Identification of Differentially Expressed Genes in Mouse Pax6 Heterozygous Lenses

Abstract

purpose. Pax6 is a critical regulator of the developing lens, other ocular tissues, central nervous system, and pancreas. Downstream targets of Pax6 are largely unknown. The present study was designed to identify differentially expressed genes in Pax6 heterozygous and normal mouse lenses.

methods. RNAs from 8-week-old normal and Pax6 heterozygous mouse lenses were analyzed by both RT-PCR differential display and a candidate-gene approach. The expression levels of identified genes were confirmed by semiquantitative RT-PCR.

results. Eight transcripts encoding phosphatase inhibitor Pip-1 protein, heat shock protein Hsp40, Purkinje cell protein Pcp4, an expressed sequence tag (EST; AA331381) originally reported in a brain-specific library, Pitx3, and CBP, were confirmed to be downregulated in the Pax6 heterozygous mouse lenses. αB- and βA3/A1-crystallin transcripts exhibited decreased expression in Pax6 heterozygous lenses, whereas the expression levels of other crystallins were virtually unchanged.

conclusions. The present data identify eight genes with expression levels that are decreased in Pax6 heterozygous lenses and provide evidence that four functional categories of transcripts—namely, small hsps (αB-crystallin and Hsp40), crystallins (αB- and βA3/A1-crystallin), transcription factors (Pitx-3 and CBP), and components of signal transduction cascades (Pip-1) are under direct or indirect transcriptional control by Pax6.

The critical regulatory gene Pax6 is located on human chromosome 11p13 and mouse chromosome 2. It is expressed in many developing ocular tissues, brain, and pancreas. ¹ The Pax6 gene encodes a specific DNA-binding transcription factor capable of initiating ectopic lens ² and eye ³ development. Heterozygous mutations in human PAX6 induce a spectrum of ocular diseases including aniridia, Peters anomaly, autosomal dominant keratitis, foveal hypoplasia, and early-onset cataracts. ¹ In addition, more recent studies showed that PAX6 haploinsufficiency in humans leads to cerebral malformations and olfactory dysfunction. ⁴ Homozygous PAX6 mutations cause anophthalmia, brain malformation, and neonatal lethality. ⁵ Two major forms of the protein, Pax6 and Pax6(5a), result from alternate splicing of Pax6 mRNA. ⁶ The function of Pax6(5a) has not been studied as extensively as Pax6; however, overexpression of PAX6(5a) relative to PAX6 was detected in human congenital cataracts. ⁵ Ectopic expression of Pax6(5a) in lens fiber cells of transgenic mice results in an abnormal lens phenotype, associated with changes in the levels of cell adhesion proteins. ⁷  

The expression pattern of Pax6 in the developing mouse embryo and other vertebrate systems reveals a dynamic behavior of Pax6 from the onset of expression (mouse embryonic day [E]8.0) up to the end of organ morphogenesis. ⁸ Pax6 is also expressed in many adult tissues. ^{9 10 11} Despite extensive studies indicating roles for Pax6 in biological processes, as diverse as cellular proliferation, differentiation, cell migration, cell-to-cell adhesion, and signal transduction pathways, the genes directly regulated by Pax6 are largely unidentified. Studies on the transcriptional regulation of crystallin genes in vertebrate lenses implicate Pax6 as a critical regulatory factor influencing, at least, αA-, αB-, δ1-, βB1-, and ζ-crystallins. ^{12 13} In addition, two genes expressed in the cornea, keratin K12 and gelatinase B, are known to be transcriptionally regulated by Pax6. ^{14 15} Pax6 has also been implicated in transcriptional control of a small set of genes expressed in the developing lens, encoding diverse transcription factors, including Eya-1 and -2, and c-Maf. ^{16 17} In the optic cup and stalk, Pax6 has been shown to control expression of Pax2. ¹⁸ Finally, in nonocular tissues, the genes directly regulated by Pax6 in the brain and pancreas are L1 CAM and insulin, glucagon and somatostatin, respectively. ^{19 20} In all instances, except for Eya-1 and -2, Pax6 has been shown to directly bind regulatory elements of the genes just listed. ^{12 13 14 15 17 18 19 20} In addition, analysis of mouse embryonic Pax6-null brains has shown that cadherin 6, Lim-1, Gsh1, Islet-2, and Wnt-7b are also possibly directly activated by Pax6. ^{21 22 23}  

