December 2001
Volume 42, Issue 13
Free
Biochemistry and Molecular Biology  |   December 2001
Organization of the Human IMPG2 Gene and Its Evaluation as a Candidate Gene in Age-Related Macular Degeneration and Other Retinal Degenerative Disorders
Author Affiliations
  • Markus H. Kuehn
    From the Department of Ophthalmology and Visual Sciences, The University of Iowa Center for Macular Degeneration, Iowa City.
  • Edwin M. Stone
    From the Department of Ophthalmology and Visual Sciences, The University of Iowa Center for Macular Degeneration, Iowa City.
  • Gregory S. Hageman
    From the Department of Ophthalmology and Visual Sciences, The University of Iowa Center for Macular Degeneration, Iowa City.
Investigative Ophthalmology & Visual Science December 2001, Vol.42, 3123-3129. doi:https://doi.org/
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Markus H. Kuehn, Edwin M. Stone, Gregory S. Hageman; Organization of the Human IMPG2 Gene and Its Evaluation as a Candidate Gene in Age-Related Macular Degeneration and Other Retinal Degenerative Disorders. Invest. Ophthalmol. Vis. Sci. 2001;42(13):3123-3129. doi: https://doi.org/.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To characterize the genomic organization of human IMPG2, the gene encoding the retinal interphotoreceptor matrix (IPM) proteoglycan IPM 200, to evaluate its relationship to IPM 150, and to evaluate its involvement in inherited retinopathies, such as age-related macular degeneration, retinitis pigmentosa, and Leber congenital amaurosis.

methods. After isolation of human genomic clones, the structure of IMPG2 was determined by sequence analysis. Mutational analyses were conducted on genomic DNA isolated from 316 probands using single-strand conformation polymorphism analysis.

results. The IMPG2 gene is organized into 19 exons, and the structure of the gene is highly similar to that of the IMPG1 gene, which encodes another retinal proteoglycan, IPM 150. Mutational analyses indicate that the observed sequence changes are present at approximately equal rates in donors with and without retinal disease. Additional data derived from RT-PCR and Northern blot analysis show that IMPG2 is processed in the human retina into multiple alternatively sized transcripts that may represent splicing isoforms.

conclusions. Analysis of the overall relationship of human IMPG2 (located on chromosome 3q12.2-12.3) to human IMPG1 (located on chromosome 6q14) suggests that these genes have evolved from a common ancestral gene. Although this is an excellent candidate gene for hereditary retinopathies, single-strand conformation polymorphism analyses provided no evidence that variations in IMPG2 coding region are responsible for the inherited retinopathies examined.

