Truncations in the TIGR Gene in Individuals with and without Primary Open-Angle Glaucoma

Abstract

purpose. To investigate the coding exons in the trabecular meshwork–induced glucocorticoid response protein (TIGR) gene for mutations in primary open-angle glaucoma (POAG) in Chinese subjects.

methods. Ninety-one Chinese patients with POAG and 113 of their family members without glaucoma were screened for sequence alterations in the TIGR gene by polymerase chain reaction, conformation-sensitive gel electrophoresis, and DNA sequencing. One hundred thirty-two unrelated individuals without glaucoma, aged 50 years or more, were studied as control subjects.

results. Five sequence variants that lead to amino acid changes were identified. One was novel: Arg91Stop in one patient with POAG. Four had been reported: Arg46Stop in subjects with and without POAG, including an unaffected 77-year-old woman homozygous for Arg46Stop; Gly12Arg in subjects without glaucoma; and Asp208Glu and Thr353Ile in subjects with and without POAG. The previously reported 1-83(G→A) and Arg76Lys polymorphisms were detected in both patients and controls and always occurred together.

conclusions. A different pattern of TIGR sequence variants exists in the Chinese than in non-Chinese populations. No common TIGR mutation that causes POAG was found. The occurrence of subjects without glaucoma who are heterozygous or homozygous for Arg46Stop suggests that reduction in the amount of TIGR protein does not cause glaucoma. Thus, the TIGR missense mutations known to cause POAG probably do not cause glaucoma by inactivating a normal TIGR function, but rather through the gain of a pathologic function.

Glaucoma is a complex and progressive disorder of the optic nerves and a leading cause of visual field defects and blindness in developed countries. ¹ Primary open-angle glaucoma (POAG), which affects almost 2% of the world’s population, accounts for most glaucoma. ² Onset of the disease can occur at young age or later in life, but the prevalence increases with age. The pathophysiology of POAG is not precisely known although its cause is clearly multifactorial. It is a result of multiple and interactive genetic and environmental effects. Risk factors include positive family history, age, hypertension, diabetes, smoking, and alcohol consumption. ^{3 4 5}  

At least six associated chromosomal loci have been located for POAG: GLC1A, GLC1B, GLC1C, GLC1D, GLC1E, and GLC1F on chromosomes 1q24-25, 2cen-q13, 3q21-24, 8q23, 10p, and 7q35-36 respectively. ^{6 7} GLC1A codes for the myocilin polypeptide, also known as the trabecular meshwork–inducible glucocorticoid response protein (TIGR). ⁸ TIGR is expressed in many eye tissues including sclera, ciliary body, trabecular meshwork (TM), and retina, as well as in nonocular tissues such as heart, lung, and pancreas. ^{9 10 11} In the TM cells, although the mechanism is unknown, it is suggested that mutated TIGR proteins expressed from TIGR variants may disturb the normal cytoskeletal function or block the movement of aqueous humor through the extracellular spaces. Glucocorticoid causes overexpression and secretion of TIGR by cultured TM cells, and topical glucocorticoid treatment induces intraocular pressure (IOP) elevation in some patients with POAG. ¹² Thus, production of mutated TIGR protein with altered structures or inappropriately high levels of TIGR protein may contribute to glaucoma pathogenesis, causing IOP elevation. In fact, certain TIGR mutations have been shown to be associated with clinical IOP elevations in patients with glaucoma who are carriers of the mutations. ¹³  

The TIGR gene spans 20 kb and includes three exons. Its promoter region is characterized by multiple-consensus steroid hormone–responsive elements, besides other important regulatory motifs. ¹⁰ There have been more than 30 sequence variants reported for the TIGR gene within its structural domains. Among them, at least 16 (Table 1) were shown to have strong associations with POAG. ^{8 10 13 14 15 16 17 18 19 20 21 22 23 24 25} The sequence changes were mainly found to be associated with exon 3 and included missense and nonsense mutations. Some sequence variants in exon 1 have been called probable glaucoma-causing mutations, ^{13 18 26} but the number of subjects studied was not large enough to confirm an association with POAG. However, most sporadic occurrences of POAG do not occur in patients with mutations in TIGR. ^{13 18 21} The prevalence of POAG is affected by ethnicity. American blacks have a significantly higher frequency than American whites. ² Ethnic difference in the frequency of TIGR mutations among patients with POAG has not been well examined, but one large study reported a range from 2.6% to 4.3% among Japanese, African-Americans, and whites. ¹⁸ So far there has been no report on TIGR mutations in Chinese. In this study, we screened for TIGR sequence alterations in Chinese subjects with and without POAG. 