High-throughput technologies based on expression analysis of mRNA involving cDNA microarrays ²⁴ and differential display RT-PCR (RT-PCR-DD) ²⁵ offer rapid detection of novel candidate target genes for developmental regulatory factors. Pax6 haploinsufficient lenses can serve as an advantageous system to identify genes regulated by Pax6, because Pax6 homozygous embryos are completely without lenses. In the current study, we used RT-PCR-DD and a candidate-gene approach to identify target genes of Pax6. These methods were chosen over others, because they can be reliably conducted with relatively small amounts of RNA, ²⁶ and, in contrast to cDNA microarrays, can detect low-level transcripts. These strategies yielded eight genes showing reduced expression in the Pax6 haploinsufficient lenses. The functional roles of these genes agree with established roles of Pax6 in lens biology. Collectively, the present data provide the molecular basis for understanding the role of Pax6 and other critical transcription factors required for lens development and maintenance. 

Methods

Animals and Genotyping

Transfection and CAT Assay.

Pax6 heterozygous lenses were dissected from 8-week-old transgenic Pax6 knockout/lacZ knockin mice that were generously provided by Peter Gruss, Max-Planck-Institute of Biophysical Chemistry, Göttingen, Germany. ²⁷ Although approximately 75% of all Pax6 heterozygous lenses were found in the normal position, and their microdissection did not require a specialized technique, approximately 25% of mutated lenses were found buried inside the eyeball, and extra pressure was needed for their microdissection. Wild-type lenses of the same age and NMRI strain used for the knockout were obtained from the Charles River Laboratories (L’Arbresle, France). RNA preparations were prepared with a kit used as specified by the manufacturer (Totally RNA; Ambion, Woodlands, TX). 

Genotyping of Animals.

To confirm the genotype of Pax6 heterozygous lenses, RT-PCR was conducted using primers designed to amplify Pax6 (5′-TTTAACCAAGGGCGGTGAGCAG-3′ and 5′-TCTCGGATTTCCCAAGCAAAGATG-3′) and lacZ (5′-GTCAGGTCATGGATGAGCAG-3′ and 5′-CACTACGCGTACTGTGAGC-3′) mRNAs, by using a commercial system (One Step RT-PCR; Life Technologies, Inc., Gaithersburg, MD). The initial RT step was conducted at 50°C for 30 minutes, and amplifications were conducted at the annealing temperature of 58°C. 

Reverse Transcriptase–Polymerase Chain Reaction Differential Display

First-Strand cDNA Synthesis.

Indicated amounts of total RNA (Fig. 1) were subjected to reverse transcription with 0.2 μM of an anchored primer (AP1) of sequence 5′-ACGACTCACTATAGGGCTTTTTTTTTTTTAA-3′ containing the T7 promoter sequence(italic), a T12 anchoring sequence, and two anchoring bases. First-strand synthesis was performed by incubation at 25°C for 10 minutes, 42°C for 60 minutes, and 70°C for 15 minutes, in the presence of 25 μM of each deoxyribonucleoside triphosphate, 10 mM dithiothreitol, 20 U RNAsin (Promega, Madison, WI) and 40 U reverse transcriptase (Superscript II; Gibco-BRL, Gaithersburg, MD) in a volume of 20 μL reverse transcription buffer (50 mM Tris [pH 8.3], 6 mM MgCl₂, 10 mM KCl). 

Amplification of Double-Stranded cDNA Fragments.