In previous studies, we have identified and characterized two novel human interphotoreceptor matrix (IPM) proteoglycans, designated IPM 200 1 2 and IPM 150 1 3 4 5 that, together with their associated isoforms, comprise a unique family of extracellular proteins. These molecules were initially identified as constituents of the IPM, an extracellular matrix that surrounds retinal photoreceptor outer segments and ellipsoids. 1 Other reports suggest that IPM 200 may also be expressed in nonocular tissues, including the brain. 6 7  
The IPM is crucial for normal function and viability of retinal photoreceptor cells. It is a likely participant in the exchange of metabolites and catabolic byproducts between the retinal pigment epithelium and photoreceptor cells, the regulation of the subretinal ionic milieu, and the orientation, polarization, and turnover of photoreceptor outer segments. 8 9 10 11 12 IPM proteoglycans have been shown to mediate photoreceptor cell adhesion. 13 14 15 16 IPM 200 and IPM 150 may also mediate photoreceptor cell survival by sequestration of growth factors 10 17 or through the epidermal growth factor (EGF)-like domains contained within their core proteins. 2 3 5  
Photoreceptor cells are highly vulnerable to dysfunction and/or death in various heritable retinal dystrophies and degenerations (reviewed in Ref. 18 ). Nucleotide sequence variations in the genes encoding a number of retinal proteins are associated with the etiologies of various forms of retinal degeneration. For example, mutations in the genes encoding retinal rhodopsin,β -phosphodiesterase, rab geranylgeranyl transferase, rim protein, and the RP1 gene product cause retinal degeneration. 19 20 21 22 23  
Because IPM 200 is expressed at high levels by retinal photoreceptor cells and probably plays a critical role in the maintenance of the interphotoreceptor space, it is reasonable to postulate that sequence variations within its gene, IMPG2, may cause photoreceptor cell dysfunction and/or retinal degeneration. The IMPG2 gene has been mapped to chromosome 3q12.2-12.3 between markers WI3277 and NIB1880. 2 Although no human hereditary diseases have yet been mapped to this interval, IMPG2 is a strong candidate gene for unmapped inherited ocular, or neuronal, disorders, including age-related macular degeneration (AMD). 
AMD is a significant cause of irreversible blindness worldwide. There is strong evidence that a significant proportion of AMD has a genetic foundation, 24 25 26 27 and several AMD loci have been identified. 28 29 In addition, the ApoE4 allele has been shown to be protective for the disease. 30 In this study we screened DNA from patients with abnormalities on both sides of the photoreceptor cell–retinal pigment epithelium interface with a wide range in age of onset, from birth to the ninth decade of life, for mutations in IMPG2. These afflictions include AMD, retinitis pigmentosa (RP), and Leber congenital amaurosis (LCA)—three genetically heterogeneous retinal diseases characterized by photoreceptor cell death. 31 32 33  
Materials and Methods
Identification and Characterization of Genomic Subclones
To identify bacterial artificial chromosome (BAC) clones that contain portions of the IMPG2 gene, several PCR primer pairs were generated based on the IPM 200 cDNA sequence (GenBank accession no. AF173155; GenBank is provided by the National Center for Biotechnology Information and available in the public domain at http://www.ncbi.nlm.nih.gov/genbank). Two of these primer pairs (sense 1: 5′-AAA AAG AAA CAG CCT CTG GAC CGC AG-3′ and antisense 1: 5′-CAG CCT CTG CAA CAC TTT CAT CTG GG-3′, spanning nucleotides 372 to 492 of the IPM 200 cDNA; sense 2: 5′-TCA TTC ACT CAA CCT GTG C-3′ and antisense 2: 5′-GAC CCT GAA CCT AAA CCA C-3′, spanning nucleotides 1794 to 2005 of the IPM 200 cDNA) consistently yielded PCR amplification products of the expected size when human genomic DNA was used as a template. These primer pairs were used to screen a commercially available human BAC library (Genome Systems, St. Louis, MO). BAC clones 340M10, 366H07, 325H22, and 493P03 appeared to contain portions of the IMPG2 gene. The human genomic DNA was isolated from these BAC clones and fragmented by digestion with the restriction endonucleases HindIII, SacI, or EcoRI. The resultant fragments were ligated into either dephosphorylated vector pBluescript SK (Stratagene, La Jolla, CA) or pClonesure (CPG Inc., Fairfield, NJ) without further purification. After transformation by electroporation, Escherichia coli TOP 10 cells were grown overnight, at 37°C, on Luria-Bertani (LB) broth–based agar plates containing carbenicillin (50 μg/ml). From each restriction digest, 48 subclones were randomly selected and arrayed into 96-well microtiter plates. To identify subclones containing specific regions of IMPG2, nitrocellulose membranes were placed on LB-agar plates containing carbenicillin, and a small number of cells from each subclone were transferred to establish colonies directly on the membranes. Colonies were grown overnight at 37°C. DNA bound to the filter was then denatured by incubation in 0.5 M NaOH and 1.5 M NaCl for 5 minutes, neutralized in 1 M Tris (pH 8.0) and 1.5 M NaCl for 5 minutes, briefly rinsed in 2× SSC, and cross-linked to the membranes using UV irradiation. The filters were then incubated overnight in hybridization buffer containing 32[P]-labeled oligonucleotides that were designed based on the human IPM 200 cDNA sequence. After removal of unbound probe, filters were exposed to x-ray film to identify subclones yielding hybridization signals. 
Plasmids were isolated from these colonies and sequenced. Exonic domains were determined by comparison of the obtained genomic sequences to that of the cDNA sequence. 
Human Subjects
The study included 92 individuals with AMD, 92 with RP, 40 with LCA, and 92 normal individuals (control subjects). The control subjects were between the ages of 44 and 93 and were not afflicted with any ocular diseases. All probands with AMD and all control subjects were ascertained at The University of Iowa Hospitals and Clinics, whereas portions of the RP and LCA groups were ascertained at other centers. The protocol was in compliance with the tenets of the Declaration of Helsinki. 
Single-Strand Conformation Polymorphism Analyses
Genomic DNA from each study participant was screened for sequence variations in the IPM 200 coding sequence by single-strand conformation polymorphism (SSCP) analysis. PCR amplification reactions (10 μl) contained 5 ng human genomic DNA, 10 ng each PCR primer, 2.5 mM MgCl2, 0.25 U Taq polymerase, and 1× Taq polymerase buffer. Occasionally, reaction conditions were varied slightly to achieve optimal amplification when using specific primer pairs (Table 1) . These variations included the addition of 10% dimethyl sulfoxide (DMSO), the use of 1.5 mM MgCl2 instead of 2.5 mM MgCl2, or the use of “touchdown” PCR. All samples generally underwent 35 cycles of amplification and were then diluted with one volume of sample buffer (95% formamide, 20 mM EDTA, 0.05% xylene cyanol green and 0.05% bromophenol blue). Samples were heat denatured, electrophoresed on 6% nondenaturing polyacrylamide gels and visualized by silver staining, as described previously. 34 Samples of exons exhibiting band shifts were amplified again, purified, and sequenced bidirectionally on an automated DNA sequencer (model 377; PE Applied Biosystems, Foster City, CA). 
RT-PCR Analyses
