Differential Expression of Facilitative Glucose Transporters GLUT1 and GLUT3 in the Lens

Abstract

purpose. To determine the expression patterns for members of the facilitative glucose transporter family (GLUT1–4) in the rat lens.

methods. An initial molecular profiling of GLUT expression in lens fiber cells was achieved using reverse transcription–polymerase chain reaction (RT-PCR). The presence of isoform-specific transcript detected by RT-PCR was then confirmed using northern blot analysis and in situ hybridization. The presence of transporter protein was verified by western blot analysis and immunocytochemistry.

results. Transcripts for GLUT1 and GLUT3, but not for GLUT2 and GLUT4, were detected by RT-PCR of fiber cell mRNA. Transcript for GLUT3, but not for GLUT1, was detected by northern blot analysis of fiber cell total RNA, indicating that GLUT3 was the predominant isoform in the fiber cells. In situ hybridization and immunolocalization in rat lens sections confirmed this result at the transcript and protein levels, respectively. In contrast, GLUT1 was predominantly expressed in the lens epithelium and only to a limited extent in the equatorial fiber cells.

conclusions. GLUT1 and GLUT3 are differentially expressed in the rat lens. The presence of the high-affinity transporter GLUT3 in fiber cells indicates that these cells have the capacity to take up glucose independently from the epithelium.

Glucose is the principal metabolic fuel that the lens uses to support growth and homeostasis. Most of the glucose is processed anaerobically with oxidative phosphorylation limited to the epithelium and differentiating fiber cells. ¹ Its source is the aqueous humor, where glucose levels mirror those in the blood. Glucose uptake into the lens is mediated by facilitated transport, which seeks to achieve equilibrium with the aqueous. Knowledge of the molecular identity of glucose transporters and their localization in the lens is essential, because they constitute a key component of the mechanisms that underpin normal lens homeostasis. 

Facilitative glucose transport is mediated by the GLUT family of proteins, of which there are currently seven known isoforms. ^{2 3} These isoforms exhibit different substrate specificities, uptake kinetics, and tissue expression profiles. GLUT proteins 1, 2, 3, and 4 are believed to be involved in cellular glucose uptake. GLUT1, 3, and 4 are high-affinity glucose transporters, whereas GLUT2 has a significantly lower affinity. Transport of GLUT4 to the plasma membrane is regulated by insulin. GLUT5 is a high-affinity fructose transporter with poor glucose transport capacity. GLUT6 represents a pseudogene and is unlikely to encode a functional transporter. GLUT7 is closely related to GLUT2 but is retained in the endoplasmic reticulum. 

Information available to date on the type of glucose transporters and their spatial distribution in the lens is surprisingly controversial. One study localized GLUT1 in cortical fiber cells ⁴ but another study failed to detect this isoform in the lens alltogether. ⁵ GLUT2, GLUT3, and GLUT4 were also investigated but could not be detected. Yet another series of studies found elevated levels of glucose transporters in the lens nucleus and lesser levels in the cortex. ^{6 7 8} Transport studies also produced differing results. Evidence for facilitated glucose transport at both the anterior and posterior surfaces ⁹ contrasts with evidence from another laboratory that the anterior epithelium is predominantly responsible for the uptake of glucose. ¹⁰  

Our report addressed these uncertainties by screening for those members of the glucose transporter family (GLUT 1, -2, -3, -4) that could possibly contribute to lens homeostasis. Using a comprehensive approach, we identified and localized glucose transporter isoforms at the transcript and protein levels. We found that the rat lens expresses GLUT1 predominantly in the epithelium and GLUT3 in the fiber cells of the lens cortex. The consistency of the data at the transcript and protein levels suggests that a higher degree of reliability has now been achieved and that these data are worthy of consideration in models of lens homeostasis and cataractogenesis. 

