Role of Transforming Growth Factor-β in Transdifferentiation and Fibrosis of Lens Epithelial Cells

Abstract

purpose. To determine the levels of mRNAs encoding markers of fibrosis in lens epithelial cells (LECs) from patients with anterior polar cataracts and to test whether transforming growth factor (TGF)-β enhances the expression of mRNAs for mesenchymal markers in LECs.

methods. LECs attached to the anterior capsules of patients with nuclear or anterior polar cataracts were analyzed by reverse transcription–polymerase chain reaction (RT-PCR) for the expression of mRNAs encoding pathologic extracellular matrix proteins, a marker of myofibroblast transformation, growth factors, and growth factor receptors, and by western blot analysis for the proteins encoded by these mRNAs. Bovine lens epithelial explants and intact rabbit lenses cultured with or without TGF-β1 were also subjected to RT-PCR and western blot analysis.

results. The levels of fibronectin, type I collagen, and α-smooth muscle actin (SMA) mRNAs were higher in LECs from patients with anterior polar cataracts than in those from patients with nuclear cataracts. Expression of mRNAs for TGF-β1, TGF-β2, TGF-β receptor type II, and connective tissue growth factor (CTGF) was significantly greater in anterior polar type than in nuclear type cataracts. In contrast, expression of mRNAs for epidermal growth factor (EGF), epidermal growth factor receptor (EGFR), fibroblast growth factor (FGF)-2, and FGF receptor-1 was similar in LECs from the two types of cataracts. TGF-β1 markedly increased the levels of fibronectin, type I collagen, and α-SMA mRNA in bovine lens epithelial explants and intact rabbit lenses.

conclusions. This is the first finding showing altered mRNA expression in LECs from anterior polar cataracts. Enhanced expression of TGF-β and the TGF-β receptor suggests that TGF-β derived from LECs may function in an autocrine fashion as the prime mediator of transdifferentiation and pathogenesis in human LECs. Elevated levels of CTGF mRNA suggest that this growth factor may play a role in the increased deposition of extracellular matrix in metaplastic LECs.

Epithelial–mesenchymal transformation is a dynamic process in which cells change from the epithelial state of differentiation into a mesenchymal phenotype. This transition is known to occur normally during embryogenesis. Epithelial–mesenchymal transformation is, however, thought to be a critical pathologic event in certain diseases, such as metastasis of cancer cells and pathologic fibrosis in some abnormal conditions. ^{1 2} Transforming growth factor-β (TGF-β), a multifunctional cytokine, has been implicated in epithelial–mesenchymal transformation of many cell types, such as cardiac endothelium and mammary epithelial cells. ^{3 4} TGF-β also promotes the production and deposition of extracellular matrix, which is essential to normal tissue repair after injury. ⁵ However, overexpression of TGF-β can cause tissue fibrosis in many pathologic conditions such as scleroderma, idiopathic pulmonary fibrosis, and liver fibrosis. ^{6 7 8 9} TGF-β stimulates the expression of other growth factors, including platelet-derived growth factor and connective tissue growth factor (CTGF) that may act locally in fibrotic lesions. CTGF is implicated in connective tissue formation and appears to mediate some of the actions of TGF-β in fibrosis. ¹⁰ It is transiently expressed during normal repair processes but may be permanently overexpressed in various fibrotic conditions. TGF-β and CTGF are coordinately expressed at sites of wound repair and in fibrotic disorders such as atherosclerosis, pulmonary fibrosis, and renal fibrosis. ^{11 12 13}  

Lens epithelial cells (LECs) can transdifferentiate into mesenchyme-like cells during the formation of anterior subcapsular cataracts and after-cataracts. ^{14 15} Abnormal extracellular materials, including type I and type III collagen, accumulates around the transdifferentiated cells in these cataracts. ^{16 17 18} Embryonic LECs also undergo transdifferentiation into fibroblasts when suspended within native type I collagen gels in vitro. ^{19 20} These mesenchyme-like cells stop producing type IV collagen, laminin, and lens crystallins and, instead, synthesize type I collagen. In cultured rat lenses and lens epithelial explants, TGF-β added to the culture medium induces cataractous changes resembling anterior subcapsular cataract. ^{21 22 23} In addition, overexpression of active TGF-β by lens fiber cells causes anterior subcapsular cataract in mice. ²⁴ However, there have been few studies attempting to correlate expression level of TGF-β or other growth factors with pathogenic changes in LECs obtained from human cataracts. Moreover, precise molecular mechanisms whereby TGF-β mediates transdifferentiation and overproduction of extracellular matrix materials of LECs are not clearly understood. Therefore, the objective of this study was to characterize transdifferentiated LECs in anterior subcapsular cataracts by analyzing the levels of mRNAs encoding proteins characteristic of myofibroblasts. We also assayed growth factors and growth factor receptors that may be involved in the transdifferentiation of LECs. These studies were supplemented by experiments designed to test whether TGF-β can induce mRNAs and proteins characteristic of fibroblasts in LECs in vitro. 

