Decreased Expression of Ribosomal Proteins in Human Age-Related Cataract

Abstract

purpose. To identify lens epithelial genes with altered expression levels in age-related human cataract.

methods. Epithelia from age-related cataracts and from normal lenses were microdissected and RNA was extracted. RNAs were compared for gene expression differences by RT-PCR differential display. Transcripts exhibiting altered levels of gene expression were cloned and identified by sequencing. The expression levels of identified clones were confirmed by semiquantitative RT-PCR with three separately isolated RNA preparations. Specific primers were designed and used to examine the mRNA levels of other genes important in protein synthesis.

results. Numerous transcripts exhibited altered levels of gene expression. One transcript exhibiting a decreased level of expression in cataract compared with normal lenses was identified as encoding ribosomal protein L21. Three additional ribosomal proteins, L15, L13a, and L7a, also exhibited decreased expression in cataract compared with normal human lenses. By contrast, the levels of elongation factor (EF)-1α1 and eucaryotic initiation factor (eIF)-4E remained unchanged.

conclusions. The results provide evidence that human age-related cataract is associated with decreased expression of L21 and other ribosomal proteins. The results suggest that modulation of protein synthesis and/or other functions mediated by ribosomal proteins is associated with age-related cataract.

Identification of genes with expression levels that are altered in age-related cataract relative to normal lenses points to those protective and regulatory processes important in the maintenance of lens transparency. 

To identify genes with expression levels that are altered in the presence of cataract, we compared the gene expression profiles of epithelia isolated from human lenses with age-related cataract and from normal human lenses. The lens epithelium contains the majority of metabolic enzymes present in the lens. ^{1 2 3} It is the first part of the lens exposed to environmental insult. ^{4 5} Metabolic communication between the lens epithelium and the underlying fiber cells has been demonstrated, ⁶ and damage to the lens epithelium and its enzyme systems is associated with cataract formation. ^{7 8 9 10}  

We have provided evidence that the human lens epithelium responds to the presence of age-related cataract through alterations in the levels of specific transcripts. These include decreased expression of protein phosphatase 2a regulatory subunit, ¹¹ increased expression of metallothionein IIa, ¹¹ and increased expression of osteonectin. ¹²  

In the present study, we have used RT-PCR differential display and semiquantitative RT-PCR to provide evidence that the large ribosomal subunit proteins L21, L15, L13a, and L7a exhibit decreased expression in cataract compared with normal human lenses. 

Ribosomal proteins are major constituents of ribosomes that catalyze protein synthesis in the cytoplasm. ¹³ The eukaryotic ribosome is composed of a large (60S) and a small (40S) subunit consisting of three RNAs and 46 proteins and one RNA and 33 proteins, respectively. ¹⁴ The catalytic functions specific to individual ribosomal proteins are largely unknown. ^{14 15} Under normal conditions, ribosomal proteins are synthesized stoichiometrically with rRNA to produce equimolar amounts of RNA and protein. Under altered conditions, including events surrounding cellular growth and proliferation, ¹⁶ the expression levels of ribosomal proteins are altered. For instance, the large ribosomal subunit proteins L3, L7, L8, L10, L23a, L27a, L36a, and L39 exhibit decreased expression during neuronal differentiation of human embryonic carcinoma cells, as do the levels of the small ribosomal subunit proteins. ¹⁷ These alterations appear to be restricted to specific ribosomal proteins, because some ribosomal protein levels are altered, whereas others remain constant. ^{18 19}  

Independent alterations in ribosomal protein synthesis suggest that individual ribosomal proteins have functions beyond the simple structural makeup of the ribosome or protein synthesis. For example, P0 and S3 possess endonuclease activity, suggesting that they may have DNA repair functions, ^{20 21} and L7 can function as a coactivator of nuclear receptors. ²² L7, S20, and S3a have been implicated in apoptosis. ^{23 24 25} Altered ratios of ribosomal subunits are also associated with stage-specific tissue development. ²⁶ Several ribosomal proteins are known to be induced by agents associated with cataract including RPL13a, the synthesis of which is activated by exposure to UV irradiation, and RPL7, the synthesis of which is activated by exposure to UV irradiation, heat shock, or carcinogens. ²⁷  

The present data provide evidence that the levels of specific ribosomal transcripts are decreased in age-related human cataract. Although we cannot distinguish that decreased ribosomal protein expression is a consequence of cataract or a response of the lens to cataract, the results suggest that regulation of protein synthesis and/or other functions mediated by ribosomes are associated with age-related cataract. 