Total retinal RNA was isolated from human donor tissue within 4 hours after death using spin columns (RNeasy; Qiagen, Valencia, CA). The RNA was reverse transcribed using random hexamer primers and reverse transcriptase (SuperscriptII; Gibco BRL, Grand Island, NY). Fifty nanograms of the resultant single-stranded cDNA was PCR amplified using primers designed based on the human IPM 200 cDNA sequence. The derived PCR fragments were analyzed by electrophoretic separation on agarose gels. The primers used to amplify the open reading frame of human IPM 200 were sense, 5′-TTGGAAGTTT CAAGGATTTG-3′, and antisense, 5′-AACACAGCAT TCAGTCTTTA TAG-3′. The expected 4017-bp amplification product of spans between bp 120 and bp 4135 (exons 1 and 19, respectively) of the previously published IPM 200 cDNA sequence (GenBank accession no. AF173155). 
Results
Genomic Organization of the IMPG2 Gene
The intron–exon boundaries of the IMPG2 gene and portions of the intronic sequences flanking the exons were determined by partially sequencing four overlapping BAC clones (Fig. 1) . The IMPG2 gene comprises 19 exons ranging in size between 21 and 1259 bp. The 5′ and 3′ ends of all exons exhibited sequences that were consistent with consensus acceptor and donor splice sites, respectively (Table 2) . These sequences have been deposited in GenBank (accession numbers AF271363 through AF271379). Summation of all nonoverlapping sequences obtained in the course of this study indicated that the gene is at least 31.0 kb in size. In addition, approximately 700 bp of genomic sequence located immediately upstream of the IMPG2 gene were determined. 
Comparison of the Organization of IMPG2 and IMPG1
As reported earlier, comparison of IPM 200 and IPM 150 cDNAs and their deduced amino acid sequences indicated that the two proteins are closely related to one other and constitute a novel family of glycoproteins. 2 5 Analyses of the genomic organization of their respective genes, IMPG2 and IMPG1, support these data. Alignment of the human IPM 150 and IPM 200 amino acid sequences revealed that the size, distribution and overall organization of exons is highly conserved between the two genes (Fig. 2) . Closer analysis indicated that regions of high amino acid sequence conservation correspond directly to regions in which the genomic organization is more stringently preserved. In regions of the genes that encode the more highly conserved amino- and carboxyl-terminal regions of the IPM 150 and IPM 200 proteins, the intron–exon boundaries often occur precisely at the same amino acid (Fig. 3) . The conservation of genomic structure is less stringent in the regions that encode the central domains of the IPM 150 and IPM 200 proteins. These are the same regions in which the primary structures of the proteins are also less conserved. 
Screening of IMPG2 in Patients with Retinal Disease
To assess the potential involvement of the IMPG2 gene in the development of AMD, LCA, and RP, we screened genomic DNA obtained from 224 patients affected with these retinopathies for sequence changes within the exons of this gene. The data obtained were compared with those derived from a group of 92 patients for whom there was no clinical evidence of retinal disease. Three sequence changes were identified in the coding region of the gene (Table 3) . A silent T→C transition in the third position of the codon for Leu1127 was observed in approximately 25% of both affected and unaffected individuals. Approximately one third of all evaluated alleles display a C→T change in exon 13, which induces a Thr674Ile change in the mucin-like domain of IPM 200. A rare C→T change, resulting in a Pro1013Leu substitution immediately preceding the first EGF-like domain, was observed in approximately 1% of AMD-affected and control individuals. In addition, an intronic A→G sequence change 10 bp downstream of exon 6 was observed in approximately 45% of all examined alleles. Thus, individuals from both the affected and control groups harbored all observed sequence variations at approximately equal rates, suggesting that the detected base changes represented nondisease-causing polymorphisms. 
Identification of Alternative Transcripts of Human IPM 200
Several bands running at a molecular weight lower than 6.2 kb were observed on extended autoradiographic exposure of Northern blot analysis of retinal RNA hybridized with IPM 200 cDNA probes (Fig. 4B) . These data indicate the presence of transcripts of several sizes, suggesting that various splicing isoforms of IPM 200 may exist. To confirm these data and to rule out that the additional observed bands are due to alternative initiation of transcripts or polyadenylation, RT-PCR amplification of IPM 200 from human retinal cDNA was performed. RT-PCR of the open reading frame of human IPM 200 produced the 4.0-kb amplification product predicted from the previously described cDNA sequence, as well as several smaller PCR products of approximately 3.7, 3.6, 2.9, and 1.8 kb (Fig. 4A) . These findings demonstrate that the observed transcripts differ within the coding region of the cDNA, resulting in all likelihood in the synthesis of several distinct protein isoforms. 
Discussion
In this report, we describe the organization of the human IMPG2 gene that encodes the prominent retinal proteoglycan IPM 200. 2 4 Analyses of the IMPG2 gene, located on chromosome 3q12, indicate that it comprises 19 exons that span a minimum of 31.0 kb. A few sequence variations were identified in the IMPG2 gene after genetic analyses of individuals with RP, LCA, or AMD and unaffected control subjects. However, no significant partitioning of these polymorphisms between affected and unaffected individuals was detected. Hence, there are no indications that mutations in the coding region of IMPG2 are involved in the development of these three retinopathies. However, it is difficult to completely rule out the possibility that mutations in this gene may be involved in these retinal diseases, because certain types of mutations, such as genomic rearrangements, cannot be detected by SSCP. In addition, sequence changes in noncoding regions, such as 5′ regulatory elements or splicing branch sites, may severely interfere with the functionality of the IMPG2 gene. 
The exonic structures of IMPG2 and that of IMPG1, which encodes the related proteoglycan IPM 150, 3 4 35 36 are remarkably well conserved based on alignment of the amino acid sequences and insertion of gaps to account for the difference in overall size of the proteins (Fig. 3) . Many exons are either of identical length or terminate in similar locations. These observations indicate that IPM 200 and IPM 150 are members of a single gene family. We speculate that the IMPG1 and IMPG2 genes may have arisen from the duplication of a single ancestral gene. Thus, it is conceivable that IPM 200 and IPM 150, at least in part, may be functionally redundant and that retinal dysfunction and/or degeneration occurs only if both proteins are defective. 
Previous reports suggested that there are splicing isoforms of IPM 150 in the human retina. 3 35 Based on the data presented herein, it appears that human retinal IPM 200 is also synthesized as several isoforms. The nature of these IPM 200 variants has not been elucidated, although the properties of individual isoforms of the same gene can be quite diverse. For example, tenascin-C splice variants differ only in the number of their fibronectin type III domains, yet some variants possess adhesive properties, whereas others display antiadhesive characteristics. 37 38 39 Furthermore, it appears that the functional differences of the tenascin isoforms are in part dependent on their environment. 40 By analogy, it is possible that isoforms of IPM 200 serve distinct functions. It is also conceivable that these isoforms are synthesized by specific photoreceptor cell types. Future studies should provide additional insight into the isoforms and functions of IPM 200. 
 