Materials and Methods

Human Lens Capsules

Lens capsules with attached LECs were obtained during cataract surgery from 40 patients with the clinical diagnosis of nuclear or anterior polar cataracts. The ages of the patients ranged from 38 to 91 years. Lens capsules of noncataractous lenses were obtained during clear lens extraction for correction of high myopia. Briefly, after injecting viscoelastic material into the anterior chamber, continuous curvilinear capsulorrhexis was performed, and the anterior capsule was removed carefully with forceps. Lens capsules were immediately placed in TRIzol reagent (Gibco, Gaithersburg, MD) for RNA preparation or frozen in liquid nitrogen and stored at −70°C for protein extraction. 

Bovine Lens Epithelial Explants

Young bovine eyes were obtained from a local abattoir and transported to the laboratory in a 4°C cold chamber. After the cornea was excised, the iris and ciliary body were removed, and the lens capsule was torn with a bent syringe needle. The lens capsule was grasped with fine forceps and removed from the remainder of the lens with the assistance of fine scissors. The separated layer containing LECs was transferred to a six-well plate coated with type IV collagen (Sigma, St. Louis, MO) in serum-free minimum essential medium (MEM; Gibco) containing 0.2% (wt/vol) bovine serum albumin (Sigma). The fresh explants were incubated with the cell layer downward on cell culture dishes in the absence or presence of 10 ng/ml human recombinant TGF-β1 (Sigma). After the indicated periods, total cellular RNA was prepared and subjected to RT-PCR. For western blot analysis, cell lysate was prepared as will be described. 

Rabbit Lens Organ Culture

All procedures in this study adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The eyes were removed from New Zealand albino rabbits weighing approximately 2 kg immediately after euthanasia, and the lenses were carefully dissected by a posterior approach. Each of the dissected lenses was placed in a well of a 12-well culture plate containing 2 ml MEM for 1 to 2 hours. Transparent eyes without surgical damage were selected for experimentation. For treatment, each sample containing two transparent lenses was incubated in 2 ml MEM containing bovine serum albumin with TGF-β1 (20 ng/ml), fibroblast growth factor (FGF)-2 (20 ng/ml; Sigma), or medium only. After the indicated periods, total RNA or protein extract from LECs was used for RT-PCR or western blot analysis. 

RNA Isolation and RT-PCR

Total cellular RNA was isolated from LECs attached to the anterior capsules of human lenses or animal lenses by using TRIzol reagent. One microgram RNA was reverse transcribed in a 20-μl reaction mixture by using a kit (1st Strand cDNA Synthesis; Boehringer Mannheim, Indianapolis, IN). The cDNA (0.2–1 μl) was amplified in a 20-μl reaction mixture. Conditions for PCR were as follows: 0.4 μM each primer, 0.2 mM deoxynucleoside triphosphate mixture (Perkin Elmer, Foster City, CA), 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, and 1.0 U Taq DNA polymerase (Perkin Elmer). Reaction mixtures were incubated in a thermal controller (model PTC-100; MJ Research, Watertown, MA) for 25 to 35 cycles (denaturation at 94°C for 45 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 1 minute). The amounts of amplified products were analyzed using an image documentation system (ImageMaster VDS; Pharmacia Biotech, Uppsala, Sweden). DNA size markers were run in parallel to validate the predicted sizes of the amplified bands (D-15 DNA marker; Novex, San Diego, CA). The primer sequences specific for the genes examined and predicted product sizes are shown in Table 1 . All primer sequences were designed by using primer selection software offered through a Web site (Primer 3; Center for Genome Research, the Whitehead Institute for Biomedical Research, Cambridge, MA, www-genome.wi.mit.edu), except those indicated in Table 1 . 