Materials and Methods

Subjects

Patients with POAG were recruited from the Eye Clinic of the Prince of Wales Hospital, Hong Kong. Diagnosis of POAG required all the following: exclusion of secondary causes (e.g., trauma, uveitis, or steroid-induced or neovascular glaucoma); open anterior chamber angle; IOP higher than 21 mm Hg; characteristic optic disc changes (e.g., vertical cup-to-disc ratio higher than 0.3); thin or notched neuroretinal rim or disc hemorrhage; and characteristic visual field changes with reference to Anderson’s criteria for minimal abnormality in glaucoma. ²⁷  

Persons with POAG ranged in age from 8 to 77 years, with a mean and median of 44.5 and 40.5 years, respectively. Some patients’ relatives who did not have glaucoma were also included in the study. Unrelated control subjects were recruited from patients who attended the clinic for conditions other than glaucoma, including cataract, floaters, refractive errors, and itchy eyes. All control subjects were at least 50 years of age. All study subjects were given a complete ocular examination, and venous blood was collected and stored at −20°C for less than 2 months before DNA extraction. The study protocol was approved by the Ethics Committee for Human Research, the Chinese University of Hong Kong, and followed the tenets of the Declaration of Helsinki. Informed consent was obtained from the study subjects after explanation of the nature and possible consequences of the study. 

Polymerase Chain Reaction

Genomic DNA was extracted from 200 μl of whole blood using a kit (Qiamp; Qiagen, Hilden, Germany). The coding sequence of TIGR was screened for sequence alterations using polymerase chain reaction (PCR) followed by conformation-sensitive gel electrophoresis (CSGE). CSGE is an optimized heteroduplex method that can detect heterozygous mutations that are not closer than approximately 40 bases from the end of a DNA fragment, in DNA fragments less than approximately 500 bases. ^{31 32} Thus, the three exons of TIGR were amplified by dividing the two longer exons into overlapping PCR products of less than 500 bases each. The seven PCR amplicons were obtained using the primer pairs in Table 2 . For the PCR thermal cycle, a touchdown annealing temperature of 62°C minus 0.2°C per cycle for 35 cycles was used in a thermal cycler (model 9700; Perkin–Elmer, Foster City, CA). Each 25-μl reaction contained 1.5 mM MgCl₂, 1 U Taq polymerase, 200 μM dNTPs, and 2.5 μl PCR buffer (Gibco, Gaithersburg, MD), as well as 1 μl genomic DNA and 400 pM primers. 

CSGE

CSGE has been reported to be able to detect essentially all sequence changes. ^{28 29} To make CSGE gels of 300 × 400 × 0.8 mm, 20× TTE buffer containing 1.8 M Tris base, 4 mM EDTA, and 0.6 M taurine (pH 9.0) was prepared. ^{28 29} The gel contained: 2.5× TTE buffer, 37.5 ml acrylamide-bisacrylamide (49:1), 15 ml formamide, 10 ml ethylene glycol, 33 ml water, 0.15% 1,4-bis(acryloyl)piperazine, 0.1% ammonium persulfate, and 70 μl N,N,N′,N′-tetramethylethylenediamine (TEMED). The gel was prerun in 0.5× TTE for 30 minutes at 25 W. PCR products were prepared by adding 1:6 volume 6× loading dye containing 0.25% bromophenol blue, 0.25% xylene cyanol, and 30% glycerol, then heating to form heteroduplexes: 98°C for 5 minutes, 68°C for 30 minutes, then at room temperature. After the wells were washed, 5-μl of sample was loaded per well, and a DNA ladder was loaded asymmetrically to help identify the positions of lanes. A positive control known to be heterozygous was run in one lane. Up to three samples were loaded per lane by running the gel at 40 W for 45 minutes between loads. The gel was run at 25 W for approximately 20 hours. The gel was then stained with ethidium bromide, and the DNA bands were visualized and photographed under UV light. 

