Retinal Capillary Pericyte Proliferation and c-Fos mRNA Induction by Prostaglandin D₂ through the cAMP Response Element

Abstract

purpose. Cycloxygenase inhibitors have been shown to prevent angiogenesis in some circumstances, suggesting that growth of capillary pericytes or endothelial cells may be regulated by prostaglandins (PGs). The present study tests the effects of PGs on the growth of human retinal capillary pericytes.

methods. Cell growth was assayed by formazan formation and 5-bromo-2′-deoxyuridine (BrdU) incorporation. The expression of mRNAs corresponding to c-fos, PG receptors, and VEGF was examined by RT-PCR. Signal transduction was evaluated by immunoblot analysis using phosphospecific antibodies against mitogen-activated protein kinases (MAPKs) and cAMP response element–binding protein (CREB). Synthesis of cAMP was inhibited with the adenyl cyclase inhibitor SQ22536. A reporter gene (luciferase) assay was conducted using the expression vector pSVOAΔ5′ containing the 379-bp c-fos promoter with and without a mutation in cAMP response element (CRE).

results. PGD₂ treatment induced c-fos mRNA, stimulated pericyte growth, and increased expression of VEGF mRNA. PGE₂ and -F_2α had similar effects on c-fos induction and pericyte growth, whereas PGI₂ was ineffective. RT-PCR confirmed that mRNAs corresponding to the receptors for PGD₂, -E₂, -F_2α, and -I₂ were expressed in human retinal pericytes. Stimulation by PGD₂ led to phosphorylation of CREB, but had negligible effect on phosphorylation of p44/42 MAPK. The adenylyl cyclase inhibitor inhibited CREB activation and c-fos induction by PGD₂. In a reporter gene assay, c-fos induction occurred only with wild-type c-fos promoter. Mutation in CRE eliminated the response to PGD₂.

conclusions. PGD₂ promotes the growth of retinal capillary pericytes by signaling through cAMP and CREB. The findings underscore the importance of PGs in the growth of human retinal capillary pericytes and raise the possibility that PGs may play a role in proliferative retinopathies.

Proliferative vitreoretinopathy (PVR) develops in various retinal disorders, including retinal vein occlusion, retinopathy of prematurity, and diabetic retinopathy. PVR is one of the major causes of blindness in industrial countries including the United States, Japan, and European countries. The underlying mechanism of PVR is the formation of new vessels that grow into the vitreous. Although matrix metalloproteinase(s) may initiate angiogenesis by destroying the basement membrane, ¹ the endothelial cell growth factors play the key role in the formation of new vessels by stimulating endothelial cell growth. ² Angiogenesis is also closely associated with chronic inflammation. ³ The inflammatory response induced by the leaks and repeated hemorrhages from new vessels also play an important role in the further development of clinically apparent proliferative tissues. ^{4 5}  

The correlation between inflammation and angiogenesis suggests that inflammatory mediators, such as cytokines and prostaglandins (PGs), may play a role in the development of new vessels. In particular, there is mounting evidence implicating PGs and their synthetases (the cyclooxygenases [COXs]) in this process. For example, E-type PGs enhance angiogenesis in rabbits ⁶ and in chicken embryos. ⁷ Conversely, specific and nonspecific COX inhibitors inhibit cancer xenograft-induced angiogenesis ⁸ and can eventually suppress cancer growth by limiting the blood supply. ^{9 10 11} COX inhibitors also inhibit the angiogenesis produced by oncostatin, a potent cytokine that has been shown to induce COX-2 expression. ¹² Hypoxia, the major cause of retinal neovascularization, also induces COX-2 in endothelial cells. ¹³ Although the exact mechanism(s) is not well understood, PGs and COX appear to regulate new vessel growth by regulating the expression of cytokines and endothelial growth factors. ^{8 14 15} In particular, the induction of COX-2 by hypoxia is crucial for the later expression of the endothelial growth factor, VEGF. ¹⁶  