Methods

Isolation of RNA from Human Lenses

RNA was extracted from lens epithelia isolated from normal or cataractous lenses, as previously described. ¹¹ Extracted normal human donor lenses were received on ice within 24 hours after death. Lenses were microscopically examined for any sign of opacity. Those exhibiting signs of opacity were excluded from the present study. For the differential display and semiquantitative RT-PCR procedures, 6 to 8 mm of central epithelia from normal lenses was dissected and contaminating fiber cells removed, under a dissecting microscope. ²⁸ Age-related cataract epithelia (4–6 mm of central epithelia) were obtained within minutes after surgery and contaminating fibers removed identically. ²⁸ After dissection, all epithelia were washed and microscopically examined to eliminate the possibility of blood, lens fibers, or other contaminants. For the spatial analysis studies, whole normal lenses were dissected into central epithelia (4–6 mm), peripheral epithelia (the outermost 2–3 mm), whole fibers (the rest of lens minus the epithelium and capsule), and cortical fibers (2–3 mm, excluding the nuclear fibers). Donors of normal epithelia averaged 60 years of age and were 60% male, whereas of cataract epithelia were from patients who averaged 71 years of age and were 45% male. 

The cataract epithelia in this study represent the normal population undergoing cataract surgery at the Jules Stein Eye Institute (Los Angeles, CA), and were obtained and classified by the same surgeon, according to a modified version of the Lens Opacities Classification Scale (LOCS)-III grading system. The cataracts used in this study were approximately 70% mixed, 20% nuclear, 5% cortical, and 2% posterior subcapsular. With the exception of cataract type, age, and sex no further identifying information was available for individual lenses. Total RNA was prepared from all samples using an extraction kit, as specified by the manufacturer (RNeasy; Qiagen, Valencia, CA) and quantified as previously described. ¹² For RT-PCR differential display, RNA samples were treated with RNase-free DNaseI to remove possible DNA contamination. ²⁹  

RT-PCR Differential Display

Differential display reactions were performed in duplicate to reduce the potential for artifacts. For first-strand cDNA synthesis, duplicate samples of 200 ng of cataractous and normal RNA were subjected to reverse transcription using 0.2 μM of an anchored primer (AP1) of sequence 5′-ACGACTCACTATAGGGCTTTTTTTTTTTTAA-3′, containing the T7 promoter sequence (italic), a T12 anchoring sequence, and two anchoring bases. First-strand synthesis was performed by incubation at 25°C for 10 minutes, 42°C for 60 minutes, and 70°C for 15 minutes, in the presence of 25 μM deoxyribonucleoside triphosphates, 10 mM dithiothreitol (DTT), 20 U RNasin (Promega, Madison, WI), and 40 U reverse transcriptase (Superscript II; Gibco-BRL, Gaithersburg, MD) in a volume of 20 μL reverse transcription buffer (50 mM Tris [pH 8.3], 6 mM MgCl₂, and 10 mM KCl). 

Amplification of Double-Stranded cDNA Fragments

Double-stranded cDNAs were generated by PCR, by using two different primer sets. In both reactions 0.2 μM of the anchored first-strand synthesis primer was used (see prior section). In separate reactions, either 0.2 μM arbitrary annealing primer one (AR1; 5′-ACAATTTCACACAGGACGACTCCAAG-3′) or arbitrary annealing primer 2 (AR2; 5′-ACAATTTCACACAGGAGCTAGCATGG-3′) was used. Both primers contain the M13 reverse sequence (italic). PCR was performed with 1 U Taq polymerase (AmpliTaq; Perkin Elmer, Norwalk, CT) in the presence of 2.5 μCi[α -³³P]-deoxyadenosine triphosphate (1000–3000 Ci/mmol; DuPont NEN, Boston, MA), 1.5 mM MgCl₂, and 100 μM deoxynucleoside triphosphates, in a reaction volume of 20 μL. PCR cycles were as follows: 1 cycle at 95°C for 2 minutes; 4 cycles at 92°C for 15 seconds, 46°C for 30 seconds, and 72°C for 2 minutes; 25 cycles at 92°C for 15 seconds, 60°C for 30 seconds, and 72°C for 2 minutes; and 1 cycle at 72°C for 7 minutes. After amplification,[α -³³P]-labeled cDNA fragments were separated by electrophoresis on 4.5% polyacrylamide, 8-M urea gels and visualized by autoradiography. 