Western Blot Analysis

Lens epithelial cells were lysed on ice in lysis buffer (20 mM Tris-HCl [pH 7.5], 120 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, 2 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 20 μM leupeptin, and 1 μM aprotinin; Sigma). For sodium dodecyl sulfate (SDS)- and urea-soluble fractions, cells were lysed in buffer containing 1% SDS and 8 M urea, respectively. After centrifugation for 10 minutes at 10,000g, the supernatant was stored at −20°C. Protein concentrations were determined by using a protein assay kit (DC; Bio-Rad Laboratories, Hercules, CA). The lysates containing 20 μg protein were boiled for 5 minutes in SDS sample buffer, fractionated by SDS−10% polyacrylamide gel electrophoresis, and transferred to a nitrocellulose membrane (Hybond; Amersham Life Science, Cleveland, OH) using an electroblot apparatus (Bio-Rad). Membranes were blocked for 1 hour in Tween–phosphate-buffered saline (PBS-Tween) containing 5% nonfat milk powder. The membranes were then incubated with primary antibody at 1:1000 dilution in PBS-Tween containing 5% nonfat milk powder at room temperature for 45 minutes and washed in PBS-Tween. The primary antibodies used in this study were rabbit anti-human fibronectin antibody (Sigma) and mouse anti-human smooth muscle actin (SMA) antibody (Sigma). Blots were then incubated with a 1:1000 dilution of horseradish peroxidase–conjugated anti-rabbit or anti-mouse antibody (Amersham) at room temperature for 45 minutes After they were washed three times in PBS-Tween, the blots were developed by using chromogenic substrate solution (diaminobenzidine substrate; Boehringer Mannheim). Prestained molecular weight standards (SeeBlue) were purchased from Novex. 

Results

Enhanced Expression of Fibronectin, Type I Collagen, and α-SMA mRNAs in Human LECs of Anterior Polar Cataracts

To characterize transdifferentiated LECs in anterior polar cataracts at the mRNA level, we compared the steady state mRNA amounts of aberrant extracellular matrix proteins and a cytoskeletal component specific for myofibroblasts in human nuclear and anterior polar cataracts. In our preliminary experiments, we compared different types of human cataractous LECs and found that LECs obtained from noncataractous lenses and cortical cataracts showed similar patterns of mRNA expression to LECs obtained from nuclear cataracts. LECs of nuclear cataracts retained an epithelial morphology, displaying normal polygonal arrays of cells, whereas those of anterior polar cataracts were changed into fibroblast-like cells, showing strong immunoreactivity to type I collagen, according to our microscopic and immunohistochemical analysis (data not shown). As shown in Figure 1 A, expression of fibronectin, type I collagen, and α-SMA mRNA was prominent in LECs of anterior polar cataracts but negligible in nuclear cataracts. The amount of β-actin product, an internal control for PCR amplification, was similar in epithelial cell samples from both types of cataract. 

To confirm the production of the corresponding proteins, we prepared cell lysates from the LECs attached to the anterior capsules and performed western blot analysis with anti-fibronectin and anti-SMA antibodies. As shown in Figures 1B and 1C , the results correlated with the RT-PCR data, demonstrating abundant expression of fibronectin and SMA in anterior polar cataracts. SMA was not detected in nuclear cataractous LECs by western blot analysis. These data were consistent with those in a previous study in which strong immunostaining for SMA was shown in spindle-shaped cells in human anterior subcapsular cataract. ²⁵ Abundant fibronectin was observed in SDS-soluble and urea-soluble fractions of protein extract of anterior polar cataracts. By contrast, fibronectin was barely detected in LECs obtained from lenses with nuclear cataracts. Fibronectin has been detected in subcapsular plaques in rat lenses cultured with TGF-β2 and in LECs transformed into mesenchyme-like cells within type I collagen gel. ^{18 20} Taken together, our results demonstrate that increased fibronectin accumulation is an additional pathologic marker of human anterior subcapsular cataracts. 

