Elevated Expression of Transglutaminase 1 and Keratinization-Related Proteins in Conjunctiva in Severe Ocular Surface Disease

Abstract

purpose. In severe ocular surface diseases, pathologic keratinization of the ordinarily nonkeratinized corneal and conjunctival mucosal epithelia results in severe visual loss. The expression in conjunctivalized corneas of various proteins known to play important roles in the physiological keratinization process in human epidermis was examined to better understand the mechanism of keratinization.

methods. Conjunctiva covering the cornea was examined in 12 eyes with ocular surface disease in the chronic cicatricial phase. These comprised four Stevens–Johnson syndrome, four ocular cicatricial pemphigoid, and four chemical injuries. Normal conjunctivas from four age-matched individuals served as controls. Semiquantitative reverse transcription–polymerase chain reaction (RT-PCR) was used to investigate transglutaminase 1 gene expression and immunohistochemistry to study the expression of transglutaminase 1 protein along with other keratinization-related proteins (involucrin, loricrin, filaggrin, and cytokeratins 1 and 10) and cytokeratin pairs 4/13 and 3/12.

results. Semiquantitative RT-PCR showed that transglutaminase 1 mRNA expression was upregulated in keratinized conjunctiva compared with normal. Also, in this tissue, immunohistochemistry demonstrated elevated levels of transglutaminase 1, involucrin, filaggrin, and the cytokeratin pair 1/10. Levels of loricrin and cytokeratin pairs 4/13 and 3/12, however, remained the same.

conclusions. Various keratinization-related proteins, transglutaminase 1 included, are most likely involved in the pathogenesis of cicatrizing ocular surface diseases.

Severe ocular surface diseases such as Stevens–Johnson syndrome (SJS) and ocular cicatricial pemphigoid (OCP) are among the most challenging entities facing the clinician today. ^{1 2 3 4 5 6} Conventional management is generally unsatisfactory, and long-term ocular consequences are devastating. During the chronic cicatricial phase, most patients with ocular surface disease and those with severe chemical injuries experience numerous ocular surface problems, including symblepharon, entropion, ectropion, trichiasis, xerophthalmia, persistent epithelial defect, persistent conjunctival inflammation, corneal vascularization (conjunctivalization), and pathologic keratinization. Some of these can be managed by the use of antibiotics, corticosteroids, immunosuppressants, and/or artificial tears. The pathologic keratinization of the ordinarily nonkeratinized corneal and conjunctival epithelium, however, is a serious and potentially debilitating problem that is difficult to manage pharmacologically. 

The pathologic transition of nonkeratinized stratified epithelium (either secretory or nonsecretory) into nonsecretory keratinized epithelium is termed squamous metaplasia ^{7 8 9 10} and is a process involving abnormal epithelial differentiation. In the human eye, squamous metaplasia is accompanied by the loss of goblet cells, an increase in cellular stratification, an enlargement of superficial cells, and keratinization. ^{11 12 13} Squamous metaplasia has been described in a variety of ocular surface disorders including SJS, OCP, chemical injury, dry eye, Sjögren syndrome, and vitamin A deficiency ^{9 10 11 12 13 14 15} ; however, despite numerous efforts, little is known about its pathogenesis. 

Our group recently reported that transglutaminase 1 (keratinocyte transglutaminase; TGase 1) gene expression accompanies pathologic keratinization in severe SJS. ¹⁶ In situ hybridization showed that TGase 1 mRNA is not expressed in normal ocular surface epithelia. It is expressed during the terminal differentiation of keratinocytes, where it helps form a cornified cell envelope, ^{17 18} a structure that retards water loss through the epidermis and protects the internal milieu of the body against external mechanical stimuli, chemical injury, and biologic invasion. TGase 1 is an enzyme that catalyzes the formation of covalent cross-links between protein substrates, such as involucrin ¹⁹ and loricrin, ²⁰ and plays an important role in the formation of the stratum corneum in skin. ^{21 22}  