Retinal capillaries consist of two types of cells: endothelial cells and pericytes. Pericytes express muscle-type actins ¹⁷ and provide appropriate tonus to maintain the functional structure of the capillary. Although pericytes have been shown to synthesize VEGF ¹⁸ and regulate endothelial cell growth, ^{19 20 21} relatively little is known about their response to PGs and other inflammatory mediators that are implicated in angiogenesis. However, several studies have shown that PGs and their synthetases modulate the growth of smooth muscle cells, a closely related cell type. ¹⁷ For example, in atherosclerosis, a condition associated with smooth muscle cell proliferation, both COX-2 expression and PG production are increased. ^{22 23} Moreover, COX-2 is a key factor in the growth of smooth muscle cells induced by both TNF-α and angiotensin II. ²⁴ These findings led us to investigate whether PGs might have important regulatory effects on retinal pericytes, as well. Herein, we report that PGD₂ induced the expression of the early response gene, c-fos, and stimulated the growth of human retinal capillary pericytes through activation of the cAMP response element binding protein (CREB). In addition, our data indicate that PGD₂ increased the expression of VEGF mRNA, a key growth factor in retinal neovascularization. 

Materials and Methods

Chemicals and Materials

Unless otherwise stated, all reagents used in the study were of analytical grade. PGD₂, -E₂, -F_2α, and -I₂, and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO). Dulbecco’s modified minimum essential medium (DMEM), fetal calf serum (FCS), trypsin-EDTA solution (0.05% trypsin and 0.02% EDTA in HEPES-buffered saline solution) and all other cell culture reagents were obtained from Biofluids, Inc. (Rockville, MD). Antibodies against phospho- and non-phospho-p44/42 MAPK (Erk1/2; Thr202/Tyr204) and phospho-p38 MAPK (Thr180/Tyr182) were the products of New England Biolabs, Inc. (Beverly, MA). Antibodies against non-phospho- and phospho-CREB (Ser133) and adenyl cyclase inhibitor 9-(tetrahydro-2-furanyl)-9H-purin-6-amine (SQ22536) were purchased from Calbiochem Corp. (San Diego, CA). Transfection reagent (FuGENE6) and a dual-luciferase reporter assay system were obtained from Roche Diagnostics Corp. (Indianapolis, IN) and Promega Corp. (Madison, WI), respectively. Two human lymphocytic cell lines, Raji and SKW6.4, were obtained from American Type Culture Collection (Manassas, VA). Human umbilical vein endothelial cells (HUVECs) were purchased from Clonetics-BioWhittaker (San Diego, CA). 

Human retinal capillary pericytes (from a 55-year-old white man) were obtained from Clonetics-BioWhittaker. Pericytes were maintained in DMEM supplemented with 10% FCS in the collagen-coated culture plates in a 5% CO₂ atmosphere. The identity of the cells was confirmed by detection of muscle type α-actins. ¹⁷  

Viable Cell Assay

The number of viable cells was measured spectrophotometrically on 96-well plate with a kit (CellTiter 96 Assay; Promega), according to the manufacturer’s instructions. 

Briefly, the suspended human pericytes (100 μL) were plated into 96-well plates (2.5 × 10⁴ cells per well) and cultured in DMEM containing various stimulants. After the cells were cultured at 37°C for 3 days, 15 μL of dye (tetrazolium) solution was added, and the incubation at 37°C was continued for another 4 hours. After the cells were solubilized, the brown color developed by tetrazolium metabolism was measured at 570 nm. To eliminate the background absorbance by cell debris, the cell number, expressed as the absorbance at 570 nm, was adjusted by the absorbance at 650 nm. In each experiment, cells, cultured without and with 10% FCS were included as the negative and positive controls, respectively. The cell viability was expressed as the ratio of number of cell to that of the control cells cultured in serum-free DMEM. 

Quantitation of DNA synthesis

DNA synthesis was assayed by quantitating 5-bromo-2′-deoxyuridine (BrdU) incorporation into newly synthesized DNA in 96-well plate using a cell proliferation ELISA kit (Roche Diagnostics Corp.). The cells (2.5 × 10⁴ cells per well) were cultured in DMEM containing various stimulants at 37°C for 3 days. After labeling with BrdU for 4 hours, BrdU incorporated into DNA was spectrophotometrically quantitated at 370 nm after the reaction with a peroxidase-conjugated mouse monoclonal antibody against BrdU and the following peroxidase reaction with 3,3′,5,5′-tetramethylbenzidine (TMB) as substrate. The background absorbance was adjusted by absorbance at 492 nm. 