Enhanced mRNA Expression of TGF-β, TGF-βR, CTGF in Human LECs of Anterior Polar Cataracts

Next, we determined mRNA levels of various growth factors and growth factor receptors in nuclear and anterior polar cataracts. Figure 2 A indicates that expression of mRNA for TGF-β1, TGF-β2, type II TGF-βR (TβRII), and CTGF was greater in epithelial cells from lenses with anterior polar cataracts compared with epithelial cells from nuclear cataracts. In comparison, levels of mRNA for epidermal growth factor (EGF), FGF-2, epidermal growth factor receptor (EGFR), FGF receptor-1, and the β-actin internal standard were similar in LECs from both types of cataract. Similar elevation of the levels of TGF-β, TGF-β receptor, and CTGF in anterior polar cataracts was observed when compared with those in noncataractous LECs (Fig. 2B) . 

Induction of mRNA Expression of Fibronectin, Type I Collagen, andα -SMA by TGF-β1 in LECs

The above results suggest that TGF-β enhances the expression of mRNA encoding extracellular matrix proteins and SMA in LECs of anterior polar cataracts. Because human LECs have a limited availability and proliferative potency, we used animal lenses to examine the production of mRNAs for fibrotic marker proteins in response to treatment with TGF-β1. Figure 3 A shows that TGF-β1 mediated marked accumulation of mRNA for fibronectin and type I collagen in bovine lens epithelial explants within 24 hours. SMA mRNA was also significantly upregulated by TGF-β1 in rabbit lens culture (Fig. 3C) . FGF-2, a potent inducer of lens fiber differentiation ²⁶ did not induce SMA mRNA expression. Similar data were reported previously at the protein level. ²⁷ Western blot analysis confirmed that treatment with TGF-β1 led to increased accumulation of fibronectin in bovine LECs (Fig. 3B) and of SMA in rabbit LECs (Fig. 3D) . 

Discussion

Previous studies have demonstrated that LECs of anterior subcapsular cataracts and anterior polar cataracts are transdifferentiated into fibroblast-like cells and produce a large amount of extracellular materials not normally present in the lens capsules. ^{14 17 28} Similar changes in the production of extracellular matrix components are also seen in posterior capsular opacification after cataract surgery (after-cataract). After-cataract is thought to be caused by transdifferentiation of LECs remaining after cataract surgery. ¹⁵ TGF-β has been proposed as the most important factor driving the transdifferentiation and pathologic fibrosis of LECs that occur in anterior subcapsular cataracts and after cataract surgery. In cultured rat lenses, treatment with TGF-β leads to the formation of distinct anterior opacities accompanied by the appearance of spindle-shaped cells, capsule wrinkling, and deposition of abnormal extracellular matrix components, such as type I collagen. ²² The spindle-shaped cells induced by TGF-β accumulate α-SMA, a specific marker for myofibroblastic cells. ^{21 23 27} According to a recent report, transgenic mice exhibiting lens-specific expression of active TGF-β1 driven by the αA-crystallin promoter also developed anterior subcapsular cataracts. ²⁴ Focal plaques of spindle-shaped cells in lenses of these transgenic mice showed strong reactivity to α-SMA. 

Although the potential effects of TGF-β on cataract induction have been studied in vitro and in animal models as described herein, the expression level of TGF-β in clinical situations has not yet been explored. In the present study we characterized LECs of anterior polar cataracts by examining changes in gene expression of fibrotic markers, various growth factors, and growth factor receptors at mRNA level. We demonstrated that LECs from anterior polar cataracts had elevated levels of TGF-β1, TGF-β2 and TGF-β receptor II mRNAs when compared with specimens from age-related nuclear cataracts. Our findings further support the concept that TGF-β is responsible for the transdifferentiation of LECs in these cataracts. This is supported by previous studies showing that TGF-β promotes epithelial–mesenchymal transformation in other cell systems. ^{3 4} Our data are also in agreement with the reports indicating elevated levels of TGF-β mRNA and TGF-β protein in fibrotic areas of lung, kidney, and skin. ^{7 29 30} Increased levels of mRNAs for TGF-β and TGF-β receptor shown in this report suggest the existence of an autocrine pathway by which TGF-β could modulate transdifferentiation and extracellular matrix production of LECs. Induction of TGF-β mRNA by TGF-β has been demonstrated in target cells in vitro. ^{31 32}  