Double-stranded cDNAs were amplified by PCR with two different primer sets. Both reactions used 0.2 μM of the anchored first-strand synthesis primer shown earlier (5′-ACGACTCACTATAGGGCTTTTTTTTTTTTAA-3′). Separate reactions used either 0.2 μM of arbitrary annealing primer one (AR1; 5′-ACAATTTCACACAGGACGACTCCAAG-3′) or arbitrarily annealing primer 2 (AR2; 5′-ACAATTTCACACAGGAGCTAGCATGG-3′). Both primers contain the M13 reverse sequence (italic). PCR was performed with 1 U Taq polymerase (AmpliTaq; Perkin Elmer, Norwalk, CT) in the presence of 2.5 μCi [a-³³P]-deoxyadenosine triphosphate (1000–3000 Ci/mmol; New England Nuclear-DuPont, Boston, MA), 1.5 mM MgCl₂, and 100 μM deoxynucleoside triphosphates, in a reaction volume of 20 μL, the PCR cycles were as follows: one at 95°C for 2 minutes; four at 92°C for 15 seconds, 46°C for 30 seconds, and 72°C for 2 minutes; 25 at 92°C for 15 seconds, 60°C for 30 seconds, and 72°C for 2 minutes; and 1 at 72°C for 7 minutes. After amplification, [α-³³P]–labeled cDNA fragments were separated by electrophoresis on 4.5% polyacrylamide, 8 M urea gels and visualized by autoradiography. 

Reamplification of Differentially Displayed Bands.

Bands of differing intensity, and two unchanged bands (as the control), between the cataract and the normal samples were excised from the gel, and the resultant gel slices were directly subjected to PCR. cDNAs were bidirectionally amplified with 0.2 μM each full-length T7 primer (5′-GTAATACGACTCACTATAGGGC-3′) and M13 reverse (−48) sequencing primers (5′-AGCGGATAACAATTTCACACAGGA-3′). The PCR conditions and cycles used in these procedures were identical with those described for amplification of double-stranded cDNA fragments, except that [α-³³P] deoxyadenosine triphosphate was omitted from the reaction mixture. Products were separated by electrophoresis on 1.2% agarose gels and visualized by ethidium bromide staining. 

Cloning and Sequence Analysis of Differentially Displayed cDNAs.

Reamplified bands were analyzed by electrophoresis on 1.2% agarose gels. The products were then cloned into the TOPO TA cloning vector (Invitrogen, San Diego, CA), according to the manufacturer’s instructions. Cloned DD products were sequenced by fluorescent dye terminator cycle sequencing, as specified by the manufacturer (PE Applied Biosystems, Warrington, UK), using a sequencing primer (5′-GCTCGGATCCACTAGTAACGG-3′) complementary to the vector (TOPO TA) SP6 sequence. Reactions were run and sequences analyzed on a DNA sequencer (model 373a; Applied Biosystems, Foster City, CA). Sequences were analyzed using the BLAST algorithm with GenBank data (provided in the public domain by the National Center for Biotechnology Information Bethesda, MD, and available at http://www.ncbi.nlm.nih.gov), and sequence alignments were performed by computer (MegAlign program in Lasergene; DNASTAR, Inc., Madison, WI). 

Analysis of Differentially Expressed Genes

Three genes, encoding argininosuccinate synthetase, uridine monophosphate kinase, and Pax6, were used as controls for semiaquantitative RT-PCR. Uridine monophosphate kinase and argininosuccinate synthetase were identified as unchanged genes in a parallel cDNA microarray experiment. ²⁸ The primers were designed using a commercial algorithm (Prime from the GCG package; Oxford Molecular Group, Inc., Campbell, CA). The primer sets are shown in Table 1 . Primers and conditions used to amplify αA-, αB-, βB1-, βA3/A1-, γB-, and γE+F-crystallins were described elsewhere. ^{29 30}  

Indicated transcripts were reverse transcribed and amplified (One Step RT-PCR system; Life Technologies, Inc.). Where indicated, control reactions were performed identically in the absence of reverse transcriptase. The amount of RNA was 50 and 10 ng per assay. The initial reverse transcriptase step was conducted at 50°C for 30 minutes. Primers used in this study (Table 1) were either designed to cross intron–exon boundaries, or, in the absence of this information, were tested in the absence of reverse transcriptase. The annealing temperatures used for individual experiments were 53°C (argininosuccinate synthetase), 54°C (Pcp4), 55°C (uridine monophosphate kinase, expressed sequence tag [EST] AA331381, and β1-integrin), and 56°C for all remaining genes. Amplification of Pitx3 was conducted in the presence of 10% dimethyl sulfoxide (DMSO). Control reactions were performed to ensure linearity of amplification over the concentrations of RNA in the present study. 