Figure 1.
 
Organization of the IMPG2 gene and the BAC contig used to determine it. Broken lines: intronic regions that were not completely sequenced.
Figure 1.
 
Organization of the IMPG2 gene and the BAC contig used to determine it. Broken lines: intronic regions that were not completely sequenced.
Table 1.
 
PCR Primers used during SSCP Analyses of the IMPG2 Gene
Table 1.
 
PCR Primers used during SSCP Analyses of the IMPG2 Gene
Exon Sense Primer (5′ to 3′) Antisense Primer (5′ to 3′) Size (bp)
1-1 TTATCTCACCAGCTTTTATAGCA TGTCCAAATCCTTGAAACTTCC 192
1-2 GGTTGTTCATTCTCAAACATAGA TATGGAAAGATACAAACAAATG 256
2-1 TTTTGTACTGTATCTTCATTATCG TTTCAGTTTCTCTGCGGTCC 185
2-2 TCCTGCCTGAAGAATCAACA GGAGCTGAAGGATTTGGATG 201
3 CCCCAGAGCATGTTAGCTTT CCAGGAATCCCTTCCTTTGT 247
4 GGGCAGTAGTGGTCTCTATG TTAGGCTATGACACATCTGTG 179
5 CCTTTTTGGAAAACAACCCC GTGAGCCTGTCTTAAACC 197
6 TCATGCATATGTTTTTGCTTTTC TGTGTAGTCCAGCAATGGGA 199
7 ATTGAATGAATAAGCCTTGACA GGCATACTGCCTTGTTTGTT 249
8 CAGTTCACTTTTTATTCTACTCTT GGACATTCCATTCAGAATAAAG 218
9 AATAATAACTGTCTCAAACTCTG GGACCTACGGCCTGCTATATT 145
10-1 GCTCCTTTCTTTGTGCTTCC CAACAGTGGGTTTATCATCCAG 191
10-2 CCAACAAGGTGGAAAACCAT ACCAGAGCATACTGGAAAAGA 223
11 GTTGTCCCTGCACCTCAAAT GAGGGCCTGGTTCTAGCATA 190
12-1 GGAATATAGACAGATAGGTGG GAAAGGCTAATTTGTGTGTAGA 249
12-2 CAGGGAACTCTGGTCAGAAAG ATACAATAAGAAGTACGAAAA 246
13-1 GGAATACATTTTGGCAACTCTGT GAGGTCAGATATGGTGAAGATG 199
13-2 CTCAACCTGTGCCAAAAGAA TGAACCTAAACCACCGTCAA 199
13-3 AAAAGTGAGCCCTTTCCTGC ATCTCAGCTGGCAAAAGTGAA 191
13-4 ACTTGGCCATGGAGTGAGAC GTATCTGCGAAGATGGGCAC 241
13-5 CACTTTCCAGAGGAAGAGCC TCAAACCATTCATAGTTGGATGA 256
13-6 TGCCATCCTAAGGGAGGATA GGTTGGAGGCAATTTGGTAG 243
13-7 AGTGCTGACAGGCTCTGGTT GCCAAGCCACACTAACCATC 237
13-8 GGTTGGTAGTTATGTGGAAATG GTGCCCATGTTTCACTTTTT 249
14-1 TGAACAAAATGTGACACGCTG CCAGAATCATGTACACCGCA 199
14-2 AAGTTTGCCAATTCTGTCCC ATGAGGAAGAAAACACACAAG 199
15-1 TGTGTTTTGCCTTTTCTTGC TCAGGCTGTAGGTCACAGAGA 197
15-2 TGCTTCCCTGGATACCTGAG AGGCCCCTTTTCTTTAGAGG 186
16-1 TGTCAGTGTGAGCAGAGTGATT TGAAGAAGTAGATGATAGCAG 194
16-2 GCAAGCACTGTGAGGAATTT TGTGCTCTTTCTTATTTACCTGA 175
17-1 CCAAACAAGAGCCTGAATCC CCGCTAGCAGAGCTGTAGAA 178
17-2 ACAGGGCTGGATGTGAGAAG AGCTGCGACAGCAACATAAA 171
18 TGCAATGTGTGGCCTATTGT TGCTCACTCAGGTGTGACATT 195
19 GCTCTTTGTGTTTTCATGG ATCTCCATCTTCTCCAGGC 84
Table 2.
 
Exon–Intron Junctions of the Human IMPG2 Gene
Table 2.
 