It has also been reported that squamous metaplasia secondary to alterations in the microenvironment is associated with changes in cytokeratin expression in several mucosae. ^{23 24 25} Cytokeratins play an important structural and protective role in maintaining the integrity of the epithelium of the anterior segment of the eye. ^{26 27 28 29} In vivo, cytokeratin filament systems are composed of type 1 (neutral-basic) and type 2 (acidic) obligate heterodimers that exist as specific pairs. ²⁹ Defined subsets of individual cytokeratin pairs are characteristically expressed depending on epithelial cell and tissue type, level of differentiation, or disease state. In the human epidermis, especially in the cornified cell layers, the most highly expressed cytokeratins are keratin 1 and keratin 10. ^{30 31} In skin, it is believed that filaggrin, a protein derived from a precursor present in keratohyalin granules, causes these cytokeratins to aggregate. ³²  

In this study, to further identify the proteins involved with pathologic keratinization in ocular surface diseases, we examined the expression of TGase 1, involucrin, loricrin, filaggrin, and several cytokeratins in 12 pathologic specimens. 

Materials and Methods

Preparation of Human Samples

Several lines of evidence indicate that the conjunctival epithelium invades and resurfaces the cornea in ocular surface diseases (limbal stem cell deficiency) such as SJS, OCP, and alkali injury. ^{33 34} With proper informed consent in accordance with the tenets of the Declaration of Helsinki for research involving human subjects and on approval by the Institutional Review Board of the Kyoto Prefectural University of Medicine, we obtained conjunctivas that covered corneas from 12 patients with SJS, OCP, or alkali injury (four of each) at the time of lamellar keratoplasty to improve vision (Table 1) . All eyes were in the chronic cicatricial phase, and the corneal surfaces were totally covered by conjunctival tissue. Again with proper informed consent, normal human bulbar conjunctiva was obtained during cataract surgery from four age-matched patients with no history of ocular surface disease. Conjunctivas for RNA isolation were frozen in liquid nitrogen immediately after removal and stored with reagent (Trizol; Gibco, Grand Island, NY) at −80°C until use. Conjunctivas for immunohistochemistry were snap frozen in liquid nitrogen, and embedded in optimal temperature cutting compound (Tissue-Tek II; Miles, Elkhart, IN). 

RNA Isolation and Semiquantitative RT-PCR of TGase 1

Total RNA was isolated from the keratinized conjunctivas by the use of reagent (Trizol; Gibco) in accordance with the manufacturer’s protocol. To investigate relative levels of TGase 1 mRNA expression in diseased conjunctiva, semiquantitative reverse transcription–polymerase chain reaction (RT-PCR) was performed. ³⁵ The human G3PDH gene was used as the internal control. Primer sequences used were ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (antisense). cDNA was generated by mixing the extracted RNA after ethanol precipitation (1 μg/μl per sample) with a random hexamer primer (Takara Biomedicals, Tokyo, Japan) and incubating at 65°C for 5 minutes, while chilling the samples on ice. The mixture was then subjected to reverse-transcription in 25 mM MgCl₂, 100 mM Tris-HCl (pH 8.3), 500mM KCl, 40 U/μl RNase inhibitor (Takara Biomedicals), 10 mM dNTP mixture, and 5 U/μl reverse transcriptase (AMV-XL, final volume, 20 μl; Takara Biomedicals). The mixture was incubated at 30°C for 10 minutes and at 42°C for 30 minutes, heated to 99°C for 5 minutes, and then stored at −20°C until use. A 10-μl aliquot (half of the total volume) of the same RT product (per sample) was used for PCR amplification. Oligonucleotide primers to the nontandem repeat regions of TGase1 were designed from published ³⁶ or GenBank sequences CCTTCTGGGCTCGCTGCTGTGG (sense) and CCACGAGAGCCGCCAAGACCAG (antisense). PCR amplifications were performed as previously described, ³⁷ with conditions optimized for the TGase1 gene using the RT product from total conjunctival RNA. The linear range of the amplification reaction for TGase 1 and G3PDH was determined by checking amplification after each cycle from cycles 23 to 30 for TGase 1 and from 21 to 31 for G3PDH. This showed that the 27th cycle was in the midlinear phase for TGase 1 and G3PDH. All PCR amplifications started with denaturation at 95°C for 3 minutes and ended with a final elongation at 72°C for 10 minutes. The parameters for PCR amplification were as follows: 27 cycles of denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute. A 5-μl aliquot of the reaction mixture was then electrophoresed on a 2% agarose gel (Seakem; FMC, Rockland, ME) containing ethidium bromide to evaluate amplification and fragment size. The amount of amplified product was quantified for each sample using a computing densitometer (420OE scanner; PDI, NY) and software (Quantity One; PDI, NY). The final amount of PCR product was expressed as the ratio of the TGase1 gene amplified to that of the G3PDH gene, to account for any differences in beginning amounts of RNA. 