RNA Preparation

Human pericyte mRNA was isolated by extraction reagent (QIAshredder; Qiagen,Valencia, CA) and a kit (RNeasy Mini Kit; Qiagen). All experiments were conducted according to the manufacturer’s instructions. All mRNA preparations used in the study were confirmed to contain no genomic DNA and to produce no PCR products without reverse transcription. When PCR using PCR beads (Ready-To-Go beads; 0.2 mL tubes/plate; Amersham Pharmacia Biotech Inc., Piscataway, NJ) produced any visible products, mRNA was treated with the DNase in a kit (DNA-free; Ambion, Austin, TX). 

Reverse Transcription–Polymerase Chain Reaction

RT-PCR was conducted using RT-PCR beads (0.2 mL tubes/plate, Ready-To-Go; Amersham Pharmacia Biotech Inc.) on a PCR system (GeneAmp 9700; PE-Applied Biosystems, Foster City, CA). The primers and predicted molecular weights are summarized in Table 1 . 

Approximately 100 ng of mRNA was reverse transcribed and amplified in a total volume of 50 μL with RT-PCR beads that contained 2.0 units of Taq DNA polymerase, 10 mM Tris-HCl (pH 9.0), 60 mM KCl, 1.5 mM MgCl₂, 200 μM of each dNTP, reverse transcriptase, porcine RNase inhibitor, and RNase- and DNase-free BSA. The condition for reverse transcription was 42°C for 30 minutes, and the amplification was performed in 32 cycles of denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and elongation at 72°C for 30 seconds. The products were visualized by ethidium bromide after electrophoresis on 1% agarose gel. 

Signal Transduction Assay

The cells were cultured in six-well culture plates (Costar Corp., Cambridge, MA) with regular DMEM containing 10% FCS. When the cells reached confluence, the medium was replaced with FCS-free DMEM. Culturing was continued for 12 hours and the cells were stimulated by incubating at 37°C for 10 minutes in DMEM containing appropriate stimulants. The cells were washed with ice-cold PBS and quickly frozen by placing the culture plate on dry ice. After the cells were solubilized with 1% SDS, the cell-signaling pathway was examined by detecting the phosphorylation of p44/42 MAPK, p38 MAPK, and CREB on Western blot analysis. 

SDS-PAGE and Immunoblot Analysis

SDS-PAGE was performed on a 12% acrylamide gel using a minigel system (XCell II electrophoresis apparatus; Novex, San Diego, CA). After electrophoresis, the proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories, Hercules, CA) in Tris-glycine buffer (pH 8.3) containing 20% (vol/vol) methanol at 25 mV for 90 minutes with a blot transfer system (XCell II Blot Module; Novex). Nonspecific binding of the membrane was blocked with 5% nonfat dry milk (Bio-Rad Laboratories, Hercules, CA). The membrane was incubated in phosphate-buffered saline (PBS) containing 0.1% Tween-20, 5% BSA and primary antibody (rabbit IgG, 1:1000 dilution) at 25°C overnight and then in PBS containing 0.1% Tween-20, 5% nonfat dry milk, and secondary antibody (anti-goat IgG coupled with horseradish peroxidase, 1:1000 dilution) at 25°C for 3 hours. The immunostaining was detected by peroxidase reaction using a chemiluminescence detection system (Phototope-AP Western blot detection system; Cell Signaling Technology, Beverly, MA). 

Reporter Gene Assay for Induction of c-Fos mRNA

Plasmids that carry the c-fos promoter coupled with the reporter gene luciferase and the same gene with mutation in the CRE were kindly provided by Bruce Cochran of Tufts University (Medford, MA) and Jianzheng Zhou of the National Eye Institute (Bethesda, MD). The wild-type c-fos promoter plasmid contains 379 bp of the c-fos regulatory region immediately 5′ to the transcriptional start point, cloned upstream of the luciferase gene of the expression vector pSVOAΔ5′. In the mutant c-fos promoter plasmid, three nucleotides GTA (62-60) in the CRE region are mutated to TGG, as previously described. ²⁵  

The transfection into human retinal capillary pericytes was conducted in FCS-free DMEM for 8 hours, with transfection reagent (FuGENE6; Roche Diagnostic Corp.). After transfection, the cells were further incubated in serum-free DMEM for 24 hours and then in DMEM containing 1 μg/mL PGD₂ for another 24 hours. After the incubation, the cells were washed with PBS, quickly frozen by placing on dry ice, and stored at −20°C for luciferase assay. Luciferase activity was assayed with a dual-luciferase reporter assay system (Promega Corp., Madison, WI). 