Direct DNA Sequencing

Samples corresponding to bands of altered mobility were sequenced. Sequencing was performed using dRhodamine-labeled terminators on an automated DNA sequencer (model ABI 377; Perkin Elmer). 

Restriction Endonuclease Assays

After patients with POAG and family members were screened by CSGE and sequencing, normal controls were screened for the presence of the sequence alterations identified, using restriction endonuclease assays or direct sequencing. Patients with POAG and family members were also screened by restriction analysis to detect any homozygotes not detectable by CSGE. The sequence alterations identified and the restriction enzymes used are listed in Table 3 . One to 5 units of each enzyme were mixed with each sample and incubated with their corresponding buffers overnight at 37°C (except for BsmAI at 55°C). DNA fragments were detected by electrophoresis on 2% agarose or 12% polyacrylamide gels. 

Results

Ten sequence alterations were identified in our study subjects (Table 4) , of which two were nonsense sequence changes, four were missense changes in encoded amino acid residues, one was a synonymous codon change, and three were changes in noncoding sequences. One of the amino acid sequence changes is novel: Arg91Stop. One sequence change, Gly12Arg, was found only in subjects without glaucoma. Among the sequence alterations that affects an amino acid codon, Arg91Stop was found exclusively in patients with glaucoma, albeit in only one patient (Table 4) . 

In this study, 17 of 91 patients with POAG (19%) and 34 of 132 control subjects (26%) were found to carry a TIGR amino acid sequence variation. Apart from Asp208Glu and Thr353Ile, which are in exons 2 and 3 respectively, the remaining four coding changes—Gly12Arg, Arg46Stop, Arg76Lys, and Arg91Stop—were found to be located in exon 1 (Table 4) . 

Arg46Stop was found in only one patient with POAG, P161. He was 4 years of age at the time of diagnosis, with IOP of 35 mm Hg (Table 5) . Six of his family members also carried Arg46Stop, including his mother, three uncles, and two cousins. They did not have glaucoma and were normal in visual acuity and IOP (Table 6) . Arg46Stop was also detected in four unrelated elderly control subjects, all of whom had cataracts but no glaucoma or high IOP (except for a temporary elevation of IOP after cataract surgery in C155). One of them, a 77-year-old woman, was identified as homozygous for Arg46Stop (Fig. 1) . There were four sequence alterations that did not affect encoded amino acids and are unlikely to affect the structure or function of the TIGR protein. Apart from Ala260Ala, which occurred in only 1 POAG index patient, the remaining three—1-83 (G→A) in the promoter, 730 + 35 (A→G) in intron 2, and 1515 + 73 (G→C) in the 3′ untranslated region—were found both in patients with POAG and in study subjects without glaucoma (Table 4) . The promoter polymorphism always occurred with the Arg76Lys polymorphism, in subjects with and without POAG. 

Discussion

One novel amino acid sequence change was discovered in this study: Arg91Stop. However, it was found in only one individual, a patients with POAG. Thus, no conclusion about its effect on disease risk could be made. Four previously published missense changes were found: Gly12Arg, Arg76Lys, Asp208Glu, and Thr353Ile. ^{18 13 30} Thr353Ile was described as a probable glaucoma-causing mutation, ¹⁸ but it was found in three control subjects in our study (Table 4) . Perhaps the definition of a probable disease-causing mutation should be confined to only the sequence alterations for which a statistically significant increase in frequency is found among patients compared with control subjects. Functional effects of such a mutation should also be confirmed by family linkage analysis and, if possible, in vitro expression studies. 

Gly12Arg was found only in subjects without glaucoma. When unrelated control subjects were compared with patients with POAG (Table 3) , there was a trend toward an association of this sequence alteration with the absence of POAG (Fisher’s exact two-tailed test, P = 0.14). Any potential protective effect of Gly12Arg on glaucoma may be confirmed by larger studies among Asian populations in which this sequence alteration occurs. 