Immunohistochemistry

Most primary antibodies were purchased: involucrin (Novocastra, Newcastle-on-Tyne, UK), loricrin (Berkeley Biologicals, Berkeley, CA), filaggrin (Harbor BioProducts, Stoughton, MA), cytokeratin 1 (YLEM, Roma, Italy), cytokeratin 10 (Biomeda, Foster City, CA), cytokeratin 3 (Progen Biotechnik, Heidelberg, Germany), cytokeratin 4 (ICN Pharmaceuticals, Costa Mesa, CA), and cytokeratin 13 (American Research Products, Kensington, MD). Anti-TGase 1 and anti-cytokeratin 12 antibodies were kindly provided by Takashi Hiiragi (Department of Cell Biology, Kyoto University, Japan) ³⁸ and Michelle A. Kurpakus (Department of Anatomy and Cell Biology, Wayne State University, Detroit, MI), respectively. ³⁹  

For indirect immunohistochemical studies of TGase 1 and other keratinization-related proteins (involucrin, loricrin, filaggrin, and cytokeratins 1 and 10), cryostat sections (7-μm thick) were placed on gelatin-coated slides, air dried, and rehydrated in phosphate-buffered saline (PBS) at room temperature for 15 minutes. We also observed keratins 4 and 13 (nonkeratinized, stratified) and keratins 3 and 12 (cornea-specific). To block nonspecific binding, the tissues were incubated with 1% bovine serum albumin (BSA) at room temperature for 30 minutes. Subsequently, the sections were incubated at room temperature for 1 hour with the primary antibody (Table 2) and then washed three times in PBS containing 0.15% Triton X-100 (PBST) for 15 minutes. For negative controls, the primary antibody was omitted. After they were stained with the primary antibody, the sections were then incubated at room temperature for 1 hour with suitable secondary antibodies: fluorescein isothiocyanate (FITC)–conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA), FITC-conjugated donkey anti-rabbit IgG (Vector, Burlingame, CA), and Cy3-conjugated donkey anti-rat IgG (Jackson ImmunoResearch). After several washings with PBS, the sections were coverslipped using anti-fading mounting medium (90% glycerol diluted in PBS), and the slides were examined by confocal microscopy (Fluoview; Olympus, Tokyo, Japan). For double immunostaining, the same procedure was used, except that the primary antibodies consisted of a mixture of mouse anti-filaggrin and rat anti-TGase 1 monoclonal antibodies. In these experiments, the secondary antibodies were FITC–conjugated donkey anti-mouse IgG and Cy3-conjugated donkey anti-rat IgG. 

Results

Semiquantitative RT-PCR of TGase 1

To compare the expression of TGase 1 mRNA within experimental groups, the linear phase of amplification of each cDNA was found so that gene expression could be semiquantitatively compared. For TGase 1 and the control housekeeping gene (G3PDH), the linear phase of amplification was established at 27 cycles. In normal human conjunctivas, TGase 1 mRNA was detected either slightly or not at all. However, an increase of TGase 1 mRNA expression was observed in diseased conjunctivas (SJS, OCP, and alkali injury; Fig. 1A ). Densitometric comparisons of TGase 1 mRNA with G3PDH mRNA were obtained in each of these groups (Fig. 1B) . The ratios of TGase 1 and G3PDH mRNA in the ocular surface diseases studied were higher than those of normal conjunctiva. These differences were statistically significant (Dunnett test; P < 0.001; asterisks, Fig 1B ). In addition, these results were confirmed by sequence analysis of the bands using a PCR direct-sequencing technique. 

Immunohistochemistry of TGase 1, Involucrin, and Loricrin

In ocular surface disease, pathologic keratinization is accompanied by an increase in epithelial stratification and enlargement of the superficial epithelial cells (Fig. 2B ). ^{7 8 9 10} Moreover, the conjunctivalized ocular surface cells have nuclei, whereas cornified cells are always anuclear in normal human epidermis. Control sections, incubated with the secondary antibody only, exhibited no discernible specific immunoreactivity over the entire region. The immunoreactivity observed in each specimen was compared against these control samples. It revealed the presence of TGase 1 in diseased conjunctival epithelium, predominantly in the cell membrane (Fig. 3B ). This expression was observed in the superficial and intermediate layers; the basal cells were not immunoreactive. In contrast to its expression in keratinized epithelia, TGase 1 was not expressed, or was expressed at very low levels, in normal conjunctival epithelium (Fig. 3A) . 