Results

Stimulation of Pericyte Growth by PGs

To test whether PGs are able to stimulate pericyte growth, human retinal pericytes were cultured in serum-free medium containing two different concentrations (0.1 and 1 μg/mL) of PGD₂, -E₂, and -F_2α or in medium containing 10% FCS as a positive control. All three PGs significantly increased the number of cells in a dose-dependent manner (Fig. 1) . Among these three PGs, PGD₂ was consistently the most effective, and the increase in cells with 1 μg/mL PGD₂ was approximately 60% as much as with 10% FCS. The increase in cells was statistically significant, even at 0.1 μg/mL. We also examined the effect of another PG, PGI₂, a well-known muscle dilatator (Fig. 2) . Unlike the other three PGs, PGI₂ caused a slight, but not statistically significant, decrease in the number of pericytes. 

To confirm that the increase in cells by PGD₂ is due to increased cell growth rather than cell survival, DNA synthesis was also examined with a BrdU incorporation assay. When the cells were stimulated with 1 μg/mL PGD₂, DNA synthesis significantly increased (Fig. 3) , confirming that the increase of cell number by PGD₂ is due to increased proliferation of pericytes. 

Expression of PG Receptors

Because the these results indicated that retinal pericytes responded to exogenous PGD₂ and two other PGs, PGE₂ and -F_2α, we next tested whether they express the necessary PG receptors (Fig. 4) . RT-PCR detected mRNAs corresponding to the receptors for PGD₂ (DP), -E₂ (EP₁ and EP₂), -F₂ (FP), and -I₂ (IP), in human retinal capillary pericytes. The expression pattern of these receptors appeared to be cell-type specific. For example, DP and FP were not detected by RT-PCR in two lymphocytic cell lines, Raji and SKW6.4, although both were clearly present in human pericytes. In addition, the seven-transmembrane receptor CRTH2, which has been reported to mediate PGD₂-dependent cell migration of eosinophils and basophils, ²⁶ was not detected by RT-PCR in human pericytes (data not shown). 

Induction of the c-Fos Gene by PGD₂

To explore the mechanism by which PGs stimulate pericyte growth, we next examined the expression of the early-response gene, c-fos, by RT-PCR (Fig. 5) . c-Fos mRNA was barely detected in human retinal capillary pericytes cultured for 12 hours in unsupplemented DMEM. However, when the cells were stimulated by 1 μg/mL PGD₂, the expression of c-fos mRNA quickly increased, reaching a maximum at 1 hour after stimulation and then gradually decreasing (Fig. 5A) . Both PGE₂ and -F_2α also strongly induced c-fos mRNAs (Fig. 5B) , but PGD₂, which had the greatest effect on cell growth, also showed the strongest stimulation of c-fos mRNA. These findings suggest that stimulation of pericyte growth by PGs may be partly due to their ability to induce expression of the immediate early gene, c-fos. 

Effects of PGD₂ on Activation of p44/42 MAPK (Erk1/2) and p38 MAPK

To explore the mechanism by which PGs induce c-fos mRNA and stimulate cell growth, we next examined the effect of PGD₂ on the phosphorylation state of the MAPKs, signaling enzymes involved in growth regulation in many cell types. Although PGD₂ strongly stimulated pericyte growth, we did not detect significant levels of the phosphorylated, active forms of p44/42 MAPK (Erk1/2) or p38 MAPK in cells treated with 1 μg/mL PGD₂ (Fig. 6) . In contrast, when human retinal capillary pericytes were stimulated by 10% FCS, the activation of both p44/42 and p38 MAPKs was clearly detected. Occasionally, slight positive staining with antibody against phospho-p44/42 MAPK was observed after stimulation by PGD₂. However, in view of the strong effect of PGD₂ on cell growth, it seemed unlikely that the MAPK pathway was the major signaling pathway used by this PG. 