Reamplification of Differentially Displayed Bands

Bands of differing intensity, and two unchanged bands (as a control), between the cataract and the normal samples were excised from the gel, and the resultant gel slices were directly subjected to PCR. cDNAs were bidirectionally amplified with 0.2 μM of each full-length T7 primer (5′-GTAATACGACTCACTATAGGGC-3′) and M13 reverse (−48)-sequencing primers(5′-AGCGGATAACAATTTCACACAGGA-3′). The PCR conditions and cycles used in these procedures were identical with those described for amplification of double-stranded cDNA fragments, except that [α-³³P]-deoxyadenosine triphosphate was omitted from the reaction mixture. Products were separated by electrophoresis on 1.2% agarose gels and visualized by ethidium bromide staining. 

Cloning and Sequence Analysis of Differentially Displayed cDNAs

Reamplified differentially displayed bands were analyzed by electrophoresis on 1.2% agarose gels. The products were cloned into the a cloning vector (TOPO TA; Invitrogen, San Diego, CA), according to the manufacturer’s instructions. Cloned differentially displayed products were sequenced by fluorescent dye terminator cycle sequencing as specified by the manufacturer (PE Applied Biosystems, Warrington, UK), using a sequencing primer (5′-GCTCGGATCCACTAGTAACGG-3′) complementary to the vector’s (TOPO TA) SP6 sequence. Reactions were run and sequences analyzed (Model 373A DNA sequencer; PE Applied Biosystems). Sequences were further analyzed using the BLAST algorithm with GenBank data (provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD, and available at http://www.ncbi.nlm.nih.gov/genbank), and sequence alignments were performed on computer (MegAlign program contained in the Lasergene software package; DNAstar, Madison, WI). 

Semiquantitative RT-PCR

Semiquantitative RT-PCR was performed by modification of established procedures. ^{12 29} RNA from individual samples was examined using the one-step system, according to the manufacturer (Gibco-BRL). Primers were designed to cross intron–exon boundaries. The primer concentration of 200 nM used in these experiments was chosen to ensure that the amount of primers would not be limiting. Control reactions used primers specific for human β-actin and glyceraldehyde-phosphate dehydrogenase (GAPDH). PCR cycling parameters (20–25 cycles) were chosen to ensure linear product formation over the amounts of RNA and other reagents described. The sequences of the gene-specific primers used to amplify the β-actin, GAPDH, L21, gp130, L15, L13a, L7a, eIF4E, and ΕF1α1 transcripts along with their corresponding GenBank accession numbers and annealing temperatures are shown in Table 1 . Products were separated on 1.2% agarose gels and visualized by ethidium bromide staining. Reaction products were sequenced to ensure they represented the authentic transcripts. Where indicated, 1μ Ci of 1000- to 3000-mCi/mmol[α -³³P]-deoxyadenosine triphosphate was added to each RT-PCR reaction, and incorporated radioactivity was monitored by scintillation counting of excised RT-PCR products. 

Results

Differential Display between Cataract and Normal Human Lens Epithelia

Differential display was performed on RNAs isolated from 30 pooled cataracts and 15 pooled normal human lens epithelia, using two different primer sets. Figure 1A is the differential display profile obtained with primer set 1, and Figure 1B is the differential display profile obtained using primer set 2. Three bands (Fig. 1 , bands A, B, and C) were excised from the differential display gel and successfully reamplified. One band exhibited decreased expression between cataractous and normal lenses by differential display (Fig. 1B , band C). This band yielded an approximately 200-bp reamplification product. The two other bands (Fig. 1A , bands A and B) exhibited equal levels between cataract and normal epithelia. These were selected as the control and yielded approximately 200-bp reamplification products. 

Cloning and sequencing of these transcripts revealed that band C was identical with bp +168 through +352 from the start of translation of the reported cDNA sequence for ribosomal protein L21, ³⁰ with the exception of three mismatches (Fig. 2A) . Control bands A and B were identical in sequence with [phone] from the start of translation of the reported cDNA sequence for glycoprotein (gp)130 mRNA ³¹ (Fig. 2B) . It is uncertain whether the mismatches detected for L21 represented actual differences from the reported sequence or PCR incorporation errors. 