Results

RT-PCR-DD between Pax6 Heterozygous and Normal Lenses

Differential display was performed on RNAs isolated from 40 normal and 48 heterozygous Pax6 lenses, by using two different primer sets (Fig. 1) . Figure 1A is a portion of the differential display profile obtained with primer set AR1, and Figure 1B is a portion of the differential display profile obtained using primer set AR2 (see the Methods section). Multiple gene expression differences were detected with both primer sets (compare Figs. 1A and 1B ). Seven bands (I–VII) excised from the differential display gel were successfully reamplified. All exhibited decreased expression, whereas no band exhibiting increased expression in Pax6 was successfully reamplified. Reamplified bands were cloned and identified by sequencing. 

Of the seven clones, four were highly similar to cellular genes found in GenBank and were further pursued. These included phosphatase inhibitor protein Pip-1 (band II), Hsp40 (band I), Pcp4 (band III), and an EST (AA331381; band IV). Two bands (V and VI), which encoded a mitochondrial cytochrome c oxidase, and a third unidentifiable band (VII) were not pursued further. 

Confirmation of Transcript Levels

Differential expression of mRNAs encoding Pip1, Hsp40, Pcp4, and an EST (AA331381) encoding a large protein found in a brain cDNA library was confirmed by RT-PCR. The critical step in comparison of two similar RNA preparations is to find genes with expression that is unchanged. In this study, we took an advantage of a parallel cDNA microarray analysis and used the argininosuccinate synthetase and uridine monophosphate kinase as common reference mRNAs. ²⁸ Figure 2A shows amplification of uridine monophosphate kinase in the presence and absence of reverse transcriptase to demonstrate the absence of genomic DNA in the RNA preparations. As expected, expression of these genes was not changed (Fig. 2B) , when the same amounts of RNA were used in all samples. Next, we compared the expression levels of Pax6 mRNA between normal and heterozygous lenses, confirming that Pax6 expression is reduced in the heterozygous lenses (Fig. 2B) . Consistent with the differential display result, the expression levels of Pip-1, Hsp40, Pcp4, and EST (AA331381) transcripts were reduced in the heterozygous lenses relative to the wild-type lenses when examined by RT-PCR (Fig. 2C) . 

Analysis of Transcripts Encoding Transcription Factors and Major Crystallins

Previous studies have indicated that Pax6 may directly or indirectly regulate the transcription of numerous genes, including diverse families of crystallins and transcription factors. To determine what other transcription factors Pax6 might regulate, we chose to examine Pitx3, CBP, p53, and pRb as candidate genes. These transcription factors are important regulatory proteins of the embryonic lens formation and/or lens homeostasis as judged from mouse ^{31 32 33 34} and human ^{35 36} models. Reduced levels of Pitx3, CBP, pRb, and p53 expression were indeed detected in the heterozygous lenses (Fig. 3) . In addition, we also examined the level of β1-integrin expression between Pax6 heterozygous and normal lenses, because this gene has been found to be differentially expressed at the mRNA and protein levels in transgenic lenses overexpressing Pax6(5a). ⁷ The present results demonstrated that β1-integrin expression is increased in Pax6 heterozygous lenses compared with wild-type when examined by RT-PCR (Fig. 3) . 

Because crystallin gene expression is believed to be regulated by Pax6, we also compared the levels of αA-, αB-, βB1-, βA3/A1-, and γ-crystallin transcripts between normal and heterozygous lenses. Reduced levels of αB- and βA3/A1-crystallin mRNAs were detected (Fig. 4) . By contrast, the levels of αA-, βB1-, and γ-crystallin mRNAs were not changed. 