Activation of CREB by PGD₂

An alternative mechanism for induction of c-fos mRNA is activation of CREB. To test whether PGD₂ signaling might be mediated by CREB, we examined the relative concentration of the phosphorylated, active protein in the presence and absence of PGD₂ (Fig. 7) . Phosphorylation of CREB was not detected in cells cultured in serum-free DMEM for 12 hours. However, when the cells were stimulated with 1 μg/mL PGD₂, CREB was quickly activated. Phosphorylated CREB was detected within 5 minutes (Fig. 7A) . Positive staining for phosphorylated CREB was continuously detectable for at least 1 hour and gradually decreased at later times. By 2 hours after the stimulation by PGD₂, the phosphorylated CREB was almost undetectable. When the adenylyl cyclase inhibitor SQ22536 was added to the medium, the activation of CREB by PGD₂ was significantly reduced (Fig. 7B) . 

Reduction of PGD₂-Induced c-Fos mRNA by Inhibition of Adenyl Cyclase

To confirm the involvement of the cAMP signaling pathway in PGD₂-induced cell growth, we also investigated the effects of the adenylyl cyclase inhibitor SQ22536 on c-fos expression and cell growth induced by PGD₂. When pericytes were stimulated by 1 μg/mL PGD₂, the induction of c-fos mRNA was clearly detected. This c-fos induction by PGD₂ was significantly reduced when SQ22536 was added to the medium (Fig. 8A) . At a 1-mM concentration, SQ22536 almost completely eliminated the induction of c-fos by PGD₂. SQ22536 also reduced FCS-dependent induction of c-fos mRNA (Fig. 8B) , but this effect was minor when compared with the inhibition of PGD₂-dependent induction. 

Reduction of PGD₂-Induced Cell Growth by Inhibition of Adenyl Cyclase

In the absence of the adenylyl cyclase inhibitor SQ22536, the addition of 1 μg/mL PGD₂ to the medium increased the number of human retinal pericytes by approximately 44%, compared with that cultured in serum-free and PGD₂-free medium for 3 days. When SQ22536 was added, PGD₂-induced cell growth was significantly reduced (Fig. 9) . With 0.1- and 1-mM concentrations of SQ22536, the increase in cells by PGD₂ was only 20% and 16%, respectively. At both concentrations, the inhibition of PGD₂-induced cell growth by SQ22536 was statistically significant. 

Elimination of PGD₂-Induced c-Fos Expression by Mutation in the CRE of the c-Fos Promoter

As an additional test of CREB involvement the induction of c-fos mRNA by PGD₂, the c-fos promoter gene, coupled with the luciferase reporter gene, was transfected into human retinal pericytes and c-fos mRNA induction by PGD₂ was examined (Fig. 10) . No significant luciferase activity was detected in unstimulated cells transfected with the either the wild-type c-fos promoter or the promoter containing a mutation in the CRE. However, when stimulated with 1 μg/mL PGD₂, the cells carrying the wild-type c-fos promoter gene displayed significant luciferase activity, whereas those carrying the mutation in CRE did not (Fig. 10) . Thus, an intact CRE site is required for the induction of c-fos by PGD₂. 

Induction of VEGF mRNA by PGD₂ in Human Retinal Pericytes

Because VEGF is a key growth factor for retinal neovascularization, we also investigated whether stimulation of pericyte proliferation by PGD₂ affects the expression levels of VEGF mRNA (Fig. 11) . VEGF mRNA was barely detectable in resting pericytes. However, when human pericytes were stimulated with 1 μg/mL PGD₂, the relative concentration of VEGF mRNA steadily increased over a 7-hour period. In the presence of 1 mM SQ22536, this PGD₂ induction of VEGF mRNA was almost completely blocked (Fig. 12) . This indicates that PGD₂ is a potent inducer of VEGF mRNA in retinal pericytes, and the cAMP pathway is also the major signaling pathway for the induction of VEGF mRNA. 