Confirmation of Ribosomal Protein L21 and Gp130 Transcript Levels between Cataractous and Normal Lens Epithelia

Decreased expression of ribosomal protein L21 between epithelia isolated from cataractous and normal lenses was confirmed by semiquantitative RT-PCR, using separately isolated cataract and normal RNA samples prepared from an additional 20 cataractous and 8 normal lenses. Gp130 and β-actin transcripts were simultaneously examined as a control. The RT-PCR primers for RPL21 amplification (Table 1) were designed to produce a 504-bp product and were complementary to sense nucleotides +7 through +26 and antisense nucleotides +534 through +511 of the L21 cDNA sequence, from the start of translation. The RT-PCR primers for gp130 amplification (Table 1) were complementary to sense nucleotides +2113 through +2137 and antisense nucleotides +2583 through+ 2559 of the gp130 cDNA sequence from the start of translation. 

Consistent with the differential display results (Fig. 1) , L21 expression was almost entirely restricted to normal lens epithelium (Fig. 3B , compare lanes 3 and 7 with 4 and 8). As a control, gp130 was detected at equal levels between those of cataract and normal epithelia (Fig. 3B , compare lanes 1 and 5 with 2 and 6). As a further control, the levels of β-actin transcript were identical between cataract and normal epithelia (Fig. 3A , compare lanes 1 and 2). 

As a further confirmation, the differences in L21 expression between cataractous and normal lenses were examined by monitoring[α ³³P]-adenosine triphosphate (ATP) incorporation into RT-PCR products using a third set of cataractous and normal RNAs prepared from an additional 25 cataractous and 10 normal lenses. Consistent with the differential display results (Fig. 1) and the previous RT-PCR results (Fig. 3) , L21 expression was significantly decreased between cataractous and normal lenses (Fig. 4A , compare lanes 1 and 3 with lanes 2 and 4). The levels of gp130 or GAPDH control transcripts were the same between cataractous and normal lenses (Figs. 4B 4C) . Based on incorporated radioactivity, it is estimated that L21 levels were decreased three- to fourfold between cataractous and normal human lenses. 

Spatial Expression of Ribosomal Protein L21 mRNA in the Normal Human Lens

In the differential display and semiquantitative RT-PCR procedures, approximately 6- to 8-mm portions of central normal epithelia were compared with approximately 4- to 6-mm portions of central cataractous epithelia. To be certain that decreased expression of L21 in cataract versus normal lenses was not a consequence of spatial differences in L21 expression, four normal lenses were microdissected into whole (7–9 mm), central (4–6 mm), and peripheral epithelium (2–3 mm) portions and examined for L21 expression by RT-PCR (Fig. 5) . L21 expression was also examined in whole lens minus the epithelium and in cortical lens fibers alone (Fig. 5) . 

Approximately equal levels of L21 were detected between whole epithelium, central epithelium, and peripheral epithelium (Fig. 5A , WE, CE, and PE, respectively), indicating that L21 expression differences did not result from spatial expression differences. Slightly more RPL21 was detected in whole-lens epithelia than in central or peripheral lens epithelium (Fig 5 , compare lanes 1 and 2 with lane 3). More L21 transcript was detected in whole lens without epithelium (Fig. 5A , WF) than in cortical fibers alone (Fig. 5A , CF; compare lanes 4 and 5). As a control, equal levels of GAPDH were detected in all samples (Fig. 5B , compare lanes 6–10). 

Expression of Other Ribosomal Proteins in Cataract Versus Normal Human Lenses

To determine whether the levels of other ribosomal proteins in addition to L21 were decreased between cataractous and normal lenses, the levels of three other large ribosomal subunit proteins L15, L13a, and L7a were examined, using RNAs prepared from an additional 15 cataractous and 8 normal human lens epithelia (Fig. 6A) . The levels of the elongation factor ΕF1α1 and the initiation factor eIF4E were also examined (Fig. 6B) . The level of GAPDH was examined as a control (Fig. 6C) . 

All three ribosomal proteins exhibited decreased expression in cataract compared with normal human lenses (Fig. 6A) . RPL15 and RPL13a exhibited the greatest differences in expression (Fig. 6A , compare lanes 1–4 with lanes 5 and 6). By contrast, the levels of EF1α1 and eIF4E transcripts were unaltered between cataractous and normal lenses (Fig. 6B , lanes 1–4). As a control, GAPDH transcript levels were identical between cataractous and normal lenses (Fig. 6C , compare lanes 1 and 3). 

Discussion

In the present study, RT-PCR differential display was used to detect decreased expression of ribosomal protein L21 between age-related cataract and normal human lenses. This result was confirmed by semiquantitative RT-PCR using three separately isolated cataract and normal RNA preparations. Based on incorporation of radioactivity, L21 expression was decreased approximately fourfold between cataractous and normal lens epithelia. 