Materials and Methods

Preparation of Ocular and Lens Tissues

Eyes were taken from 5-day-old female Wistar rats and either used whole for embedding and sectioning, or lenses were extracted from the eyes in sterile RNase-free (dimethyldicarbonate[DMDC]-treated) phosphate-buffered saline (PBS). Lenses were rolled on sterile filter paper to remove any adherent tissues and decapsulated to remove the epithelial cells from the fiber cells. All animals were treated according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 

Identification of GLUT Isoforms by Reverse Transcription–Polymerase Chain Reaction

Total RNA was isolated from the fiber cell tissue by using reagent according to standard procedures (Trizol; Gibco, Grand Island, NY). Genomic DNA was removed from the total RNA before cDNA synthesis with a 30-minute incubation at 37°C with 0.1 U/μl DNase I (Boehringer–Mannheim, Indianapolis, IN) in a volume of typically 150μ l. Approximately 150 μg of fiber total RNA was obtained from 10 rats. mRNA was purified ( QuickPrep Micro mRNA Purification Kit; Pharmacia Biotechnology, Piscataway, NJ). 

First-strand synthesis and cDNA amplification were performed with fiber mRNA using reagents (Perkin Elmer, Norwalk, CT). cDNA synthesis was performed at 42°C for 15 minutes. The reaction mixture contained 5 mM MgCl₂, 1× polymerase chain reaction (PCR buffer), 1 mM dNTPs (dATP, dTTP, dCTP, and dGTP), 2.5 μM oligo(dT)₁₆ primer, 1 U/μl RNase inhibitor, 2.5 U/μl M-MLV reverse transcriptase, and 1 ng mRNA. A control reaction (no cDNA synthesis) was also conducted with the elimination of reverse transcriptase. 

Synthesized cDNA (10 μl) or control reaction (10 μl) were added to separate PCR mixtures, which contained 1× PCR buffer, 3 mM MgCl₂, 2.5 units DNA polymerase (AmpliTaq Gold, Perkin Elmer, Norwalk CT), and 0.5 μM sense and antisense primers from the GLUT1, GLUT2, GLUT3, or GLUT4 primer sets listed in Table 1 . ^{11 12 13 14} Reactions were also performed with primers specific for connexin(Cx)43 and connexin50 (Table 1 ^{15 16} ) to verify that the mRNA was from fiber cells only and not contaminated with epithelium. ¹⁷  

After a 10-minute pre-PCR incubation at 95°C to activate the DNA polymerase, amplification was performed using a two-step thermal cycling program (Omnigene, Hybaid, Middlesex, UK) with a 1-minute period of denaturation at 94°C, and a 2-minute period for annealing and extension at 60°C for 35 cycles. An extra 10-minute period for extension at 72°C was performed to optimize ligation conditions. Amplified PCR products were analyzed by electrophoresis on 0.8% agarose gels and subsequently cloned and sequenced. 

Determination of Transcript Levels by Northern Blot Analysis

The control tissue (brain; 10 μg) and lens fiber cell total RNA were electrophoresed through a 1%-agarose formaldehyde gel in MOPS buffer, and transferred overnight by capillary action to a nylon membrane (Boehringer–Mannheim). Hybridization was performed for 2 hours at 25°C (according to standard Boehringer–Mannheim procedures) with 0.5 picomoles/ml of digoxigenin (DIG)-labeled antisense probe (Table 2) . Probes specific for individual glucose transporter isoforms were labeled by tailing the 3′ ends using a DIG oligonucleotide tailing kit (Boehringer–Mannheim). The specificity of each probe and optimal hybridization conditions were confirmed by Southern blot analysis with sequenced PCR products. GLUT-specific RNA was detected with anti-DIG antibodies conjugated to alkaline phosphatase (1:20,000; Boehringer–Mannheim) in buffer A for 1 hour, followed by chemiluminescence (CDP-star; Boehringer–Mannheim) and exposure onto film (Hyperfilm ECL; Amersham, Arlington Heights, IL). 