Arg76Lys was the most common protein sequence polymorphism and displayed no association with POAG. It always occurred with the promoter polymorphism 1-83 (G→A), unlike other ethnic groups. ¹⁸ That we observed no recombination between these two sequence variants in the cases we screened raises questions about whether any recombination events have occurred in this 309-bp interval since this haplotype entered the Chinese population. 

Asp208Glu has been reported only once before, in a Japanese patient with ocular hypertension. ³⁰ Although it was also found in two patients with POAG in this study, we cannot conclude whether Asp208Glu contributes to POAG, because it was also found in a 50-year-old normal subject. 

However, many sequence alterations in TIGR have been identified that are likely to cause POAG. ^{8 10 13 14 15 16 17 18 19 20 21 22 23 24 25} Table 1 lists the mutations that have been reported in sufficiently large case–control or family studies to give a high likelihood that they are associated with POAG. All are in exon 3, and all but one, Gln368Stop, are missense mutations. There are at least two ways in which TIGR missense mutations may increase IOP: On the one hand, they may act by inactivating a putative normal function of TIGR that keeps IOP from increasing to excessive levels. For example, blockage of TIGR expression has been shown to reduce flow through a cultured TM cell layer. ³¹ On the other hand, the mutations may act by inducing a pathologic activity of the TIGR protein that increases IOP. For example, several of the mutated TIGR species appeared in the insoluble fraction of cultured cells, unlike the normal soluble TIGR. ³² A nonsense sequence alteration, Arg46Stop, provides clues to choose the more likely of the above mechanisms. 

The Arg46Stop protein truncation is thought to eliminate more than 90% of the normal length of the TIGR protein, with only 13 amino acids remaining after cleavage of the signal sequence. ¹² Thus, assuming no effects of the sequence change on expression of the normal allele, Arg46Stop essentially reduces TIGR expression by half in heterozygotes, and eliminates expression in homozygotes. Recently, a Korean individual with severe juvenile-onset POAG was found to be homozygous for Arg46Stop. ²⁶ However, our Arg46Stop-carrying elderly homozygote, who was 77 years of age, and all but one of our heterozygotes did not have glaucoma, and neither did the heterozygous relatives of the Korean homozygote (although two of them had IOP ≥22 mm Hg). Thus, the coexistence of glaucoma with the Arg46Stop sequence in the Korean homozygote may be due to the presence of other genetic or environmental factors interacting with this TIGR alteration. It may be just a coincidence due to two probable factors: Arg46Stop may be common in Asians (3% of our control subjects), and the proportion of patients with glaucoma in those screened for TIGR mutations has been much greater than in the general population. It is tempting to interpret absence of glaucoma in our elderly Arg46Stop homozygote as indicating that loss of TIGR gene product does not cause glaucoma. However, because nonpenetrance has been observed for other clearly pathogenic TIGR mutations, we cannot currently make predictions about whether additional Arg46Stop homozygotes are likely to develop glaucoma. However, these findings suggest that loss of TIGR gene product alone is not enough to result in glaucoma. Thus, these findings raise questions about whether TIGR is essential for normal eye function or whether other proteins can serve the function of TIGR. 

Among the 11 Arg46Stop carriers in this study, including the one homozygote identified, only one had high IOP (besides subject C155 after cataract surgery). That Arg46Stop carriers generally do not have high IOP reduces the likelihood that the pressure increase in the presence of missense mutations is the result of the loss of normal TIGR function. Thus, those missense mutations are likely to be creating or enhancing an IOP-increasing function of TIGR. The mechanism by which these mutations lead to increased IOP is not known, but at least two hypotheses appear reasonable: 1) TIGR protein can be secreted by TM cells. It may then contribute to an extracellular matrix that constricts outflow of aqueous humor through the TM. 2) TIGR protein within TM cells may control the structure of the cytoskeleton, affecting the shape of the cells and thus the size of the pores between cells through which aqueous humor may exit. Some mutations may affect binding of TIGR protein to cytoskeleton. 

Glucocorticoid treatment increases expression of TIGR by TM cells, and the time course and dose response of this expression are similar to the effect of glucocorticoids on increasing IOP. ^{12 26} If an extracellular mechanism were correct, increased expression of TIGR protein would be expected to increase the probability of TM blockage and increased IOP. The glucocorticoid-induced increases in both TIGR expression and IOP are consistent with this conclusion, although glucocorticoids may increase IOP primarily through other mechanisms. 