Discussion

PGD₂ is formed by isomerization of PGH₂, the primary product of arachidonic acid metabolism by cyclooxygenases. PGD is further metabolized to 9α,11β-PGF_2α and/or the J series of prostanoids such as Δ ¹² -PGJ₂ or 15-deoxy-Δ ^{12 14} -PGJ₂ and displays a variety of physiological and pathologic functions, such as sleep induction, regulation of body temperature, hormone release, and nociception (see the recent review by Urade and Hayaishi ²⁷ ). PGD₂ is especially important as the major mediator in allergic asthma. ²⁸ It also has been reported that PGD₂ induces the early response genes zif-268 and tis-1 mRNAs in retinal pigment epithelial cells. ²⁹ The present study also demonstrates that PGD₂ is essential as a stimulator of pericyte growth. Stimulation of PDG₂ induces rapid expression of c-fos mRNA and enhances the growth of retinal capillary pericytes. Although both PGE₂ and PGF_2α have displayed similar effects on pericyte growth, PGD₂ is more effective than those PGs in inducing the early response gene c-fos and in stimulating pericyte growth. PGI₂, however, which is also formed from PGH₂, neither induced c-fos mRNA nor stimulated growth of human retinal pericytes. PGI₂ is structurally and functionally distinct from PGD₂, -E₂, and -F_2α, and often opposes the action of these three PGs. For example, PGI₂ is a vessel dilatator and inhibits the growth of smooth muscle cells, whereas PGE₂ and -F_2α cause vessel contraction and stimulate the growth of smooth muscle cells. 

Although PGD₂ and FCS both induce the expression of the early response gene c-fos and enhance the growth of capillary pericytes, the signaling pathways used appear to be distinct. It has been well established that p44/42 MAPK (ERK1/2) pathway is the major signaling pathway of cell growth and/or differentiation by various growth factors and lymphokines. ^{30 31} Indeed, this study confirms that treating retinal pericytes with FCS activates p44/42 MAPK and, to a lesser extent, p38 MAPK. In contrast, the activation of p44/42 or p38 MAPK was barely detectable after stimulation by PGD₂, indicating that the MAPK pathway is unlikely to be the major signaling pathway in PGD₂-induced pericyte growth. 

Our data indicate that the major signaling by PGD₂ in retinal pericytes goes through the cAMP pathway, which eventually activates the transcriptional regulator, CREB. PGs are known to bind to specific cell surface receptors, activating a G-protein cascade that leads to activation of adenylyl cyclase, increased levels of cAMP, and activation of protein kinase A (PKA). ³² PKA, in turn, activates the transcription factor CREB, ^{33 34} which has been implicated in c-fos induction in many cell types. ^{35 36} The present study demonstrates that CREB is quickly activated when retinal pericytes are treated with PGD₂, and the phosphorylated CREB is detectable within 5 to 10 minutes. The adenylyl cyclase inhibitor SQ22536 significantly reduced PGD₂-dependent CREB phosphorylation and inhibited PGD₂-induced c-fos mRNA expression and cell growth. Moreover, in a reporter gene study, PGD₂ stimulated transcription of the wild-type c-fos promoter, but had no effect on transcription of the c-fos promoter with a mutation in the CRE site. Together, these findings support the view that the activation of CREB through the cAMP pathway is an essential early event in PGD₂-mediated c-fos induction and pericyte growth. 

Although PGs are well-established inflammatory mediators, several observations suggest that PGD₂ also have important physiological roles in the eye. PGD₂ is widely detected in most eye tissues, including retina. ³⁷ Although retinal pigment epithelium is the major site of PGD synthetase expression in rat retina, PGD synthetase activity is found at high levels in extracellular locations, such as interphotoreceptor matrix and vitreous and aqueous humors. ^{38 39} The finding that DP receptor mRNA is expressed in epithelial cells of iris and ciliary body and in photoreceptor cells has led to the speculation that PGD₂ is important in regulation of intraocular pressure and in the vision process. ⁴⁰ Considering the high levels of PGD₂ in retina, the finding that PGD₂ affects pericyte growth raises the possibility that it may be also important in maintaining the normal function of retinal capillaries. 