Discussion

Since it was first identified in 1991, a large body of information about transcription factor Pax6 has been accumulated during the past decade. Pax6 is essential for normal visual system development; however, which genes are directly regulated by Pax6 is largely unknown. Previous studies have identified Pax6 as a regulatory gene for a small number of regulatory genes and several structural genes, including the crystallins in the lens. Morphologically, Pax6 heterozygous mouse lenses appear smaller, with occasional cataractous changes in the anterior epithelium, ^{37 38} whereas human lenses develop to the normal size and exhibit numerous cataractous changes. ^{1 39}  

In the current study, we examined the impact of Pax6 haploinsufficiency on the expression of genes in the lens. From the number of bands with different intensities compared with bands with even intensities found in two separate experiments, it appears that large proportion of genes have expression levels that are altered in Pax6 heterozygous lenses. There are also distinct bands suggesting upregulation of some genes in the Pax6-haploinsufficient lens, consistent with the possibility that Pax6 acts both as an activator and repressor of transcription. ⁴⁰ This idea is also supported independently by findings in a parallel study in which cDNA microarray technology was used, showing that approximately 10% of the expressed genes are differentially expressed in Pax6-mutated lenses. ²⁸  

In the present study we identified a novel group of genes, Pip-1, Hsp40, Pcp4, and an EST (AA331381), all of which are expressed at reduced levels in the Pax6 heterozygous lens compared with wild-type. The expression levels of these genes’ mRNAs were compared with those of natural control genes, namely argininosuccinate synthetase and uridine monophosphate kinase. These were used instead of the GAPDH and β-actin genes that are widely used, but are not always reliable in establishing a transcriptional base line between two expression level variables. The present data show that Pip-1, Hsp40, Pcp4, and an EST (AA331381) are expressed in Pax6 heterozygous lenses at reduced levels. Additionally, these four genes have not been detected previously in the mouse lens, although all of them seem to have restricted patterns of expression. Pcp4 is highly expressed in the mouse brain, primarily in cerebellar Purkinje cells and cortex. ^{41 42} Pip1 is expressed in a variety of tissues, including the embryonic eye. ^{43 44} The highest levels were observed in the brain, skeletal muscle, and kidney. Hsp40 is a member of family of Hsps including a-crystallins. ^{45 46} Examination of genomic fragments containing promoters of these genes revealed the presence of several candidate Pax6-binding sites, by using the known consensus sequences for the Pax6 paired domain (data not shown). Thus, our data raise the possibility that Pax6 can act as a modulatory transcription factor for these genes. 

In this study, we also characterized the RNA levels of major mouse crystallins and several important transcription factors. Our data indicate that the Pax6 heterozygous adult lens expressed a lower level of αB- and βA3/A1-crystallin mRNAs than did wild-type lenses. Our preliminary data also suggest reduction in the level of αB-crystallin and Hsp40 protein in Pax6 heterozygous lenses relative to normal lenses (data not shown). In our previous studies, we found evidence that αB-crystallin is directly regulated by Pax6 at the level transcriptional level. ^{47 48} This model was solely based on cell culture cotransfection experiments, followed by demonstration of Pax6 binding to the minimal lens-specific αB-crystallin promoter. Thus, earlier data combined with the present results further support a direct role of Pax6 in the transcription of αB-crystallin in the lens. In contrast, expression of αA-crystallin, another gene regulated by Pax6 in transfection studies, ⁴⁹ did not exhibit altered expression levels in the Pax6 heterozygous lenses. 

We also found reduced levels of expression of Pitx3, a homeobox-containing gene, required for normal lens development. ^{32 35} Mutations in human PITX3 cause congenital cataract, and the expression pattern of the Pitx3 gene in the mouse lens indicated the possibility that Pax6 might directly control expression of this gene. The present data, demonstrating decreased expression of Pitx3, support the hypothesis that Pax6 may directly or indirectly regulate Pitx3. ²⁸ Another gene identified was CBP, a coactivator with histone acetyltransferase and bromodomain that causes Rubinstein-Taybi syndrome, characterized by mental retardation, malformed thumbs and toes, and a wide array of ocular defects, including cataract and glaucoma. ³⁶ Because of the broad expression pattern of CBP in mouse and human tissues, its reduced expression in Pax6 heterozygous lenses is probably an indirect effect. 