Exon–Intron Junctions of the Human IMPG2 Gene
Exon Acceptor Site Exon Length (bp) Donor Site Intron Length*
1 TAACAGGTATTTAAAA 454 bp
2 CACTCTGTAGCACAAA 249 TCCGAGGTAAGCGAAC >1.1 kb
3 TATTTTCTAGTGTGTC 167 ATGAAGGTAAGTGTCA >1.2 kb
4 TTTTCCTTAGAAACTG 32 AAGCAGGTGAGTGTCT >1.3 kb
5 TTTTTTCTAGCTCTGA 50 TGGGAGGTATACTTTT 919 bp
6 TTCTTCTTAGACACTA 83 GAGAGTGTGAGTGATA >1.0 kb
7 AAAAATTCAGATTAGC 162 TCAGAGGTGGGTGATT >730 bp
8 CTTTTAACAGGTTGAA 59 ATTTAGGTAAATAGAC >1.1 kb
9 TTGTTTTCAGGTCCCC 21 TGACAGGTACTTTTTG >640 bp
10 CCATCCATAGTGGCGT 245 TCAATGGTGAGTTTGA >780 bp
11 CTTTCCTCAGTGAGAG 86 ATTCTGGTATGTTTTT >730 bp
12 TTCCCCCCAGGATAAT 304 AAGATGGTGAGAAACT >720 bp
13 TTATTTTTAGGATTAG 1259 GAATTGGTAAGCATAA >880 bp
14 TATATTGTAGCTGGTT 220 AATCAGGTATGATATT >790 bp
15 AATGTTTTAGGTGATG 211 TTGTAGGTATGTTGTA >1.0 kb
16 TTGGTTGCAGGTGCCG 189 CTTCAGGTAAATAAGA 579 bp
17 TTTCTTTTAGTGGCTC 211 AGAGAGGTGGGAAACT >480 bp
18 TTTGTTTAAGGAAATT 80 ACAAGTGTAAGCTTTT >1.0 kb
19 TTCATGGCAGGGAAGA
Figure 2.
 
Organization and comparison of the IMPG2 (top) and IMPG1 (bottom) genes and their encoded proteins, IPM 200 and IPM 150. Black boxes: regions of high sequence homology; darkly shaded boxes: regions of moderate homology; lightly shaded boxes: regions of low sequence homology. Vertical lines: borders between exons; thin horizontal lines: insertion of gaps; ovals: EGF-like domains; diamond: hydrophobic, putative transmembrane domain of IPM 200.
Figure 2.
 
Organization and comparison of the IMPG2 (top) and IMPG1 (bottom) genes and their encoded proteins, IPM 200 and IPM 150. Black boxes: regions of high sequence homology; darkly shaded boxes: regions of moderate homology; lightly shaded boxes: regions of low sequence homology. Vertical lines: borders between exons; thin horizontal lines: insertion of gaps; ovals: EGF-like domains; diamond: hydrophobic, putative transmembrane domain of IPM 200.
Figure 3.
 
Alignment of the IPM 200 (top) and IPM 150 (bottom) core proteins. Arrows: exon boundaries.
Figure 3.
 
Alignment of the IPM 200 (top) and IPM 150 (bottom) core proteins. Arrows: exon boundaries.
Table 3.
 
Allelic Distribution of the Observed Polymorphic Markers in the Human IMPG2 Gene
Table 3.
 
Allelic Distribution of the Observed Polymorphic Markers in the Human IMPG2 Gene
Exon AMD RP LCA Control
6 A→G intronic 46 42 44 51
13 Thr674Ile 41 35 40 38
15 Pro1013Leu 1.2 0 0 0.8
16 Leu1127Leu 31 27 20 18
Figure 4.
 
RT-PCR (A) and Northern blot (B) analyses of IPM 200 expression in the human retina and RPE-choroid (RPE/Ch). Arrows: alternatively sized transcripts of IPM 200.
Figure 4.
 