Localization of Transcript by In Situ Hybridization

Whole eyes were fixed in 10% buffered formalin for 20 hours and embedded in paraffin following standard procedures. Axial sections (16μ m) were cut and attached to silane-coated heat-resistant microscope slides (Perkin Elmer, Norwalk, CT). Tissue sections were dewaxed in xylol and washed in 0.02 M HCl for 10 minutes before proteinase K (Boehringer–Mannheim) treatment at 5 μg/ml for 30 minutes at 37°C. Sections were briefly washed in ice-cold 20% acetic acid, followed by rinsing in PBS, and dehydration in ethanol. Genomic DNA was removed by incubating each section overnight with 1U/μl DNase I (Gibco) in a humidified chamber at 37°C. DNase treatment was terminated with a 5-minute wash in DMDC-treated H₂0, followed by dehydration in ethanol. 

After denaturation of sections at 95°C for 5 minutes, hybridization was performed for 3 hours at 25°C. The hybridization solution (30μ l) was applied to each section containing 10% formamide, 2× SSC, 5% dextran sulfate, and 2.5 picomoles GLUT isoform-specific DIG-11-dUTP tailed antisense RNA probe (described earlier). Nonspecific labeling was assessed in separate sections by using the corresponding sense RNA probe in the hybridization mixture. Excess probe was removed with a 10-minute rinse in 2× SSC and 0.1% sodium dodecyl sulfate (SDS) at room temperature, followed by two 10-minute washes at 37°C of 0.1× SSC and 0.1% SDS. Tissue sections were first equilibrated in 0.1 M maleic acid, 0.15 M NaCl (pH 7.5; buffer A) and then incubated for 1 hour in the same buffer containing 1% nonfat milk powder. Sections were rinsed in buffer A and treated with anti-DIG antibodies conjugated to alkaline phosphatase (1:100; Boehringer–Mannheim) in buffer A for 1 hour. Unbound antibodies were removed by two 15 minute washes in buffer A. Tissue sections were equilibrated in 0.1 M Tris-HCl, 0.1 M NaCl, (pH 9.5; buffer B), and a colorimetric reaction using the substrates 5-bromo-4-chloro-3-indolyl phosphate (BCIP) (175μ g/ml) and 4-nitroblue-tetrazolium chloride (NBT) (300μ g/ml) was performed. RNA transcripts were detected as an intense blue staining typically appearing within 30 minutes. The color reaction was terminated with a 10-minute wash in 10 mM Tris-HCl and 1 mM EDTA (pH 8.0). The sections were mounted with 30% glycerol-PBS and viewed by normal bright-field light microscopy. 

Detection of Transporter Protein by Western Blot Analysis

Crude fiber cell membranes were prepared by homogenizing decapsulated rat lenses in 5 mM Tris-HCl, 5 mM EDTA, and 5 mM EGTA (pH8.0) and repeatedly washing the homogenate by centrifugation at 12,000 rpm for 20 minutes in a rotor (model SS34; Sorvall, Newtown, CT). Membrane proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE; 15% acrylamide), and transferred to a nitrocellulose membrane by electrophoresis for 90 minutes at 170 mA. Proteins were visualized with a 4-minute incubation in Ponceau stain to determine the transfer efficiency, and the membrane was left overnight in a blocking solution (1% bovine serum albumin [BSA] in 1× Tris-buffered saline [TBS]) at room temperature. GLUT1 and GLUT3 proteins were detected using commercially available antibodies (Research Diagnostics, Flanders, NJ). The protein blots were incubated for 2 hours with 0.2 μg/ml primary antibody in 1% BSA-TBS, followed by incubations with biotinylated secondary antibody (1:2000; Amersham), and streptavidin-HRP (1:2000; Amersham) for 1 hour each. After each incubation the membrane was washed three times for 15 minutes in 1× TBS. Labeled protein was visualized by chemiluminescence detection (ECL; Amersham) and exposure onto film (Hyperfilm; Amersham). 