Decreased L21 expression between cataractous and normal lenses is not a consequence of spatial differences between different parts of the lens epithelium, in that identical levels of L21 were detected by RT-PCR, by using central versus peripheral lens epithelial RNA. 

It is unlikely that differences in L21 expression are a consequence of differences between postmortem times, because all samples were stored on ice during transport, and no differences in the levels of GAPDH orβ B2-crystallin transcripts were detected between lens epithelia stored for 1 hour or 36 hours at 4°C (data not shown). Moreover, the levels of most transcripts detected in the present study by both differential display and RT-PCR, including GAPDH, gp130, EF1α1, and eIF4E, were identical in cataractous and normal lenses. If postmortem times were a factor, it is likely that large differences in the levels of all transcripts would have been detected. 

Every attempt was made to ensure the detection of cataract-specific differences in the present study. However, we cannot rule out the possibility that changes in L21 expression could also be related to differences in age between normal and cataractous lenses (averaging 60 and 71 years, respectively) or differences in medical histories or racial and regional characteristics of individual donors. The human population is diverse, and each individual has a unique life history, making it extremely difficult, if not impossible, to obtain exact controls. We are confident that our results are cataract-specific, because identical levels of gene expression were detected in three separately isolated populations of normal and cataractous lenses, which would be expected to compensate for interindividual variability. However, we cannot eliminate the possibility of these factors having some influence on our results or their interpretation. 

The onset of cataract is gradual, and some of the normal lenses used in the present study are likely to have contained undetected opacities, despite careful microscopic examination performed to reduce this possibility. The presence of cataractous lenses mixed with the normal lenses may have the effect of reducing the magnitude of gene expression differences detected in the present study, but is not likely to change the overall trends in gene expression established by the present data. 

The lenses examined in this study had mostly mixed cataracts, with approximately 20% nuclear cataracts and a smaller percentage of cortical and posterior subcapsular cataracts. Thus, no direct correlation between decreased expression of L21 and cataract type can be made from the present study. In preliminary experiments, no difference in the levels of L21 was detected in individual cataracts. Further studies with large numbers of individual lenses are needed to establish a relationship between L21 expression and specific cataract phenotypes. 

L21 is not the only ribosomal protein exhibiting decreased expression between cataractous and normal human lenses. Decreased expression of L15, L13a, and, to a lesser extent, L7a was also detected. In contrast to the ribosomal proteins, two other proteins involved in protein synthesis, EF1α1 and eIF4E, exhibited identical levels of expression in cataractous and normal lenses. Unchanged levels of EF1α1 and eIF4E is not a surprising result, because previous reports have indicated that translational control ³² and gene amplification ³³ are responsible for altered levels of these proteins, respectively. 

Decreased expression of ribosomal proteins is likely to result in decreased lens protein synthesis. Protein synthesis is dependent on the relative levels of ribosomal proteins, ribosomal RNA, initiation factors, and elongation factors. ¹⁴ Because approximately 98% of total RNA is ribosomal RNA, and measurements performed in the present study were equalized to total RNA, the present data indicate that the ratio of ribosomal RNA to total RNA is decreased in cataractous compared with normal lenses. This is likely to result in decreased translation of lens proteins through decreased availability of ribosomal subunits. 

It is not possible to distinguish whether decreased expression of ribosomal transcripts is a consequence of cataract or a specific response of the lens to the presence of cataract. Further studies are needed to elucidate the mechanisms underlying this phenomenon. Regardless of whether decreased ribosomal transcript expression is a consequence of cataract or a response of the lens to the presence of cataract, the present results suggest that decreased translation of proteins is associated with age-related cataract, and this hypothesis is supported by other studies that have demonstrated decreased protein synthesis in association with lens insult ^{34 35 26} and cataract. ^{36 37 38}  

In addition to having a direct role in protein synthesis, several ribosomal proteins identified in the present study have additional functions. L13 has been proposed to act as a tumor suppressor, ¹⁸ and L7 can function as a coregulator of nuclear receptors. ¹⁰ L7 has also been implicated in apoptotic pathways ^{23 24 25} and is induced by UV light and heat shock. ²⁷ Many of these functions are also associated with cataract, and it is interesting to speculate that they may be related to the decreased expression of ribosomal transcripts identified in the present study. 