RT-PCR (A) and Northern blot (B) analyses of IPM 200 expression in the human retina and RPE-choroid (RPE/Ch). Arrows: alternatively sized transcripts of IPM 200.
The authors thank Louisa Affatigato and Jake Roos for technical assistance, Val Sheffield, MD, Ph.D., and his staff for performing sequence analyses, and Robert Mullins, Ph.D., for helpful discussions throughout the project. 
Hageman GS, Johnson LV. Structure, composition and function of the retinal interphotoreceptor matrix. Osborne N Chader J eds. Progress in Retinal Research. 1991;207–249. Pergamon Press Oxford, UK.
Kuehn MH, Hageman GS. Molecular characterization and genomic mapping of human IPM 200, a second member of a novel family of proteoglycans. Mol Cell Biol Res Commun. 1999;2:103–110. [CrossRef] [PubMed]
Kuehn MH, Hageman GS. Expression and characterization of the IPM 150 gene (IMPG1) product, a novel human photoreceptor cell-associated chondroitin-sulfate proteoglycan. Matrix Biol. 1999;18:509–518. [CrossRef] [PubMed]
Kuehn MH, Hageman GS. Characterization of a cDNA encoding IPM 150, a novel human interphotoreceptor matrix chondroitin 6-sulfate proteoglycan [ARVO Abstract]. Invest Ophthalmol Vis Sci. 1995;36(4)S510.Abstract nr 2788
Kuehn MH, Wietecki DT, Hageman GS. Molecular characterization of the murine orthologue of the human retinal proteoglycan IPM 150. Mol Vis. 2000;6:148–156.available on-line at http//:www.molvis.org/molvis/v6/p148/ [PubMed]
Wang X, Brownstein M, Young W, III. Sequence analysis of PG10.2, a gene expressed in the pineal gland and the outer nuclear layer of the retina. Mol Brain Res. 1996;41:269–278. [CrossRef] [PubMed]
Acharya S, Foletta VC, Lee JW, et al. SPACRCAN, a novel human interphotoreceptor matrix hyaluronan-binding proteoglycan synthesized by photoreceptors and pinealocytes. J Biol Chem. 2000;275:6945–6955. [CrossRef] [PubMed]
Marmor MF, Yao XY. The metabolic dependency of retinal adhesion in rabbit and primate. Arch Ophthalmol. 1995;113:232–238. [CrossRef] [PubMed]
Bok D, Hageman GS, Steinberg RH. Repair and replacement to restore sight: report from the panel on photoreceptor/retinal pigment epithelium. Arch Ophthalmol. 1993;111:463–471. [CrossRef] [PubMed]
Hageman GS, Kirchoff-Rempe MA, Lewis GP, Fisher SK, Anderson DH. Sequestration of basic fibroblast growth factor in the primate retinal interphotoreceptor matrix. Proc Natl Acad Sci USA. 1991;88:6706–6710. [CrossRef] [PubMed]
Hewitt AT, Adler R. The retinal pigment epithelium and interphotoreceptor matrix: structure and specialized function. Ogden T eds. Retina. 1989;57–64. CV Mosby Co St. Louis.
Lazarus HS, Hageman GS. Xyloside-induced disruption of interphotoreceptor matrix proteoglycans result in retinal detachment. Invest Ophthalmol Vis Sci. 1992;33:364–375. [PubMed]
Yao XY, Hageman GS, Marmor MF. Retinal adhesiveness is weakened by enzymatic modification of the interphotoreceptor matrix in vivo. Invest Ophthalmol Vis Sci. 1990;31:2051–2058. [PubMed]
Hageman GS, Marmor MF, Yao XY, Johnson LV. The interphotoreceptor matrix mediates primate retinal adhesion. Arch Ophthalmol. 1995;113:655–660. [CrossRef] [PubMed]
Marmor M, Yao XF, Hageman G. Retinal adhesiveness in surgically enucleated human eyes. Retina. 1994;14:181–186. [CrossRef] [PubMed]
Hollyfield JG, Varner HH, Rayborn ME, Osterfeld AM. Retinal attachment to the pigment epithelium. Retina. 1989;9:59–68. [CrossRef] [PubMed]
Alberdi E, Hyde CC, Becerra SP. Pigment epithelium-derived factor (PEDF) binds to glycosaminoglycans: analysis of the binding site. Biochemistry. 1998;37:10643–10652. [CrossRef] [PubMed]
Stone J, Maslim J, Valter-Kocsi K, et al. Mechanisms of photoreceptor death and survival in mammalian retina. Prog Retinal Eye Res. 1999;18:689–735. [CrossRef]
Dryja TP, McGee TL, Reichel E, et al. A point mutation of the rhodopsin gene in one form of retinitis pigmentosa. Nature. 1990;343:364–366. [CrossRef] [PubMed]
McLaughlin ME, Sandberg MA, Berson EL, Dryja TP. Recessive mutations in the gene encoding the beta-subunit of rod phosphodiesterase in patients with retinitis pigmentosa. Nat Genet. 1993;4:130–134. [CrossRef] [PubMed]
Guillonneau X, Piriev NI, Danciger M, et al. A nonsense mutation in a novel gene is associated with retinitis pigmentosa in a family linked to the RP1 locus. Hum Mol Genet. 1999;8:1541–1546. [CrossRef] [PubMed]
Allikmets R, Singh N, Sun H, et al. A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nat Genet. 1997;15:236–246. [CrossRef] [PubMed]
Seabra MC, Brown MS, Goldstein JL. Retinal degeneration in choroideremia: deficiency of rab geranylgeranyl transferase. Science. 1993;259:377–381. [CrossRef] [PubMed]
Gorin MB, Breitner JC, De Jong PT, et al. The genetics of age-related macular degeneration. Mol Vis. 1999;5:29.available on-line at http//:www.molvis.org/molvis/v5/p29/ [PubMed]
Heiba IM, Elston RC, Klein BE, Klein R. Sibling correlations and segregation analysis of age-related maculopathy: the Beaver Dam Eye Study. Genet Epidemiol. 1994;11:51–67. [CrossRef] [PubMed]
Seddon JM, Ajani UA, Mitchell BD. Familial aggregation of age-related maculopathy. Am J Ophthalmol. 1997;123:199–206. [CrossRef] [PubMed]
Klein ML, Mauldin WM, Stoumbos VD. Heredity and age-related macular degeneration: observations in monozygotic twins. Arch Ophthalmol. 1994;112:932–937. [CrossRef] [PubMed]
Weeks DE, Conley YP, Mah TS, et al. A full genome scan for age-related maculopathy. Hum Mol Genet. 2000;9:1329–1349. [CrossRef] [PubMed]
Klein ML, Schultz DW, Edwards A, et al. Age-related macular degeneration: clinical features in a large family and linkage to chromosome 1q. Arch Ophthalmol. 1998;116:1082–1088. [CrossRef] [PubMed]
Klaver CC, Kliffen M, van Duijn CM, et al. Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet. 1998;63:200–206. [CrossRef] [PubMed]
Perrault I, Rozet JM, Gerber S, et al. Leber congenital amaurosis. Mol Genet Metab.. 1999;68:200–208. [CrossRef] [PubMed]
Lotery AJ, Namperumalsamy P, Jacobson SG, et al. Mutation analysis of 3 genes in patients with Leber congenital amaurosis. Arch Ophthalmol. 2000;118:538–543. [CrossRef] [PubMed]
Phelan JK, Bok D. A brief review of retinitis pigmentosa and the identified retinitis pigmentosa genes. Mol Vis. 2000;6:116–122.http//:www.molvis.org/molvis/v6/p116/ [PubMed]
Nishimura DY, Swiderski RE, Alward WL, et al. The forkhead transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. Nat Genet. 1998;19:140–147. [CrossRef] [PubMed]
Felbor U, Gehrig A, Sauer C, et al. Genomic organization and chromosomal localization of the interphotoreceptor matrix proteoglycan-1 (IMPG1) gene: a candidate for 6q-linked retinopathies. Cytogenet Cell Genet. 1998;81:12–17. [CrossRef] [PubMed]
Kuehn M, Stone E, Hageman G. Molecular analyses of IPM 150, a photoreceptor cell-specific proteoglycan. Invest Ophthalmol Vis Sci. 1997;38(4)S599.Abstract nr 2788
Gotz B, Scholze A, Clement A, et al. Tenascin-C contains distinct adhesive, anti-adhesive, and neurite outgrowth promoting sites for neurons. J Cell Biol. 1996;132:681–699. [CrossRef] [PubMed]
Mackie EJ. Molecules in focus: tenascin-C. Int J Biochem Cell Biol. 1997;29:1133–1137. [CrossRef] [PubMed]
Ruoslahti E. Brain extracellular matrix. Glycobiology. 1996;6:489–492. [CrossRef] [PubMed]
Meiners S, Powell EM, Geller HM. Neurite outgrowth promotion by the alternatively spliced region of tenascin-C is influenced by cell-type specific binding. Matrix Biol. 1999;18:75–87. [CrossRef] [PubMed]
Figure 1.
 