Finally, in this study, PGD₂ treatment of retinal pericytes enhanced the expression of VEGF mRNA, a key growth factor in retinal neovascularization. ² Recently, angiotensin II (Ang II), a factor known to activate CREB in rat smooth muscle cells, ⁴¹ has been shown to induce VEGF expression in bovine retinal pericytes. ¹⁸ Ang II-dependent VEGF induction can be eliminated by c-fos antisense, ¹⁸ demonstrating that elevation of c-fos mRNA is necessary for VEGF induction. Indeed, many VEGF induction pathways lead to activation of the AP-1 transcription factor, of which c-Fos is a component. ⁴² Together, these findings further support the view that CREB-dependent induction of c-fos mRNA is an important step in the induction of VEGF expression in retinal pericytes. Moreover, the finding that PGD₂ activates this CREB-dependent pathway in pericytes may provide a partial explanation for the known link between angiogenesis and chronic inflammation. ³  

 Submitted for publication August 6, 2001; revised February 25, 2002; accepted March 26, 2002.

 Commercial relationships policy: N.

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Primers and Predicted Product Sizes

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

Foreward primer: GTCAGTGGTGGACCTGACCT

Reverse primer: AGGGGTCTACATGGCAACTG

Predicted product size: 420 bp

c-Fos

Forward primer: AGAATCCGAAGGGAAAGGAA

Reverse primer: CTTCTCCTTCAGCAGGTTGG

Predicted product size: 150 bp

DP receptor

Forward primer: CTCTGCCCGTAATTTATCGC

Reverse primer: CACCGGCTCCTGTACCTAAG

Predicted product size: 214 bp

EP1 receptor

Forward primer: GTGTACATCCTACTGCGCCA

Reverse primer: GGCTTTTTATTCCCAAAGGC

Predicted product size: 247 bp

EP2 receptor

Forward primer: TGCTTCTCATTGTCTCGGTG

Reverse primer: GTGAAAGGCAAGGAGCAGAC

Predicted product size: 229 bp

FP receptor

Forward primer: TTTGCCAATGGGAGGTAGAC

Reverse primer: GGCAAAATAGGCCAGATCAA

Predicted product size: 263 bp

IP receptor

Forward primer: CTTCCAGCGACTCAAGCTCT

Reverse primer: GAAATGTCAGCAGAGGGAGC

Predicted product size: 271 bp

Vascular endothelial growth factor (VEGF)

Forward primer: CTACCTCCACCATGCCAAGT

Reverse primer: ATGTTGGACTCCTCAGTGGG

Predicted product size: 258 bp

Figure 1.

 

The effects of (A) PGD₂, (B) PDE₂, and (C) PGF_2α on the growth of human retinal capillary pericytes. Human pericytes were cultured in 96-well plates for 3 days in DMEM containing no growth factors (FCS[−]) or in media containing 10% FCS or 1 or 0.1 μg/mL PGD₂. The number of vital cells in each well was determined by the formation of formazan products. The data are expressed as the mean ratio of absorbance ± SEM at 570 nm against that of the control cells cultured without any growth factors (n = 6).

Figure 2.

 

The effects of PGI₂ on the growth of human retinal capillary pericytes. Human pericytes were cultured in 96-well plates for 3 days in DMEM containing no growth factors (FCS[−]) or DMEM containing 10% FCS or 1 μg/mL PGI₂. The number of vital cells in each well was determined by the formation of formazan products. The data are expressed as the mean ratio of absorbance ± SEM at 570 nm against that of the control cells cultured without any growth factors (n = 6).

Figure 3.

 

The effects of PGD₂ on DNA synthesis. Human pericytes were cultured in 96-well plates for 3 days in serum-free DMEM (FCS[−]) or DMEM containing 10% FCS or 1 μg/mL PGD₂. After labeling with BrdU for 4 hours, BrdU incorporated into newly formed DNAs was assayed spectrophotometrically at 370 nm. The data are expressed as the mean ratio of absorbance ± SEM at 370 nm (adjusted by absorbance at 490 nm) against that of the control cells cultured in serum-free medium (n = 6).

Figure 4.

 

Expression of PG receptor mRNAs (RT-PCR) in human retinal capillary pericytes and two human leukemia cell lines, Raji and SKW6.4.