The present data show increased level of expression of β1-integrin in Pax6 heterozygous lenses. Our earlier analysis of transgenic lenses of comparable age overexpressing PAX6(5a) have shown increased levels of both β1-integrin mRNA and protein. ⁷ In Pax6 heterozygous lenses, both major forms of Pax6, Pax6 and Pax6(5a), are reduced (Fig. 2B) , as expected and in agreement with our parallel study. ²⁸ However, in PAX6(5a) transgenic lenses, we observed both increased levels of ectopic PAX6(5a), as expected, ⁷ and endogenous Pax6 and Pax6(5a) ²⁸ as a result of transcriptional autoregulation of the Pax6 promoter. ^{50 51} The increased level of β1-integrin mRNA in Pax6 heterozygous lenses (Fig. 3) suggest that Pax6 and/or Pax6(5a) repress the expression of the endogenous β1-integrin. An alternative possibility is that β1-integrin mRNA is stabilized in Pax6 heterozygous lenses. These possibilities are not mutually exclusive. In contrast, increased levels of β1-integrin, together with elevated levels of Pax6/Pax6(5a)/PAX6(5a) in 5a-transgenic lenses ²⁸ suggest that this tripartite Pax6 complex activates β1-integrin expression. The most likely source for this apparent discrepancy is based on four earlier observations. First, it has been shown that additional copies of the entire Pax6 locus (approximately 450 kb) studied in transgenic mice causes ocular and lens abnormalities similar to Pax6 haploinsufficiency. ⁵² Second, many reporter genes activated by low concentrations of Pax6 in transient transfections are repressed as Pax6 levels increase. ^{53 54} Third, studies of artificial promoters activated by either Pax6 or Pax6(5a) have shown that the activation levels of these distinct forms of Pax6 protein can differ by one order of magnitude. ⁵⁵ Fourth, adult human lenses express PAX6 and PAX6(5a) transcripts at a ratio of approximately 1:1, whereas the protein ratio is not yet known. ¹¹ Thus, it is possible that overexpression of PAX6(5a) in the transgenic lenses could increase the level of β1-integrin due to the abnormal total concentration of Pax6 proteins together with the abnormal ratio of Pax6 to Pax6(5a)+PAX6(5a). In Pax6 heterozygous lenses, the reduced levels of both Pax6 and Pax6(5a) should not change the Pax6-to-Pax6(5a) ratio, and β1-integrin can appear as a transcriptionally repressed gene, whereas both copies of thePax6 gene can activate the β1-integrin. Identification of candidate genes that are sensitive to the Pax6-to-Pax6(5a) ratio is important for the understanding of congenital lens cataract caused by mutations affecting the splicing of human PAX6. ^{6 56}  

Our data provide the first description of differentially expressed genes in Pax6 heterozygous lenses, an important step toward mapping of the lens transcriptome in normal and mutated genetic backgrounds. It would be interesting to compare the present data with other systems in which mutations of genes encoding transcription factors (e.g., Six5, CBP, and Pitx3) also result in the cataract phenotype. In addition, because Pip1, Pcp4, and an EST (AA331381) are preferentially expressed in the brain, it is possible that expression of these genes is also regulated in brain tissues expressing Pax6. Their abnormal expression may contribute to cerebral, olfactory dysfunction and psychiatric disorders possibly associated with mutations in the PAX6 locus. ^{4 57 58} Further studies will focus on identifying the entire spectrum of genes with expression levels that are altered in Pax6-mutated lenses and other ocular tissues, evaluating their expression patterns during eye development, and identifying the direct functional role of Pax6 in their regulation. 

²  Contributed equally to this work.

 Supported by Grants EY12200 (AC) and EY13022 (MK) from the National Eye Institute and Human Genome Program, and an unrestricted grant from Research to Prevent Blindness to the Department of Ophthalmology and Visual Sciences of the Albert Einstein College of Medicine. AC is a recipient of a Research to Prevent Blindness Career Development Award.

 Submitted for publication September 6, 2001; revised January 9, 2002; accepted January 30, 2002.

 Commercial relationships policy: N.

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Figure 1.

