR Primer Pairs, and Anticipated Size of the Amplified Product for the Prostanoid Receptor Types and Housekeeping Genes
Receptor Subtype Accession Code Upstream Primer Downstream Primer Amplicon Length (bp)
actin XM010801 CTGGAGAAGAGCTATGAGCTG ATCTCCTTCTGCATCCTGTC 245
DP U31332 TCTGCGCGCTACCTTTCATG TCCTCGTGGACCATCTGGATA 85
EP1 L22647 GATGGTGGGCCAGCTTGTC GCCACCAACACCAGCATTG 72
EP2 U19487 GTGCTGACAAGGCACTTCATGT TGTTCCTCCAAAGGCCAAGTAC 87
EP3 U13214 AAGGCCACGGCATCTCAGT TGATCCCCATAAGCTGAATGG 76
EP4 NM000958 CTTGGAGGCAGGAATTTGCTT AAAGTCCTCAGTGAGGTGGTGTCT 96
FP L24470 GCACATTGATGGGCAACTAGAA GCACCTATCATTGGCATGTAGCT 90
IP L29016 GCCGATCAGCTGCTGTTTCT TTTCCTCTGTCCCTCACTCTCTTC 74
TP D38081 ACGGAGAAGGAGCTGCTCATC GCGGCGGAACAGGATATACA 84
GAPDH M33197 TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGA 87
β-actin XM004814 GCTCCTCCTGAGCGCAAG CATCTGCTGGAAGGTGGACA 75
HPRT M31642 ATGGGAGGCCATCACATTGT ATGTAATCCAGCAGGTCAGCAA 77
MHC class 1 BC004489 CACACCTCTCCTTTGTGACTTCAA CCACCTCCTCACATTATGCTAACA 98
Table 3.
 
Amplification Efficiency Constant (E) for the PCRs and Corresponding Correlation Coefficients
Table 3.
 
Amplification Efficiency Constant (E) for the PCRs and Corresponding Correlation Coefficients
PCR E R 2
DP 1.91 0.998
EP1 1.87 0.980
EP2 1.78 0.973
EP3 1.89 0.968
EP4 1.85 0.993
FP 1.92 0.991
IP 1.88 0.996
TP 1.82 0.966
β-actin 1.93 0.997
HPRT 2.00 0.965
MHC class 1 1.99 0.994
GAPDH 2.00 0.999
Table 4.
 
Absolute Expression Levels (C · E −C t ) of β-Actin, Prostanoid Receptor Subtypes, and the Total Expression of All Prostanoid Receptor Subtypes
Table 4.
 
Absolute Expression Levels (C · E −C t ) of β-Actin, Prostanoid Receptor Subtypes, and the Total Expression of All Prostanoid Receptor Subtypes
β-Actin DP EP1 EP2 EP3 EP4 FP IP TP Total Receptors
1 3783 106 275 3057 33 427 429 380 443 5150
2 1909 25 74 893 5 87 97 88 37 1305
3 3935 39 116 1009 10 175 187 164 226 1927
4 9353 57 145 2970 10 202 300 164 231 4080
5 4937 13 31 475 4 33 39 56 76 726
6 7018 51 169 2894 7 113 212 123 221 3790
7 6550 36 98 2820 9 154 187 102 110 3516
8 1249 35 75 529 7 81 146 99 96 1068
9 4357 30 51 1445 5 57 96 83 100 1866
10 3507 9 19 646 2 36 55 85 22 875
Mean± SD 4660 ± 2430 40 ± 28 105 ± 76 1674 ± 1121 9 ± 9 136 ± 117 175 ± 119 134 ± 93 156 ± 127 2430 ± 1569
CV (%) 52 69 72 67 95 86 68 69 81 65
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×