Figure 5.

 

Expression of c-fos mRNA induced by FCS and various PGs (RT-PCR). (A) Time course of c-fos expression in human retinal pericytes after the stimulation by incubating in DMEM containing 1 μg/mL PGD₂ at 37°C. (B) c-Fos expression induced by stimulation with 10% FCS or 1 μg/mL PGD₂, -E₂, -F₂, or -I₂ at 37°C for 1 hour. Cont., no stimulant.

Figure 6.

 

Activation of p44/42 MAPK (Erk1/2) and p38 MAPK by FCS and PGD₂. Human retinal capillary pericytes maintained in serum-free DMEM for 12 hours were stimulated by replacing the medium with DMEM containing no stimulant (Cont.), 10% FCS or 1 μg/mL PGD₂ for 10 minutes Activation of p44/42 MAPK and p38 MAPK was detected by Western blot analysis with antibodies against non-phospho- or phospho-p44/42 MAPK and -p38 MAPK.

Figure 7.

 

Activation of CREB by PGD₂. (A) Time course of CREB activation in human retinal capillary pericytes stimulated by 1 μg/mL PGD₂ for 2 hours. (B) Inhibition of CREB activation by SQ22536. Human pericytes were stimulated by incubation for 10 minutes in serum-free DMEM (Cont.), DMEM containing 1 μg/mL PGD₂, or medium containing 1 μg/mL PGD₂ and 0.1 mM SQ22536. The activation of CREB was detected by Western blot analysis with antibodies against phospho- and non-phospho-CREB.

Figure 8.

 

Inhibition of PDG₂-induced c-fos mRNA expression by adenylyl cyclase inhibitor SQ22536 (RT-PCR). (A) c-Fos mRNA expression induced by PGD₂. Human pericytes maintained in FCS-free DMEM for 12 hours were stimulated by incubating at 37°C for 1 hour in serum free-DMEM (Control), the medium containing 1 μg/mL PGD₂, the medium containing both 1 μg/mL PGD₂ and 0.1 mM SQ22536, or the medium containing 1 μg/mL PGD₂ and 1 mM SQ222536. (B) c-Fos expression by FCS. The same cells were incubated at 37°C for 1 hour in serum-free medium, medium containing 10% FCS, the medium containing 10% FCS and 0.1 mM SQ22536, or the medium containing 10% FCS and 1 mM SQ22536.

Figure 9.

 

Inhibition of PGD₂-induced cell growth by adenylyl cyclase inhibitor SQ22536. Human retinal pericytes were plated into 96-well plates (2.5 × 10⁴ cells per well) and cultured at 37°C for 3 days in 100 μL DMEM containing no growth factor (control), 1 μg/mL PGD₂, 1 μg/mL PGD₂, and 0.1 mM SQ22536, or 1 μg/mL PGD₂ and 1 mM SQ22536. The data are the relative mean number of cells ± SEM, assayed by formazan metabolite formation, against the number of nonstimulated control cells (n = 8).

Figure 10.

 

Reporter gene assay of c-fos expression by PGD₂. Human pericytes were transfected with the expression vector pSVOAΔ5′ in which the c-fos promoter gene was inserted upstream of the luciferase gene. One of the plasmids contained the wild-type c-fos promoter (wild-type CRE), and the other contained the mutant CRE. After transfection, the cells were incubated in the presence or absence of 1 μg/mL PGD₂ for 24 hours, and mean luciferase activity ± SEM was assayed using a dual-luciferase reporter assay (n = 8).

Figure 11.

 

Induction of VEGF mRNA by PGD₂. Human pericytes maintained in serum-free medium for 12 hours were stimulated by replacing the medium with DMEM containing 1 μg/mL PGD₂. The VEGF mRNA was detected by RT-PCR. Data represent the ratio of the density of VEGF against that of GAPDH.

Figure 12.

 

Inhibition of PGD₂-induced VEGF mRNA by the adenylyl cyclase inhibitor SQ22536 (RT-PCR). Human pericytes maintained in serum-free medium for 12 hours were stimulated for 5 hours by replacing the medium with DMEM containing 1 μg/mL PGD₂ in the presence or absence of 1 mM SQ22536.