TGF-β is secreted in a latent form noncovalently associated with latency-associated peptide, which is often disulfide-linked to another protein, latent TGF-β–binding protein. Activation of TGF-β from this latent complex is a key regulatory step controlling the bioactivity of this growth factor. ³³ Our results showing the presence of TGF-β message in noncataractous LECs and LECs with nuclear cataracts may support the previous idea that the endogenous TGF-β in the ocular media mostly exists in a latent form and that the crucial step of pathogenesis is the inappropriate activation of latent TGF-β. ^{24 48} It is complicated, however, to estimate the amount of active TGF-β accessible to LECs in vivo and to compare the magnitude of latent TGF-β activation between nuclear cataracts and anterior polar cataracts in quantitative assays. Nevertheless, the initial cause that leads to latent TGF-β activation in intraocular environments during the pathogenesis of anterior polar cataract remains to be studied. The mechanisms implicated in physiological activation of latent TGF-β are not completely elucidated. Results to date showed that latent TGF-β were activated by denaturing treatments, plasmin, calpain, reactive oxygen species, and thrombospondin in vitro. ^{33 34 35 36} Among these, thrombospondin-1 was suggested to be a major activator of latent TGF-β in vivo. ³⁷ Moreover, there is emerging evidence suggesting physiological roles of integrins in regulating TGF-β bioactivity. It has been shown that integrin αvβ6 can lead to TGF-β activation by interaction with latent TGF-β complex. ^{38 39} Integrin αvβ6 is upregulated by injury and inflammation, ⁴⁰ and thrombospondin is positively regulated by growth factors such as TGF-β and FGF-2. ^{41 42}  

Thus, various cytokines, growth factors, or some other factors released in response to certain ocular diseases or injury may stimulate these and other related physiological activator(s) to trigger the activation of latent TGF-β in the ocular media and set the resultant active TGF-β to influence lens cells. Although further studies are needed to determine how TGF-β mRNA overexpression is initiated and sustained in the LECs of anterior polar cataracts, it is probable that the described events stimulate latent TGF-β to become activated, and once activated, this growth factor induces matrix deposition and its own expression from LECs. In limited injury, the production of TGF-β is transiently increased and then terminated when tissue repair is complete. As previously proposed, however, repeated injury could lead to continuous autocrine induction of TGF-β overriding the termination signals, which results in overproduction of TGF-β and extracellular matrix. ⁵ This could consist of an underlying mechanism for sustained gene expression of TGF-β and extracellular matrix in anterior polar cataract documented in this article. 

TGF-β signals by simultaneously contacting two transmembrane proteins, the type I (TβRI) and type II (TβRII) receptors. The cytoplasmic kinase domains of both receptors are essential for signal initiation. ^{43 44} Previously, type I and type II TGF-β receptors were detected by immunohistochemistry in adult rat LECs. ⁴⁵ Because TGF-β receptors determine cellular responsiveness to their ligands, the presence of cells overexpressing the TGF-β receptor in anterior polar cataract suggests that anterior polar cataract development involves the transformation of LECs toward an increased TGF-β responsiveness. Enhanced expression of mRNA for TGF-β receptors has been noted in pancreatic tissue samples from patients with acute necrotizing pancreatitis, suggesting that TGF-βs may be involved in tissue remodeling and the fibrotic reaction that occurs in the pancreas after necrosis. ⁴⁶  

TGF-β consists of three isoforms, TGF-β1, 2, and 3, that are structurally and functionally related to one another. ^{44 47} Although the relative roles of TGF-β1 and TGF-β2 in the transdifferentiation and fibrotic process could not be determined in the present studies, Gordon–Thomson et al. ⁴⁸ reported that all three isoforms could induce cataractous changes in cultured rat lenses and lens epithelial explants. According to their results, TGF-β2 and TGF-β3 were more potent than TGF-β1 in inducing cataract. Furthermore, all three isoforms or their mRNAs were detected in the lens, suggesting the availability of these polypeptides in vivo. TGF-β has been detected in high concentration in the aqueous humor from several mammalian species, ^{49 50} and its concentration in this fluid was altered after experimental cataract surgery. ⁵¹ The sources of TGF-β in the anterior chamber have not completely been identified. A recent report showed that LECs secrete TGF-β2 in vitro, suggesting that the lens may be one source of TGF-β in vivo. ⁵² In this regard, it may be worthwhile to examine in a future study whether the observed enhancement of mRNA amount for TGF-β1 and TGF-β2 in LECs with anterior polar cataract is consequently reflected in increased TGF-β levels in the corresponding aqueous humor. 