Immunocytochemical Localization of Glucose Transporters

Cryosections were cut axially from whole lenses previously fixed for 15 minutes in 2% paraformaldehyde and cryoprotected in 15% glycerol-PBS for 1 hour. Sections were attached to microscope slides (Superfrost Plus; ESCO, Electron Microscopy Sciences, Fort Washington, PA) and labeled with 2 μg/ml primary antibody in PBS, followed by a secondary fluorescein-conjugated antibody (1:120; Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour each. Control sections did not receive primary antibody. After extensive washing in PBS, sections were mounted in 50% glycerol and 10 mM p-phenylenediamine in PBS and viewed with a fluorescence microscope. 

Results

Detection of Glucose Transporter Transcript in Lens Fiber Cells

An initial screening for glucose transporters (GLUT1, -2, -3, and -4) was conducted in the rat lens by RT-PCR using isoform-specific primer sets. This initial screening specifically targeted the fiber cells for the following reasons: First, removal of capsule and epithelium before preparing lens mRNA greatly reduced the likelihood of generating PCR products from contaminating ocular tissues. Second, detection of glucose transporters in fiber cells would constitute an important result in itself, because this would argue against the epithelium’s being the exclusive site of nutrient uptake. The purity of fiber cell mRNA was verified using primer sets specific for two differentially expressed lens connexins ¹⁷ : PCR product was only obtained for the fiber-cell–specific Cx50 but not for Cx43, which is the predominant isoform in the lens epithelial cells. Given the great sensitivity of the procedure, failure to obtain a PCR product for Cx43 indicated that the fiber cell preparation was essentially free of epithelial cells (Fig. 1A ). 

Primer sets for the individual glucose transporter isoforms, and the expected size of PCR products amplified are listed in Table 1 . RT-PCR from fiber cell mRNA failed to amplify GLUT2 and GLUT4 transcripts, yet the same primer sets amplified the correct products from rat liver and heart, respectively. In contrast, PCR products for GLUT1 and GLUT3 of the predicted size were obtained from lens fiber cell mRNA. The products were sequenced and were found to be identical with the corresponding segments of the sequences contained in GenBank (accession number S68135 ¹¹ and U17978 ¹³ ), respectively. PCR with all primer sets included a control without RT, which were negative in all cases, thus excluding the possibility of amplification from genomic DNA (data not shown). Therefore, rat lens fiber cells express transcript for GLUT1 and GLUT3, although at yet unspecified levels. 

Transcript levels for GLUT1 and GLUT3 in fiber cells were assessed by northern blot analysis (Fig. 1B) . Antisense probes were approximately 30 nucleotides long and are listed in Table 2 . In control tissues antisense probes for GLUT1 and GLUT3 produced the expected bands of 2.9 kb and 4 kb, respectively. In lens fiber cells, a strong band was obtained for GLUT3 but not for GLUT1. Therefore, lens fiber cells express significant levels of GLUT3. 

Localization of Glucose Transporter Transcript in the Rat Lens

We were unable to obtain reliable data on the expression of glucose transporters in the epithelial cells by RT-PCR or northern blot analysis. Epithelial cell preparations derived from the material adhering to the lens capsule appeared to be contaminated with fiber cells on the basis that both Cx43 and Cx50 products were obtained in most cases. Furthermore, northern blot analysis required excessive numbers of rats to be killed to obtain sufficient quantities of epithelial cell RNA. As an alternative, we used an in situ hybridization procedure to detect isoform-specific transcript for GLUT1 and GLUT3 throughout the lens. An overview of the staining pattern obtained with the GLUT1 probe is shown in Figure 2A . The bulk of the lens was not stained. Staining in the anterior lens portion was clearly confined to a single cell layer (Fig. 2B) . In the equator, staining not only included the epithelial cells, but also the freshly differentiating fiber cells (Fig. 2C) . The control with the appropriate sense probe showed no staining at all. These results suggest that GLUT1 is predominantly expressed in the lens epithelium and the differentiating fiber cells. In contrast, strong staining was observed for GLUT3 throughout the lens cortex and decreased toward the lens center (Fig. 3A ). The epithelium appeared less strongly stained than the adjoining cortical fiber cells, indicating that GLUT3 was predominantly expressed in the latter (Fig. 3B) . No staining was observed using the matching sense probe. 

