Human Optic Nerve Head Astrocytes as a Target for Endothelin-1

Abstract

purpose. To determine whether human optic nerve head astrocytes (hONAs) are target cells for the actions of endothelin (ET)-1, a potent vasoactive peptide, by causing astrocyte proliferation, as occurs in glaucomatous optic nerve heads. ET-1 levels are elevated in glaucomatous eyes, and administration of ET-1 to the retina causes glial activation and optic nerve damage in animal models in a manner similar to that observed in glaucoma.

methods. Well-characterized hONAs were used in this study. Cell proliferation of hONAs was assessed, after ET-1 treatment under serum-free culture conditions, with both a formazan assay and [³H]thymidine uptake. ET receptor involvement for cell proliferation was determined with BQ788 (an ET_B antagonist), BQ610 (an ET_A antagonist), PD142893 (an ET_A/B mixed antagonist), and sarafotoxin 6C (S6C; an ET_B agonist). ET-1–induced intracellular calcium ([Ca²⁺]_i) in hONAs was measured by fura-2 imaging. RT-PCR was used to determine whether hONAs express mRNA for preproET-1, ET_A, and ET_B receptors.

results. ET-1 (10 and 100 nM) caused a time-dependent proliferation of hONAs, which was completely blocked by PD142893, as detected by two different cell proliferation assays. The effects of ET-1 were blocked by BQ788 and were also mimicked by S6C, indicative of the involvement of ET_B receptor activation. ET-1–induced elevation in [Ca²⁺]_i, and cell proliferation were both blocked completely by the ET_A antagonist BQ610, suggesting ET_A receptor involvement. The hONAs expressed mRNA for ET_A and ET_B receptors as well as preproET-1, suggesting that these cells may also be a source for ET-1 in the optic nerve head.

conclusions. ET-1 induces astroglial proliferation in cultured human optic nerve head astrocytes through ET_A/B receptor activation. This is similar to the proliferation of ET-1 in brain astrocytes. These findings suggest that ET-1, which is elevated in glaucoma, could cause proliferation of ONAs in the optic nerve head.

Astrocytes are the main glial cell type in the nonmyelinated region of the optic nerve head. Normally, optic nerve head astrocytes (ONAs) interact and provide cellular support to the axons of retinal ganglion cells by forming gap junctions, thereby promoting ionic regulation. ^{1 2} In addition, ONAs provide neurotrophic support and produce various extracellular matrix proteins to support the cribrosal beams. ^{3 4 5 6} The optic nerve head, composed of lamina cribrosa (LC), microglia, astrocytes, and the axons of retinal ganglion cells, is the main site of glaucomatous damage. ^{5 7 8}  

Under pathophysiological conditions such as neurotrauma, quiescent astrocytes undergo many changes and undergo astrogliosis, which in most cases leads to neuropathy. ⁹ Astrogliosis is characterized as astrocyte proliferation and activation followed by morphologic and cellular changes, hypertrophy, alteration of extracellular matrix profile, and formation of a glial scar. ^{5 9} Astrogliosis is a major, common pathologic feature of many neuropathies including glaucoma, Alzheimer disease, and neurotrauma. ^{5 9 10 11} Increased astrogliosis prevents axonal elongation and synaptogenesis in the repair process of the damaged nerves of the central nervous system (CNS). ¹¹ Astrogliosis occurs in human glaucomatous optic nerve heads ⁵ as well as in many animal models of glaucoma, including monkey, ^{12 13} rabbit, ¹⁴ and rat. ¹  

Endothelin (ET)-1 is a potent vasoactive peptide that is elevated in aqueous humor in some patients with primary open-angle glaucoma (POAG) ¹⁵ and in plasma in some patients with normal tension glaucoma (NTG), ^{16 17} but not in other patients with NTG ¹⁸ or POAG. ¹⁶ ET-1 has been considered an important contributing factor in promoting glaucomatous optic neuropathy through its intraocular and/or vascular effects. ^{19 20 21 22 23} ET-1 and its G-protein–coupled ET_A and ET_B receptors, are abundantly expressed and widely distributed in ocular tissues, including the retina, optic nerve, and ONAs, as well as in the brain. ^{24 25 26 27 28 29}  