CTGF mRNA increased in a coordinate fashion with the mRNA for TGF-β, suggesting its potential role in the aberrant extracellular matrix production seen in fibrotic cataract. TGF-β is known to induce CTGF expression. ¹⁰ Thus, enhancement of CTGF mRNA expression in the clinical samples of anterior polar cataract indicates that this growth factor may be increased by TGF-β in LECs. CTGF levels may increase during wound healing, where this growth factor stimulates fibroblasts to proliferate and secrete increased amounts of extracellular matrix materials. ⁵³ Our unpublished results (1998) showed that CTGF message was present in the human B-3 lens epithelial cell line and in fresh-isolated bovine LECs. Taken together, these are the first results demonstrating the presence of CTGF message in LECs. Further studies are required to test whether CTGF protein is expressed in LECs and whether TGF-β increases CTGF levels in these cells. 

TGF-β increased collagen and fibronectin mRNA accumulation in LECs, consistent with results shown in a variety of cell types. ^{54 55 56 57} Previous studies have shown that rat lens epithelial explants accumulate SMA protein when cultured in the presence of TGF-β. ²⁷ TGF-β significantly increases SMA protein levels in bovine LECs when epithelia are cultured in a collagen gel, whereas FGF-2 decreases it. ⁵⁸ In our experiments TGF-β1 induced SMA mRNA expression in rabbit LECs in intact lenses. This result is in accord with those in previous work showing TGF-β–mediated induction of SMA mRNA in other cultured cells. ^{59 60} When we initially analyzed mRNA expression for the previously mentioned myofibroblastic markers in fresh bovine lens epithelial explants, messages for these proteins were not detected in LECs in intact bovine lenses. We observed that a substantial amount of SMA mRNA but not of fibronectin and type I collagen mRNA appeared in the explants cultured for 24 hours without treatment with TGF-β1 (data not shown). This was similar to a previous study, which showed that rat lens epithelial explants cultured for 3 days without the addition of any growth factors showed some cells immunoreactive for SMA. ²⁷ It was thought that contact of the cells with plastic may induce SMA expression. This led us to examine SMA mRNA regulation by TGF-β in intact lenses. 

In summary, this report represents the first study that analyzed mRNAs for proteins associated with pathologic fibrosis in LECs obtained from patients with anterior polar cataracts. TGF-β, TGF-β receptor, and CTGF mRNAs were elevated in these LECs, suggesting a role for these growth factors in the pathologic accumulation of extracellular matrix. Our results also show that TGF-β increased the production of mRNAs encoding extracellular matrix proteins in the lens epithelium in vitro. Therapeutic approaches antagonizing the actions of TGF-β have already been attempted in fibrotic disease models involving major organs. ⁶ Recent studies point to CTGF as a new target for the development of effective drug therapies. In this regard, the present work may provide an insight into the cellular and molecular mechanisms involved in the pathogenesis of cataract and after-cataract and may lead to the development of therapies to inhibit cataractogenesis and prevent after-cataract. 

 Reprint requests: Choun-Ki Joo, Department of Ophthalmology and Visual Science, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Seocho-ku, Seoul, Korea.

 Presented at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May 1998.

 Supported by Grant 98-0403-17-01-3 from Korean Science and Engineering Foundation, Taejon, Korea, and Grant 98-MM-01-01-A-01 from Korean Ministry of Science and Technology, Seoul, Korea.

 Submitted for publication November 11, 1998; revised March 12, 1999; accepted March 25, 1999.

 Proprietary interest category: N.

 

Table 1.