Taken together, the in situ hybridization results agree well with the screening of fiber cells by RT-PCR and northern blot analysis. The predominance of GLUT3 transcript throughout the lens cortex is consistent with the significant presence of GLUT3 transcript in the fiber cell RNA. The localization of GLUT1 transcript predominantly in the epithelium is consistent with the inability to detect significant levels of this isoform in fiber cells by northern blot analysis. Therefore, at the transcript level, GLUT1 and GLUT3 are differentially expressed in the lens. 

Localization of Glucose Transporter Protein

Next, we investigated whether the expression of glucose transporters in the lens was also reflected at the protein level. Initially, we focused on the question of whether GLUT3, which had a strong presence of transcript in the fiber cells, could be detected in isolated fiber cell membranes (Fig. 4) . Crude fiber cell membranes were prepared from lenses that had the capsule and adherent epithelium removed. Western blot analysis with GLUT3-specific antibodies showed a band of approximately 45 kDa that is consistent with the published molecular weight for GLUT3, ¹³ confirming GLUT3 expression at the protein level. 

Immunolocalization in axially cut rat lens sections was performed using antibodies specific for GLUT1 or GLUT3. GLUT1 antibody labeling was limited to the epithelial cells (Fig. 5A , 5B ) ¹⁸ . In contrast, GLUT3 antibody labeling was minimal in the epithelium but exhibited a strong punctate pattern throughout the lens cortex. The lens core was not labeled (Fig. 5C) . Controls omitting both primary antibodies did not show labeling above background levels (data not shown). 

In summary, expression profiles for GLUT1 and GLUT3 transcripts and proteins agreed well with each other. Therefore, the differential expression of these two isoforms was supported at both the transcript and protein levels. Expression of both isoforms may have overlapped to a small extent in the differentiating fiber cells in the equator, but GLUT1 was primarily expressed in the lens epithelium, whereas GLUT3 was the predominant transporter in the fiber cells. 

Discussion

In our results, GLUT1 and GLUT3 were differentially expressed in the rat lens. We are confident of the reliability of our results because they were obtained through two independent experimental avenues: one detecting and identifying the transcripts coding for specific glucose transporter isoforms and the other localizing the transporter proteins themselves. Results from both avenues are in excellent agreement. Our data reliably localized GLUT1 mainly in the lens epithelium and GLUT3 in the cortical fiber cells. 

In contrast to our comprehensive approach, previous studies used only one method for detecting glucose transporters. Glucose transporters have been studied in a range of mammalian species, including human and rat, using cytochalasin B binding, and have been localized predominantly to the lens core and at lesser levels to the cortex. ^{6 7 8} In our study, we did not detect any evidence of glucose transporter expression in the lens core. Cytochalasin B also interacts with cytoskeletal components. ¹⁹ Thus, it is conceivable that the cytochalasin B binding observed in the lens core is unrelated to glucose transporters. 

The use of more specific reagents such as isoform-specific antibodies is also controversial. GLUT1, but not GLUT3, has been localized predominantly to the outer cortical fiber cells of the human lens. ⁴ In contrast, another group using the same approach failed to detect GLUT1 in the human lens. ⁵ In the rat lens our immunocytochemistry results showed that GLUT1 was predominantly expressed in the epithelium and GLUT3 was expressed throughout the cortex. Such discrepancies could occur for technical reasons but could also be attributed to species or age differences. Nevertheless, these discrepancies illustrate that immunocytochemistry alone may not be sufficient to confirm unambiguously the presence of glucose transporters in the lens. 

Our finding that glucose transporters were differentially expressed in the lens epithelial and fiber cells concurs with several transport studies. Goodenough et al. ¹⁰ found that glucose is taken up by the lens epithelium, which was where we found GLUT1 to be expressed. A number of studies have shown that in addition to the epithelium, fiber cells also have the capacity to transport glucose. This was concluded from the observation that the capacity of glucose transport is comparable at both faces of the lens. ⁹ In addition, it has been shown that glucose uptake in the lens still occurs after the removal of the capsule and adhering epithelial cell layer and is approximately 55% that of the intact lens. ²⁰ Finally, Zhang and Augusteyn ²¹ reported that enzyme activities involved in the metabolism of glucose decrease toward the center of the lens, which is consistent with a stronger presence of glucose transporters in the cortex than in the lens core. 