Immunohistochemistry also documented the presence of involucrin in keratinized conjunctival epithelia (Fig. 3D) . The positive immunoreactivity was intense in the superficial and intermediate layers, and again, the basal cell layers were not discernibly immunostained. Involucrin was expressed only in superficial layers of the normal conjunctival epithelium (Fig. 3C) . However, the intensity of the immunoreactivity varied between samples, with positive immunostaining seen in two of four normal conjunctivas. Loricrin was found on immunohistochemistry in all layers of both diseased and normal conjunctival epithelium (Figs. 4E 4F ), and in these tissues the staining patterns were similar. The immunohistochemical findings are summarized in Table 3 . 

Changes in the Cytokeratin and Filaggrin Expression Patterns

Immunohistochemistry documented the presence of keratins (1 and 10, 4 and 13, and 3) in the diseased conjunctival epithelia examined in this study (Figs. 4 5) . Keratins 1 and 10 were expressed in the superficial and intermediate layers with no discernible immunostaining in the basal cell layers (Figs. 4B 4D) . In contrast, keratins 1 and 10 were not expressed in any layers of the normal conjunctival epithelium (Figs. 4A 4C) . Keratins 4 and 13 were expressed in both keratinized ocular surface epithelia and normal epithelia in all layers (Figs. 5A through 5D) . It has been reported that cornea-specific keratin 3 is expressed in the superficial layers of the normal conjunctival epithelium and in all layers of the corneal epithelium, ⁴⁰ whereas keratin 12 is expressed in all layers of the corneal epithelium but not in any layers of the conjunctival epithelium. ⁴¹ Our results are consistent with this. We found keratin 3 in all layers of the normal corneal epithelia (data not shown), and in superficial epithelial layers both in the diseased and normal conjunctiva (Figs. 5E 5F) . Keratin 12 was expressed similarly in all layers of the normal corneal epithelium, but no keratin 12 immunostaining was found in any diseased tissue examined in these studies (data not shown). The staining patterns of keratins 3 and 12 in the keratinized diseased epithelium were similar to those in normal conjunctival epithelium. Double staining documented the presence of filaggrin in the superficial and intermediate layers of the keratinized epithelium, but not in the basal cell layer, and a granular staining pattern was evident in the cytoplasm (Fig. 3H) . This protein was not expressed in normal conjunctival epithelia (Fig. 3G) . 

Discussion

TGase 1, a membrane-bound isozyme of the TGase family, is an enzyme coded for by a gene sublocalized to chromosome 14q11.2. ⁴² It catalyzes γ-glutamyl lysine cross-links of proteins to form the cornified cell envelope at the periphery of cornified cells. ¹⁷ TGase 1 is present in the epidermis of skin, ^{17 18 43} predominantly in the upper spinous and granular layers beneath the stratum corneum and, along with TGase 3, ⁴⁴ is involved with the physiological keratinization of epidermis. Indeed, experiments in knockout mice have revealed that TGase 1 is essential for the distribution of cell envelope precursor proteins, such as involucrin and loricrin and that the function of TGase 1 cannot be compensated for by TGase 3 or other TGase isozymes. ^{36 45} In this respect, we regard TGase 1 as a representative marker of keratinization. 

Our previous report using in situ hybridization suggested that a link between TGase 1 gene expression and conjunctival epithelial cell keratinization may exist in SJS. ¹⁶ To further investigate this, we undertook a semiquantitative RT-PCR study and found that TGase 1 mRNA expression was indeed upregulated in keratinized conjunctival epithelium compared with normal conjunctival epithelium (Fig. 1) . Immunohistochemical data clearly demonstrated the upregulation of TGase 1 in diseased ocular surface epithelia, whereas the protein is not, or is only slightly, expressed in normal conjunctival epithelium (Figs. 3A 3B) . ^{16 46} In our previous report, TGase 1 mRNA in SJS conjunctival epithelium was invariably located in a band of epithelial cells located either in or above the suprabasal region. ¹⁶ The distribution of TGase 1 protein is similar to that of TGase 1 mRNA, thus reinforcing our opinion that the pathologic keratinization of keratinized conjunctival epithelia is largely due to the upregulated expression of TGase 1. 