Regardless of the function for decreased expression of ribosomal proteins in cataract, the present report supports the hypothesis that age-related cataract is associated with changes in the expression levels of specific genes. The data also suggest that changes in protein synthesis and/or other pathways mediated by ribosomal proteins may play important roles in lens transparency. 

 Supported by Grants EY-13022 (MK) and EY-03897 (JH) from the National Eye Institute.

 Submitted for publication July 3, 2001; revised August 30, 2001; accepted September 19, 2001.

 Commercial relationships policy: N.

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Gene Transcripts

Gene-Specific Primers	Accession Number	Sequence	Annealing Temperature
L21-1	XM_040643	CGCCAAAATGACGAACACAA	55 C
L21-2	XM_040643	GTAGCCCAGAGGTCCTTTATTTTT	55 C
gp130-1	XM_042068	GCCATAGTCGTGCCTGTTTGCTTAG	55 C
gp130-2	XM_042068	GACTTGGACTGACGGAACTTGGTGT	55 C
L15-1	NM_002948	TGTCATCATGCGCTTTCTTCTG	58 C
L15-2	NM_002948	CCCTGTGCTTGTGGACTGGTT	58 C
L13a-1	XM_027885	GTATGCTGCCCCACAAAACCA	58 C
L13a-2	XM_027885	CAACGCATGAGGAATTAACAGTCTT	58 C
L7a-1	XM_035105	ATTTTGGCATTGGACAGGACATC	58 C
L7a-2	XM_035105	GGACCCCCATTTTACGACACAG	58 C
elF4E-1	XM_017925	CCCCCGACTACAGAAGAGGAGAA	55 C
elF4E-2	XM_017925	AACAGCGCCACATACATCATCACT	55 C
EF1α1-1	XM_029230	TTTGCCGCCAGAACACAG	55 C
EF1α1-2	XM_029230	CCAGCAGCAACAATCAGGAC	55 C
GAPDH-1	BC004319	TGTTCCAATATGATTCCACCC	52 C
GAPDH-2	BC004319	CCCACACCCTCTCACTGTA	52 C
β-actin-1	XM_037239	TCATGAAGTGTGACGTTGACATCCGT	60 C
β-actin-2	XM_037239	CCTAGAAGCATTTGCGGTGCACGATG	60 C

Figure 1.

 

Autoradiograms showing RT-PCR differential display profile of cataractous (C) and normal (N) epithelia, using primer sets 1 (A) and 2 (B). Arrows: bands chosen for further analysis. Approximate sizes are indicated in base pairs.

Figure 2.

 

Sequence alignment of ribosomal protein L21 and gp130 with reported sequences. (A) Differential display band C (middle) aligned with the reported sequence for ribosomal protein L21 (bottom). (B) Differential display bands A and B aligned with the reported sequence for gp130. Top sequences indicate the differences between obtained and reported sequences.

Figure 3.

 

Confirmation of ribosomal protein L21 and gp130 mRNA levels between pooled cataractous (C) and normal (N) lens epithelia. Ethidium bromide–stained gel showing the transcript levels detected by RT-PCR, using the indicated amounts of lens RNA. Ethidium bromide–stained gels showing the levels of (A) β-actin control and (B) L21 and gp130 products.

Figure 4.

 

Reconfirmation of ribosomal protein L21 and gp130 transcript levels between cataractous (C) and normal (N) lens epithelia. Ethidium bromide–stained gels showing the relative transcript levels of (A) L21, (B) gp130, and (C) GAPDH, detected by RT-PCR, using indicated amounts of lens epithelia. L21 products were further examined by monitoring radioactive incorporation (in counts per minute). PCR cycles are also indicated.

Figure 5.

 

Spatial expression of ribosomal protein L21 in microdissected lens portions. Ethidium bromide–stained gel showing the levels of (A) L21 and (B) GAPDH control transcript detected by RT-PCR using indicated amounts of RNA from whole epithelium (WE), central epithelium (CE), peripheral epithelium (PE), lens minus the epithelium (WF), and cortical fibers (CF).

Figure 6.

 

Expression of other ribosomal proteins in cataractous (C) and normal (N) lens epithelia. Ethidium bromide–stained gels showing the relative levels of (A) L15, L13a, and L7a; (B) ΕF1α1 and eIF4E; and (C) GAPDH control transcript detected by RT-PCR.

The authors thank Paula Ousley and Rory Dunaway of the Lions Eye Bank of Oregon and Brian Oppermann of the Kantorow Laboratory.