Organization of the IMPG2 gene and the BAC contig used to determine it. Broken lines: intronic regions that were not completely sequenced.
Figure 1.
 
Organization of the IMPG2 gene and the BAC contig used to determine it. Broken lines: intronic regions that were not completely sequenced.
Figure 2.
 
Organization and comparison of the IMPG2 (top) and IMPG1 (bottom) genes and their encoded proteins, IPM 200 and IPM 150. Black boxes: regions of high sequence homology; darkly shaded boxes: regions of moderate homology; lightly shaded boxes: regions of low sequence homology. Vertical lines: borders between exons; thin horizontal lines: insertion of gaps; ovals: EGF-like domains; diamond: hydrophobic, putative transmembrane domain of IPM 200.
Figure 2.
 
Organization and comparison of the IMPG2 (top) and IMPG1 (bottom) genes and their encoded proteins, IPM 200 and IPM 150. Black boxes: regions of high sequence homology; darkly shaded boxes: regions of moderate homology; lightly shaded boxes: regions of low sequence homology. Vertical lines: borders between exons; thin horizontal lines: insertion of gaps; ovals: EGF-like domains; diamond: hydrophobic, putative transmembrane domain of IPM 200.
Figure 3.
 
Alignment of the IPM 200 (top) and IPM 150 (bottom) core proteins. Arrows: exon boundaries.
Figure 3.
 
Alignment of the IPM 200 (top) and IPM 150 (bottom) core proteins. Arrows: exon boundaries.
Figure 4.
 
RT-PCR (A) and Northern blot (B) analyses of IPM 200 expression in the human retina and RPE-choroid (RPE/Ch). Arrows: alternatively sized transcripts of IPM 200.
Figure 4.
 
RT-PCR (A) and Northern blot (B) analyses of IPM 200 expression in the human retina and RPE-choroid (RPE/Ch). Arrows: alternatively sized transcripts of IPM 200.
Table 1.
 
PCR Primers used during SSCP Analyses of the IMPG2 Gene
Table 1.
 