The cornified cell envelope is formed during the terminal differentiation of epidermis through cross-linking of specific proteins, such as involucrin ¹⁹ and loricrin. ²⁰ The appearance of this envelope in the upper layers of the epidermis reflects the normal physiological keratinization process. Our immunohistochemistry demonstrated the overexpression of involucrin in diseased ocular surface epithelia (Figs. 3C 3D) . Involucrin in normal conjunctival epithelium, by contrast, was expressed only in the superficial cell layers, with a variable intensity of expression depending on the sample. Several groups have investigated the expression of involucrin in normal human conjunctiva: Banks and Green, ⁴⁷ for example, reported that it is not present in the deepest epithelial cells but appears in the course of outward migration. Others have reported that normal bulbar conjunctiva adjacent to the limbus contains involucrin in only the three superficial cell layers and that the fornix conjunctiva contains no involucrin. ⁴⁸ Moreover, Krenzer and Freddo ⁴⁹ recently reported the general absence of involucrin in human bulbar conjunctiva. Our observation of sporadic involucrin-positive immunostaining has been reported in other mucous epithelia, ^{47 50} where it has been suggested that the sporadic expression is the result of focal inflammatory responses to environmental stresses. ^{49 50} We postulate that sporadic expression of involucrin in normal conjunctiva may also be due to environmental stresses and that upregulation of involucrin in diseased ocular surface epithelia is associated with the pathologic keratinization process. Our data indicate that loricrin is present in normal and keratinized epithelia (Figs. 3E 3F) . Loricrin is the major protein of the cornified cell envelope of terminally differentiated epidermal keratinocytes. It is also expressed in other types of mucosal epithelia, such as oral, esophageal, and vaginal. ⁵¹ In view of this, we postulate that loricrin may be involved in the terminal differentiation of stratified squamous epithelia, including conjunctival epithelium, in addition to being involved with epidermal terminal differentiation. Possible roles in pathologic keratinization are unclear. 

Another finding of this study is change in cytokeratin expression in keratinized conjunctival epithelium compared with normal. Cytokeratins play an important structural and protective role in maintaining the integrity of epithelial cells. ^{26 27 28 29} The cytokeratin family is composed of specific type 1 (neutral-acidic) and type 2 (basic) members. ²⁹ It has been suggested that the presence of specific keratin pairs contribute to the physical characteristics of the epithelium in question. In this study, immunohistochemistry demonstrated that keratins 1 and 10, which are involved in the physiological keratinization process in the upper layers of the epidermis, were strongly expressed in diseased conjunctival epithelium, but not in normal conjunctival epithelium (Fig. 4) . Tseng et al. ¹⁵ have reported that keratins 1 and 10 are expressed in keratinized corneal and conjunctival epithelia in vitamin A–deficient rabbits. Our results are consistent with theirs. We found that keratins 4 and 13, which were observed in nonkeratinized stratified epithelia, was expressed in both normal and keratinized ocular surface epithelia (Figs. 5A through 5D) . Keratins 3 and 12, which are a cornea-specific keratin pair, were not expressed in either normal or keratinized conjunctiva, except that keratin 3 was expressed only in superficial layers of normal and keratinized conjunctiva (Figs. 5E 5F) . Furthermore, the expression of filaggrin, ³² which is thought to aggregate keratin filaments in the lower layers of the stratum corneum, was also upregulated in keratinized conjunctival epithelia (Figs. 3G 3H) . A previous study indicated that filaggrin is not expressed in the normal conjunctival epithelium, ⁴⁹ and our data are consistent with this. They indicate that upregulations of the keratin pair 1 and 10 and filaggrin are characteristics of the pathologic keratinization process in diseased conjunctival epithelium. 