 

RT-PCR-DD with RNA isolated from Pax6 heterozygous and normal lenses. Autoradiograms of the normal (Wild-type, lanes 1 and 2) versus Pax6 heterozygous (Pax6 ^+/−, lanes 3 and 4) using two primer sets, AR1 (A) and AR2 (B). Arrows I –VII: positions of bands of differing intensity between the normal and mutated samples. Lanes 1, 100 ng; lanes 2, 50 ng; lanes 3, 200 ng; lanes 4, 100 ng total RNA. Each lane was loaded in duplicate.

Table 1.

 

Primers for RT-PCR

Gene Name/GenBank Accession Number	Size of Product (bp)	Primers (5′–3′)*
Argininosuccinate synthetase (AA419665)	106	F: GAAGCTTGGGGCCAAAAAGG
		R: ATAGCGGTCCTCGTAGAGTG
Uridinomonophosphate kinase	141	F: TGGAAGTGCCCTTTGCTGTC
(AA275763)		R: CAGTTCAACAAAACCAGCCCAG
Pax6/Pax6(5a)(X63963)	289/331	F: CGGCAGAAGATCGTAGAG
		R: GATGACACACTGGGTATG
Hsp40 (NM018808)	322	F: TGGCAGAAACCCCTTTGATAC
		R: TTCTTTCCAGCCCCTCTTCAC
Pip-1 (AF281676)	186	F: CTTGTGCTGACCAGTGATCAGTCC
		R: TTCTTCCCCTTGCTTCTGTTGCCC
Pcp4 (NM008791)	186	F: GAGATAATGATGGGCAGAAGAAAG
		R: CAGGGTGTGTATTGAGTGAGG
EST (AA331381)	201	F: AAACTCAAACAGGGCAGGAAC
		R: AATGCCTCCACAAGATCCAAC
β1-integrin (AI152300)	340	F: ACAGATGAAGTGAACAGTGAAG
		R: CACCACATTCACAAATACCCC
Pitx3 (AF005772)	162	F: ACCTTCCAGAGGAATCGCTA
		R: GAAGCCACCTTTGCACAGCT
CBP (U47741)	654	F: TGCCACCATGGAGAAGCACAAG
		R: ACGGGGCATTTGTTTTCTTGG
p53 (X02469)	265	F: ACATGACGGAGGTTGTGAGG
		R: GTGATGATGGTGAGGATGGG
pRb (NM009029)	269	F: GCTATGTCAAGACTGTTG
		R; TTGAGCAACATGGGAGGT

*  F, forward primer; R, reverse primer.

Figure 2.

 

Confirmation of differential expression of genes between in Pax6 heterozygous and normal lenses. (A) A representative experiment shows amplification of a PCR product using uridine monophosphate kinase–specific primers in the presence (+RT) and absence (−RT) of reverse transcriptase. (B) Expression of argininosuccinate synthetase, uridine monophosphate kinase, and Pax6 mRNAs between heterozygous (Pax6 ^+/−) and wild-type lenses. (C) Expression of Pip1, Hsp40, Pcp4, and an EST (AA331381) in Pax6 heterozygous (Pax6 ^+/−) and wild-type lenses. Size of specific PCR products is given in parentheses. (B, C) Lanes 1, 3 and 2, 4: 50 and 10 ng total RNA, respectively.

Figure 3.

 

Differential expression of mRNAs encoding a cell-adhesion molecule β1-integrin, and transcription factors Pitx3, CBP, p53, and pRb in wild-type and Pax6 heterozygous (Pax6 ^+/−) lenses. Size of specific PCR products is shown in parentheses. Lanes 1, 3 and 2, 4: 50 and 10 ng total RNA, respectively.

Figure 4.

 

Expression of mRNAs encoding αA-, αB-, βB1-, βA3/A1-, γE-, γF-, and γB-crystallin genes in Pax6 heterozygous and normal lenses. Size of specific PCR products is shown in parentheses. Lanes 1, 3 and 2, 4: 50 and 10 ng total RNA, respectively.

The authors thank Luc St.-Onge for the mice, Elena Semina for the Pitx3 primers, Ronald Burde and Harry Engel for encouragement during the course of this work, and the members of the Albert Einstein College of Medicine DNA Core Sequencing Facility and Mouse Facility for excellent service.