PCR Primers used during SSCP Analyses of the IMPG2 Gene
Exon Sense Primer (5′ to 3′) Antisense Primer (5′ to 3′) Size (bp)
1-1 TTATCTCACCAGCTTTTATAGCA TGTCCAAATCCTTGAAACTTCC 192
1-2 GGTTGTTCATTCTCAAACATAGA TATGGAAAGATACAAACAAATG 256
2-1 TTTTGTACTGTATCTTCATTATCG TTTCAGTTTCTCTGCGGTCC 185
2-2 TCCTGCCTGAAGAATCAACA GGAGCTGAAGGATTTGGATG 201
3 CCCCAGAGCATGTTAGCTTT CCAGGAATCCCTTCCTTTGT 247
4 GGGCAGTAGTGGTCTCTATG TTAGGCTATGACACATCTGTG 179
5 CCTTTTTGGAAAACAACCCC GTGAGCCTGTCTTAAACC 197
6 TCATGCATATGTTTTTGCTTTTC TGTGTAGTCCAGCAATGGGA 199
7 ATTGAATGAATAAGCCTTGACA GGCATACTGCCTTGTTTGTT 249
8 CAGTTCACTTTTTATTCTACTCTT GGACATTCCATTCAGAATAAAG 218
9 AATAATAACTGTCTCAAACTCTG GGACCTACGGCCTGCTATATT 145
10-1 GCTCCTTTCTTTGTGCTTCC CAACAGTGGGTTTATCATCCAG 191
10-2 CCAACAAGGTGGAAAACCAT ACCAGAGCATACTGGAAAAGA 223
11 GTTGTCCCTGCACCTCAAAT GAGGGCCTGGTTCTAGCATA 190
12-1 GGAATATAGACAGATAGGTGG GAAAGGCTAATTTGTGTGTAGA 249
12-2 CAGGGAACTCTGGTCAGAAAG ATACAATAAGAAGTACGAAAA 246
13-1 GGAATACATTTTGGCAACTCTGT GAGGTCAGATATGGTGAAGATG 199
13-2 CTCAACCTGTGCCAAAAGAA TGAACCTAAACCACCGTCAA 199
13-3 AAAAGTGAGCCCTTTCCTGC ATCTCAGCTGGCAAAAGTGAA 191
13-4 ACTTGGCCATGGAGTGAGAC GTATCTGCGAAGATGGGCAC 241
13-5 CACTTTCCAGAGGAAGAGCC TCAAACCATTCATAGTTGGATGA 256
13-6 TGCCATCCTAAGGGAGGATA GGTTGGAGGCAATTTGGTAG 243
13-7 AGTGCTGACAGGCTCTGGTT GCCAAGCCACACTAACCATC 237
13-8 GGTTGGTAGTTATGTGGAAATG GTGCCCATGTTTCACTTTTT 249
14-1 TGAACAAAATGTGACACGCTG CCAGAATCATGTACACCGCA 199
14-2 AAGTTTGCCAATTCTGTCCC ATGAGGAAGAAAACACACAAG 199
15-1 TGTGTTTTGCCTTTTCTTGC TCAGGCTGTAGGTCACAGAGA 197
15-2 TGCTTCCCTGGATACCTGAG AGGCCCCTTTTCTTTAGAGG 186
16-1 TGTCAGTGTGAGCAGAGTGATT TGAAGAAGTAGATGATAGCAG 194
16-2 GCAAGCACTGTGAGGAATTT TGTGCTCTTTCTTATTTACCTGA 175
17-1 CCAAACAAGAGCCTGAATCC CCGCTAGCAGAGCTGTAGAA 178
17-2 ACAGGGCTGGATGTGAGAAG AGCTGCGACAGCAACATAAA 171
18 TGCAATGTGTGGCCTATTGT TGCTCACTCAGGTGTGACATT 195
19 GCTCTTTGTGTTTTCATGG ATCTCCATCTTCTCCAGGC 84
Table 2.
 
Exon–Intron Junctions of the Human IMPG2 Gene
Table 2.
 
Exon–Intron Junctions of the Human IMPG2 Gene
Exon Acceptor Site Exon Length (bp) Donor Site Intron Length*
1 TAACAGGTATTTAAAA 454 bp
2 CACTCTGTAGCACAAA 249 TCCGAGGTAAGCGAAC >1.1 kb
3 TATTTTCTAGTGTGTC 167 ATGAAGGTAAGTGTCA >1.2 kb
4 TTTTCCTTAGAAACTG 32 AAGCAGGTGAGTGTCT >1.3 kb
5 TTTTTTCTAGCTCTGA 50 TGGGAGGTATACTTTT 919 bp
6 TTCTTCTTAGACACTA 83 GAGAGTGTGAGTGATA >1.0 kb
7 AAAAATTCAGATTAGC 162 TCAGAGGTGGGTGATT >730 bp
8 CTTTTAACAGGTTGAA 59 ATTTAGGTAAATAGAC >1.1 kb
9 TTGTTTTCAGGTCCCC 21 TGACAGGTACTTTTTG >640 bp
10 CCATCCATAGTGGCGT 245 TCAATGGTGAGTTTGA >780 bp
11 CTTTCCTCAGTGAGAG 86 ATTCTGGTATGTTTTT >730 bp
12 TTCCCCCCAGGATAAT 304 AAGATGGTGAGAAACT >720 bp
13 TTATTTTTAGGATTAG 1259 GAATTGGTAAGCATAA >880 bp
14 TATATTGTAGCTGGTT 220 AATCAGGTATGATATT >790 bp
15 AATGTTTTAGGTGATG 211 TTGTAGGTATGTTGTA >1.0 kb
16 TTGGTTGCAGGTGCCG 189 CTTCAGGTAAATAAGA 579 bp
17 TTTCTTTTAGTGGCTC 211 AGAGAGGTGGGAAACT >480 bp
18 TTTGTTTAAGGAAATT 80 ACAAGTGTAAGCTTTT >1.0 kb
19 TTCATGGCAGGGAAGA
Table 3.
 
Allelic Distribution of the Observed Polymorphic Markers in the Human IMPG2 Gene
Table 3.
 
Allelic Distribution of the Observed Polymorphic Markers in the Human IMPG2 Gene
Exon AMD RP LCA Control
6 A→G intronic 46 42 44 51
13 Thr674Ile 41 35 40 38
15 Pro1013Leu 1.2 0 0 0.8
16 Leu1127Leu 31 27 20 18
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×