What might cause the unusual expression of TGase 1 and keratinization-related proteins in the ocular surface diseases we examined? Our previous report indicated that the number of proliferating epithelial cells in Stevens–Johnson syndrome conjunctiva, which were immunoreactive with a monoclonal antibody Ki-67, was much greater than normal. ¹⁶ We have not performed experiments regarding apoptosis in the ocular surface disease conjunctiva but suggest that epithelial hyperproliferation may lead to the pathologic keratinization of ocular surface epithelia. Our previous report also demonstrated the presence of TGase 1 mRNA in SJS-affected conjunctival epithelium, and found that the signal was often particularly strong in the suprabasal epithelium near high concentrations of subepithelial inflammatory cells. ¹⁶ Other investigators have speculated that conjunctival inflammation may influence goblet cell loss in ocular surface diseases such as SJS. ¹³ Moreover, Saunders and Jetten ⁵² reported that TGase 1 expression is upregulated by the inflammatory cytokine IFNγ in cultured keratinocytes. Recently, we found that substantial inflammatory cell infiltration and surrounding cytokine expression (IFNγ included) is a feature of the chronic phase of SJS. ⁵³ Based on available information, we speculate that the genes for TGase 1 and other keratinization-related proteins may be expressed because of inflammatory activity, resulting in conjunctival keratinization in severe ocular surface disease. We also suspect that severe tear deficiency may be involved, because the ocular surface, made up of stratified nonkeratinizing cell layers, is covered by tear film, which lubricates, hydrates, and protects the underlying epithelium. Squamous metaplasia has been described in numerous ocular surface disorders, including dry eye disorders, ^{9 10} in which the aqueous layer of the tear film is deficient, as well as in disorders such as SJS and OCP, in which the mucous layer is deficient. ¹² In view of this, we further hypothesize that TGase 1 and keratinization-related protein gene expression may also be due to severe tear deficiency. To test this, we are now observing the expression of TGase 1 and keratinization-related proteins in several dry eye conditions. 

Features shared by the pathologic keratinization of diseased ocular surfaces and the physiological keratinization of the epidermis include the upregulation of TGase 1, involucrin, filaggrin, and the keratin pair 1 and 10. The distribution of these proteins is different, however. In keratinized conjunctiva, TGase 1 and the other proteins are expressed in nearly all cell layers except for the basal cells, whereas in the human epidermis they are expressed predominantly in the spinous and granular layers beneath the stratum corneum. We suggest that the pathologic keratinization process in diseased, keratinized conjunctival epithelia may be based on the upregulation of TGase 1 and different expression patterns of keratinization-related proteins. Increased understanding of the process of pathologic keratinization of the ocular surface will enable us to manage these debilitating diseases more effectively. 

 Supported by Grants-in-Aid for Scientific Research from the Japanese Ministry of Health and Welfare and the Japanese Ministry of Education, a research grant from Kyoto Foundation for the Promotion of Medical Science, and the Intramural Research Fund of Kyoto Prefectural University of Medicine.

 Submitted for publication July 7, 2000; revised October 4, 2000; accepted October 16, 2000.

 Commercial relationships policy: N.

 

Table 1.

 

Patients’ Profile

Patient	Age/Gender	Visual Acuity	Age at Onset (y)	Time Until Operation (y)
;l>SJS1	75/M	ND	51	24
SJS2	31/M	HM	7	24
SJS3	22/F	HM	17	5
SJS4	61/F	ND	31	30
OCP1	80/F	HM	50	30
OCP2	81/F	HM	60	21
OCP3	83/F	HM	—	—
OCP4	77/F	6/200	—	—
Alkali1	50/M	ND	22	28
Alkali2	30/M	HM	24	6
Alkali3	42/M	4/200	32	10
Alkali4	64/M	ND	18	46

 HM, hand motion; ND, numerus digitorum.

Table 2.

 

Primary Antibodies and Source

Antibodies	Category	Dilution
Transglutaminase 1 38	Rat monoclonal	×2
Involucrin	Mouse monoclonal	×100
Loricrin	Rabbit polyclonal	×250
Filaggrin	Mouse monoclonal	×200
Cytokeratin 1	Mouse monoclonal	×20
Cytokeratin 10	Mouse monoclonal	×100
Cytokeratin 3	Mouse monoclonal	×50
Cytokeratin 12 39	Rabbit polyclonal	×200
Cytokeratin 4	Mouse monoclonal	×10
Cytokeratin 13	Mouse monoclonal	×1

Figure 1.

 

Semiquantitative analysis of TGase 1 mRNA expression. (A) Representative RT-PCR experiments. (B) Densitometric analysis. A statistically significant increase of TGase 1 mRNA expression was observed in the diseased ocular surface compared with normal. Ratios of TGase1 to G3PDH mRNA were higher in diseased tissues than in normal conjunctiva (**P < 0.001; Dunnett test). Lane M, molecular weight marker; lane 1, normal conjunctiva; lane 2, Stevens–Johnson syndrome; lane 3, ocular cicatricial pemphigoid; lane 4, alkali injury (n = 4, mean ± SEM).