These observations are also consistent with an intracellular mechanism if increased TIGR protein causes TM cells to change their shape to constrict the pores in the TM. Further study on the effects of intracellular and extracellular TIGR protein will help elucidate the normal and pathologic roles of TIGR. 

 DSCL and CPP contributed equally to the study.

 Supported by the Industrial Support Fund, Hong Kong.

 Submitted for publication July 14, 1999; revised September 28 and December 7, 1999; accepted December 9, 1999.

 Commercial relationships policy: N.

Table 1.

 

 

Published Glaucoma-Associated TIGR Mutations

Table 1.

 

Published Glaucoma-Associated TIGR Mutations

Mutation	Effect	Mean Age at Diagnosis (y)	Ethnic Group	Studies
Gly246Arg	Change in charge; gain of turn; near Cys245	20, >35	French	10 14 15
Glu323Lys	Change in charge	19	Panamanian	14
Gln337Arg	Change in charge; gain of turn	14, >35	Scottish	14 16
Gly364Val	Change in polarity	33	Mixed	8 13 14 18
Gln368Stop	Premature termination	45, 62–64	Mixed	8 13 18 19
Pro370Leu	Loss of turn; near CK2 site (377-380)	10–13	Mixed	10 14 15 17 21 23
Thr377Met	Change in polarity; loss of CK2 site (377)	37	Mixed	13 14 19
Asp380Ala	Change in charge; loss of CK2 site? (377-380)	30	Mixed	14 17
Lys423Glu	Change in charge; loss of cAPK consensus (422-425); no glaucoma in homozygotes	30	French- Canadian	10 14 26 27
Val426Phe	Near cAPK site (422-425)	26	Mixed	14 28
Tyr437His	Change in charge	22	Mixed	8 13 18
Ile477Asn	Change in polarity; gain of turn; in CK2 site (475-478)	18	Mixed	13 14 18 29
Ile477Ser	Change in polarity; gain of turn; in CK2 site (475-478)	33	French	10 14 15
Asn480Lys	Change in charge; gain of α-helix; near CK2 site (475-478)	30–35	French	10 14 15
Ile499Phe	Change in secondary structure	31	French	10 14 15
Ser502Pro	Change in polarity	19	British	17

 CK2, casein kinase II; cAPK, cAMP-dependent protein kinase.

Table 2.

 

 

Oligonucleotide Primer Pairs for PCR

Table 2.

 

Oligonucleotide Primer Pairs for PCR

TIGR1aF: AATCTTGCTGGCAGCGTG

TIGR1aR: AGCTGGATTCATTGGGAC

TIGR1bF: CTTCTGTGCACGTTGCTGCA

TIGR1bR: CTGGTCCAAGGTCAATTGGT

TIGR1cF: CAGTCATCCATAACTTAC

TIGR1cR: ATATCACCTGCTGAACTC

TIGR2F: CATAGTCAATCCTTGGGC

TIGR2R: CTGCAGACCTGCTCTGACAA

TIGR3aF: GGATTAAGTGGTGCTTCG

TIGR3aR: TACGGGAACTGTCCGTGG

TIGR3bF: GAGAAGGAAATCCCTGGAGC

TIGR3bR: CATAAGTGACCATGTTCAAG

TIGR3cF: ATTGACTACAACCCCCTG

TIGR3cR: GCTTGTGGTAACCATGTAAC

Table 3.

 

 

TIGR Sequence Alterations and Restriction Endonuclease Assays

Table 3.

 

TIGR Sequence Alterations and Restriction Endonuclease Assays

Amplicon	Codon Change	Nucleotide Change	Enzyme*
1a	—	1-83 (G → A)	AvaI (e)
1a	Gly12Arg	34 (G → C)	Sau96 I (e)
1b	Arg46Stop	136 (C → T)	EaeI (e)
1b	Arg76Lys	227 (G → A)	BsmAI (e)
1b	Arg91Stop	271 (C → T)	HindIII (c)
2	Asp208Glu	624 (C → G)	BsmAI (c)
2	—	730+ 35 (A → G)	PmlI (c)
3	Ala260Ala	780 (A → G)	—
3a	Thr353Ile	1058 (C → T)	BsmAI (e)
3c	—	1515+ 73 (G → C)	—

*  e, eliminate cleavage site; c, create cleavage site; — none or not available.