 

Primers and Expected Sizes of PCR Products with Each Primer Pair

Gene	Size (bp)	Upstream Primer	Downstream Primer	Reference
Human
Collagen I	693	tccaaaggagagagcggtaa	gaccagggagaccaaactca
Fibronectin	421	gcctggtacagcctatgtagtg	atcccagctgatcagtaggctg
SMA	516	cccagccaagcactgtca	tccagagtccagcacgatg
EGF	415	tatgtctgccggtgctcagaa	agcgtggcgcagttcccacca	61
EGFR	1157	tgaccgtttgggagttgatg	tgcttcacagtttgaagaca	61
FGF-2	422	ttcaaggaccccaagcggct	ggccattaaaatcagctctt	61
FGFR-1		cgagctcactgtggagtatccatg	gttacccgccaagcacgtatac	61
α Motif	1100
β Motif	800
γ Motif	1000
TGF-β1	266	ccgcaaggacctcggctggaa	gatcatgttggacagctgctc	61
TGF-β2	686	gagaggagcgacgaagagta	ctcaagtctgtaggagggca
TβRII	507	gccaacaacatcaaccacaa	aaagcccaaagtcacacagg
CTGF	483	acgagcccaaggaccaaa	ttgtaatggcaggcacagg
β-Actin	552	atcatgtttgagaccttcaacacc	catggtggtgccgccagacag
Bovine
Fibronectin	735	ggtaacgaaggctccactgc	accagattcctcttatcaactg
Collagen I	387	gaaaggagagagcggcaac	tcaataccagggagacccac
β-Actin	552	atcatgtttgagaccttcaacacc	catggtggtgccgccagacag
Rabbit
SMA	516	cccagcccagcactgtca	cattgtgctggactctgga
β-Actin	350	aggccaaccgcgagaagatgacc	aggccaaccgcgagaagatgacc	61

Figure 1.

 

Enhanced expression of fibronectin, type I collagen, and α-SMA in human LECs of anterior polar cataracts (AP). (A) Total cellular RNA was isolated from LECs of patients with AP and nuclear (N) cataracts, and mRNA levels for β-actin, fibronectin (FN), type I collagen (Col I), and α-SMA (SMA) were examined by RT-PCR, as described in the Materials and Methods section. The data shown are from two of four independent assays. (B, C) Cell lysates were prepared from LECs attached to the anterior capsules, and levels of fibronectin and SMA were assessed by western blot analysis. The data presented are from one of two independent assays that produced similar results. M, molecular size standards (A, base pairs; B, C, kilodaltons); SS, SDS-soluble fraction; TS, Triton-soluble fraction; US, urea-soluble fraction.

Figure 2.

 

Enhanced expression of TGF-β, TGF-β receptor, and CTGF in human LECs from anterior polar cataracts. Total RNA was isolated from LECs attached to the anterior capsules, and mRNA levels for the indicated growth factors and growth factor receptors were examined by RT-PCR. (A) . Similar data were obtained from four out of five independent assays. The magnitude of increase in TGF-β1 and TGF-β2 in the fifth assay was less than that in the other assays. The discrepancy may have been caused by the different intensity of opacification, because the patient from whom this sample was obtained had milder anterior polar opacification than the other four. (B) Similar data were obtained from two independent assays. M, molecular size standards (base pairs); N, nuclear cataracts (A), noncataractous lenses (B); AP, anterior polar cataracts.

Figure 3.

 

Induction by TGF-β1 of fibronectin (FN) and SMA mRNA and protein in LECs. (A) Bovine lens epithelial explants were freshly prepared and cultured with or without TGF-β1 (10 ng/ml). After 24 hours, total RNA was isolated and subjected to RT-PCR analysis to determine mRNA expression of extracellular matrix proteins. (B) At the indicated time points, cell lysates were prepared from cultured bovine lens epithelial explants and assessed for fibronectin accumulation. Data shown are from one of two independent experiments that produced similar results. (C) Rabbit lenses were cultured in the presence of recombinant human TGF-β1 (20 ng/ml), FGF-2 (20 ng/ml), or medium only for 24 hours. Then total RNA was extracted from LECs and used for RT-PCR assay. (D) After 3 days, cell lysates were prepared and assessed for SMA expression by western blot analysis. Two additional experiments performed in the same manner gave similar results. M, molecular size standards (base pairs A, C; kilodaltons B, D); C, control cells; F, cells cultured with FGF-2; T, cells cultured with TGF-β1.

The authors thank David Beebe, Washington University School of Medicine, St. Louis, Missouri, and John McAvoy at The University of Sydney, Australia, for their valuable comments and critical review of the manuscript; and Jong-Tak Kim and Young Seomun for their technical assistance.