Figure 2.

 

Conjunctival tissue stained with hematoxylin and eosin. (A) Normal bulbar conjunctiva. (B) Conjunctiva covering cornea in a patient with Stevens–Johnson syndrome (patient SJS2), showing an increase in epithelial stratification and enlargement of superficial cells. Superficial cells have nuclei, unlike cells in the epidermis. Original magnification, ×40.

Figure 3.

 

Representative immunohistochemical analysis of TGase 1 (A, B), involucrin (C, D), loricrin (E, F) and filaggrin (G, H) from normal subjects (A, C, E, G) and patients with ocular surface disease (B, patient SJS2; D, SJS3; F, Alkali3; H, SJS2). TGase 1 was expressed only slightly or not at all in normal conjunctiva (A), whereas TGase 1 was strongly expressed in SJS (B). Its expression was observed in the cell membrane in nearly all cell layers except the basal cell layer. Involucrin was expressed in superficial layers in normal conjunctiva (C) and was upregulated in superficial and intermediate layers in SJS (D). Loricrin was expressed in both normal (E) and ocular surface disease (F), and staining patterns were similar. Double immunohistochemical staining of filaggrin (FITC) and TGase 1 (Cy3) (G, H). These proteins were not expressed in normal conjunctiva (G) but were expressed in SJS (H). A granular staining pattern of filaggrin was observed in the cytoplasm. Arrows and arrowheads: basement membrane zone and apical cell membrane, respectively. Scale bar, 100 μm.

Figure 4.

 

Representative immunohistochemical analysis of cytokeratins 1 and 10 from normal subjects (A, C) and patients with ocular surface disease (B, patient SJS2; D, SJS2). Cytokeratins 1 (A, B) and 10 (C, D) were not expressed in normal conjunctiva (A, C) but were expressed in keratinized conjunctiva (B, D). Arrows and arrowheads: basement membrane zone and apical cell membrane, respectively. Scale bar, 100 μm.

Table 3.

 

Distribution and Intensity of Expression of TGase 1 and Keratinization-Related Proteins

Antibody/Layer	Normal Conjunctiva	Keratinized Conjunctiva
				SJS	OCP	Alkali
TGase 1
Superficial	−	+++	+++	+++
Mid	−	+++	+++	+++
Basal	−	−	−	−
Involucrin
Superficial	+	+++	+++	+++
Mid	−	+++	+++	+++
Basal	−	−	−	−
Loricrin
Superficial	++	++	++	++
Mid	++	++	++	++
Basal	++	++	++	++
Filaggrin
Superficial	−	++	++	++
Mid	−	++	++	++
Basal	−	−	−	−
CK1
Superficial	−	+++	+++	+++
Mid	−	+++	+++	+++
Basal	−	−	−	−
CK10
Superficial	−	+++	+++	+++
Mid	−	+++	+++	+++
Basal	−	−	−	−
CK4
Superficial	+++	+++	+++	+++
Mid	+++	+++	+++	+++
Basal	+++	+++	+++	+++
CK13
Superficial	+++	+++	+++	+++
Mid	+++	+++	+++	+++
Basal	+++	+++	+++	+++
CK3
Superficial	+	+	+	+
Mid	−	−	−	−
Basal	−	−	−	−
CK12
Superficial	−	−	−	−
Mid	−	−	−	−
Basal	−	−	−	−

 −, Nondiscernible stain; +, faint stain; ++, moderate stain;+++ , intense stain; CK, cytokeratin.

Figure 5.

 

Representative immunohistochemical analysis of cytokeratins 4, 13, and 3 from normal subjects (A, C, E, respectively) and patients with ocular surface disease (B, patient OCP2; D, SJS2; F, Alkali1). Cytokeratins 4 (A, B) and 13 (C, D) were expressed in both normal (A, C) and diseased tissue (B, D). Cytokeratin 3 was expressed only in superficial layers in normal (E) and diseased tissue (F). Arrows and arrowheads: basement membrane zone and apical cell membrane, respectively. Scale bar, 100μ m.

The authors thank Andrew J. Quantock, Department of Optometry and Vision Science, Cardiff University, United Kingdom, for critical reading and comments on the manuscript.