Although the presence of glucose transporters in the lens epithelium was predicted earlier, ¹⁰ as far as we are aware ours is the first report of a molecular identification of such a transporter in the epithelial cell layer. GLUT1 is widely expressed in vertebrate tissues where glucose is easily accessible. A similar situation clearly applies to the lens epithelium, which by interfacing with the aqueous humor is exposed to glucose levels that mirror those in the blood. ²² The situation is different for the deeper lying fiber cells. The extracellular space between the fiber cells is narrow and tortuous. There is general agreement that molecules can enter the lens through the extracellular space. ^{10 23 24} Our finding that significant levels of GLUT3 are expressed in cortical fiber cells suggests that a portion of the total glucose taken up by the lens is transported from the narrow space between fiber cells. It is notable that GLUT3 has a lower K _m than GLUT1, thereby enabling the fiber cells to continue to take up glucose effectively, even when supplies are limited. ^{2 3}  

The formation of cortical opacities in the diabetic lens is known to be promoted by the osmotic stress that is caused by the accumulation of sorbitol as a consequence of glucose overload. ²⁵ In the diabetic rat lens, initial events include localized swelling and rupture of fiber cells in the lens cortex. ^{26 27} Our results showed that fiber cells in this zone of tissue damage had the capacity to take up glucose. Fiber cells in this zone expressed GLUT3, a glucose transporter with a low K _m, which is probably already saturated in the normal lens. Therefore, we predict that in the diabetic lens GLUT3 expression would have to be upregulated to account for the elevated levels of sorbitol observed in the diabetic lens. Our knowledge of GLUT isoform expression patterns in the lens means that this hypothesis can be tested. 

 Supported by the Health Research Council of New Zealand, the Lottery Grants Board, and the University of Auckland Research Committee.

 Submitted for publication May 14, 1999; revised July 22, 1999; accepted July 27, 1999.

 Commercial relationships policy: N.

 

Table 1.

 

PCR Primer Sets and Predicted Product Size

Protein	Oligonucleotide	Expected PCR Product Size
GLUT 1 (S6813511)*	Sense (22 b, position 39) GCCTGAGACCAGTTGAAAGCAC Antisense (23 b, position 308) CTGCTTAGGTAAAGTTACAGGAG	292 bp
GLUT 2 (J0314512)	Sense (21 b, position 136) TTGGCTTTCACTGTCTTCACT Antisense (22 b, position 925) CTTCCTTTTCTTTCCTCATCTC	811 bp
GLUT 3 (U1797813)	Sense (20 b, position 643) AACAGAAAGGAGGAAGACCA Antisense (20 b, position 1253) CGCAGCCGAGGGGAAGAACA	630 bp
GLUT 4 (J0452414)	Sense (18 b, position 96) AGTGCCTGAGTCTTCTTT Antisense (19 b, position 563) TGATGTTAGCCCTGAGTAG	486 bp
Connexin 43 (M1931715)	Sense (20 b, position 498) GATGAGGAAGGAAGAGAAGC Antisense (20 b, position 1330) TAAATCTCCAGGTCATCAGG	852 bp
Connexin 50 (M9124316)	Sense (25 b, position 1413) GGAGTGGGGAAGGAGGATGAGAAAG Antisense (25 b, position 1859) GGAGAATGGAGGAGGAAAGCAAAGC	471 bp

*  GenBank accession number.

Table 2.