Table 4.

 

 

Number of Study Subjects with Sequence Alterations Detected in the TIGR Gene

Table 4.

 

Number of Study Subjects with Sequence Alterations Detected in the TIGR Gene

Sequence Alteration	Location	POAG Patients (%) (n = 91)	Family Members without Glaucoma (%) (n = 113)	Unrelated Control Subjects (%) (n = 132)
1-83 (G → A)	Promoter	11 (12)	15 (13)	23 (17)
Gly12Arg (34G → C)	Exon 1	0 (0)	3 (3)	4 (3)
Arg46Stop (136C → T)	Exon 1	1 (1)	6 (5)	4 (3), †
Arg76Lys (227G → A)	Exon 1	11 (12)	15 (13)	23 (17)
Arg91Stop (271C → T)*	Exon 1	1 (1)	0 (0)	0 (0)
Asp208Glu (624C → G)	Exon 2	2 (2)	1 (1)	0 (0)
730+ 35 (A → G)	Intron 2	35 (38)	43 (38)	41 (31)
Ala260Ala (780A → G)	Exon 3	1 (1)	0 (0)	—
Thr353Ile (1058C → T)	Exon 3	3 (3)	3 (3)	3 (2)
1515+ 73 (G → C)	3′UTR	1 (1)	2 (2)	—

 Frequencies for family members without glaucoma may not be meaningful because several carriers of a polymorphism may belong to the same family. UTR, untranslated region.

*  Novel mutations found in this study.

†  One of the carriers is homozygous; — not measured.

Table 5.

 

 

Genotype and Clinical Data of Patients with POAG with a Sequence Alteration in the TIGR Gene

Table 5.

 

Genotype and Clinical Data of Patients with POAG with a Sequence Alteration in the TIGR Gene

Subject Number	Sex	Age at Diagnosis	Codon Change	Visual Acuity			Highest Known IOP			Vertical Cup-to-Disc Ratio
								OD	OS		OD	OS
P14	F	16	Thr353Ile	20/30	20/30	28	26	0.1/0.1
P161	M	4	Arg46Stop	LP	20/20	35	18	1.0/0.3
P179	F	49	Asp208Glu	20/30	20/30	24	26	0.3/0.3
P184	M	50	Arg91Stop	20/20	20/50	34	32	0.3/0.3
P187	F	69	Thr353Ile	20/20	20/70	37	25	0.5/0.5
P208	F	24	Asp208Glu	5/200	20/30	36	16	0.9/0.8
P211	M	67	Thr353Ile	18/200	18/200	26	28	0.3/0.4

 LP, light perception.

Table 6.

 

 

Genotype and Clinical Data of Subjects without POAG but with Arg46Stop Mutation in the TIGR Gene

Table 6.

 

Genotype and Clinical Data of Subjects without POAG but with Arg46Stop Mutation in the TIGR Gene

Subject Number	Sex	Age at Examination	Visual Acuity			Highest Known IOP
						OD	OS	OD	OS
† >P159	F	39	20/30	20/30	17	17
P160	M	37	20/15	20/20	15	13
P229	F	12	20/30	20/30	16	16
P234	M	44	20/20	20/30	12	14
P235	M	43	20/15	20/15	12	12
P236	F	16	20/30	20/30	16	17
C155	F	66	20/40	20/40	30*	16
C172	M	85	20/200	HM	16	15
C177, †	F	77	20/70	20/50	11	11
C182	F	79	20/30	20/70	13	10

 HM, hand movement.

*  Recorded one day after phacoemulsification surgery. Decreased to 15 after 2 months.

†  Homozygote.

Figure 1.

 

Electropherograms resulting from automated sequencing, showing Arg46Stop. (A) Normal sequence, (B) heterozygous sequence, and (C) homozygous sequence.

 

The authors thank Fion Lau for her contribution in contacting subjects and collecting blood samples.