 

Oligonucleotide Probes for Northern Analysis and In Situ Hybridization

Protein	Oligonucleotide
GLUT 1 (S6813511)*	Antisense (35 b, position 169) TTA CTG CTG AAG ACA CGG ACA CTC CTG CCC TGC TG
	Sense (30 b, position 151) TCC TTC TCA TGG TGT TTG TCT GGC CCT CAG
GLUT 3 (U1797813)	Antisense (32 b, position 799) TTC CAG CCC CTT CTC ATC TCC GTT GTC CTC CA
	Sense (30 b, position 829) GGA GGA CAA CGG AGA TGA GAA GGG GCT GGA

*  GenBank accession number.

Figure 1.

 

Detection of GLUT isoform-specific transcript in rat lens fiber cells. (A) Agarose gel showing RT-PCR products. Lanes 1 and 11: 1-kb ladder. Lanes 2 and 5: RT-PCR products derived from lens fiber mRNA with primers specific for GLUT1 and GLUT3, respectively. Lanes 3 and 6: no detectable PCR products with primers specific for GLUT2 and GLUT4, respectively. Lanes 4 and 7 demonstrate that these primers sets are valid, because the appropriate RT-PCR products were successfully amplified from other tissues. Lane 4: GLUT2 product derived from liver mRNA. Lane 7: GLUT4 product derived from heart mRNA. Lane 8: RT-PCR product for the fiber cell marker Cx50 derived from lens fiber cells. Lane 9: no product was obtained for Cx43, which is an epithelial cell marker. Lane 10 shows a Cx43 RT-PCR product derived from rat heart mRNA, thus validating the Cx43 primer set. (B) Northern blot analysis showing GLUT transcript levels in lens fiber cells, and in brain as control tissue. The positions of 28s and 18s rRNA are indicated. GLUT1 transcript (2.9 kb) was detected in brain total RNA (lane 1) but not in fiber cell RNA, even after prolonged exposure (lane 2). GLUT3 transcript (4 kb) was detected in both brain (lane 3) and fiber (lane 4) total RNA.

Figure 2.

 

(A) Localization of GLUT1 transcript in the rat lens by in situ hybridization. GLUT1 transcripts were detected with antisense probe in the epithelium (E) and in the equatorial fiber cells (boxed area). A control with sense probe in the inset documents complete absence of transcript-specific labeling. The density in the core region is a brown haze (distinct from the blue transcript labeling) that was visible in these paraffin sections before in situ hybridization. (B) Enlarged anterior lens region showing labeling confined to the epithelium (E). (C) Enlargement of the boxed area in (A) showing that the equatorial epithelium (E) and differentiating fiber cells (DF) contain transcript for GLUT1. Scale bars, (A) 80 μm; (B, C) 20 μm.

Figure 3.

 

Localization of GLUT3 transcript in the rat lens by in situ hybridization. (A) GLUT3 transcript was detected throughout the lens cortex but was absent in the core (C). Inset shows sense control documenting absence of transcript-specific labeling (see comment in Fig. 2A ). (B) The anterior epithelium (E) was comparatively less stained, indicating that GLUT3 transcript was reduced or nonexistent. Scale bars, (A) 160 μm; (B) 20 μm.

Figure 4.

 

Detection of GLUT3 protein in isolated rat lens fiber cell membranes by western blot analysis. Lanes 1 and 3: molecular weight markers. Lane 2: a silver-stained SDS-PAGE gel separating 2 μg of rat lens crude fiber cell membrane proteins. Lane 4: a western blot for GLUT3 of the same sample as in lane 2 detecting a 45-kDa protein that is characteristic for this transporter isoform.

Figure 5.

 

Immunolocalization of GLUT1 and GLUT3 protein in the rat lens. (A) GLUT1 protein was strongly expressed in the epithelium (E) and to a minor extent in the differentiating fiber cells (DF) in the lens equator. The stained mass in the upper right of the micrograph is the ciliary body (CB), which has previously been shown to express GLUT1. ¹⁸ (B) Strong labeling was also observed in the anterior portion of the epithelium (E). (C) GLUT3 protein was absent in the epithelium (E) but was strongly expressed in cortical fiber cells (F). Scale bars, (A, B) 80 μm; (C) 20 μm.

The authors thank Reiner Eckert for constructive discussions and Tamir Gonen for help with the protein work.