Furthermore, elevated ET-1 levels in cortical astrocytes and ET-induced astrogliosis have been linked to other neuropathies such as Alzheimer’s disease, or the aftermath of subarachnoid hemorrhage, neurotrauma, ischemia, and experimental neurotrauma. ^{30 31 32 33 34} ET receptor antagonists can block ET-induced astrogliosis in experimental brain neurotrauma. ^{35 36} However, there are very few reports regarding the involvement of ET-1 in proliferation of optic nerve head astrocytes. 

The homeostatic role of ET-1 in the retina is yet to be clearly defined, but it may act as a neuropeptide involved in regulating retinal–choroidal blood flow and retinal wound healing. ²⁵ However, the effects of ETs in neurotrauma and neuropathies (including glaucoma) may include mitogenesis of astroglial cells resulting in neuronal damage. ^{25 37} For instance, an upregulation of astroglial ET_B receptor expression in rats is associated with astrocyte proliferation after optic nerve transection. ²⁶ The effects of ET-1 and its receptors on astrocytes may be relevant to glaucoma pathophysiology. In the present study, by using two different cell proliferation assays, we demonstrated that ET-1 is a mitogenic factor for cultured human optic nerve head astrocytes (hONAs). Thus, ET-1–mediated proliferation of hONAs may be an important factor that promotes optic nerve head astrogliosis and glaucomatous optic neuropathy. 

Materials and Methods

Cell Culture and Treatments

hONAs were isolated from eyes of donors of different ages (66, 81, and 90 years), as described previously with some modifications. ^{6 38 39} Briefly, human donor eyes from regional eye banks were received within 24 hours of death, and the LC was dissected from the remaining ocular tissue. LC tissue was cut into three to four explants and placed in culture plates containing DMEM plus 10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT). Most of the cells that grew out of the explants were LC cells that were then cultured in Ham’s F-10 medium with 10% FBS and passaged with a 0.25% trypsin solution. Mixed cell populations of hONAs and LC cells were trypsinized and plated in serum-free astrocyte growth medium (AGM). After 24 hours in culture, the medium was changed to AGM containing 5% FBS. LC cells failed to attach in serum-free medium and were removed when the medium was removed. 

Subsequently, cultured hONAs were maintained in DMEM plus 10% FBS and passaged as described. All cultures were maintained in 5% CO₂-95% O₂ at 37°C, and medium was changed every 2 to 3 days. Complete confluence was reached after nearly 3 weeks in culture. Confirmation that these hONAs were type 1b astrocytes was obtained by detecting the presence of glial fibrillary acidic protein (GFAP) and neural cell adhesion molecule (NCAM) ^{6 38} The hONAs were grown in 100-mm culture dishes (for RNA isolation) or T-75 culture flasks and were maintained at 37°C in DMEM medium (Gibco, Grand Island, NY) supplemented with 44 mM NaHCO₃, 10% FBS, and antibiotics (Gibco). Cells of passages 11 to 15 were used in the study. Most experiments were performed with hONAs from at least two different age groups. After reaching confluence, cells were trypsinized and seeded in serum-containing (SC)-DMEM on (1) glass coverslips at a density of 500 cells/coverslip for intracellular calcium [Ca²⁺]_i imaging with fura-2, (2) 1000 cells/well in a 96-well culture plate for the formazan cell proliferation assay, and (3) 3500 cells/well in a 96-well culture plate for the [³H]thymidine incorporation assay. The experiments were performed under serum-free culture conditions unless otherwise specified. All experiments were replicated at least twice with multiple coverslips (for [Ca²⁺]_i) and multiple wells (for cell proliferation assays) for each treatment. PD142893, an ET_A/B mixed antagonist (Sigma-Aldrich, St. Louis, MO), BQ788 (ET_B antagonist), and BQ610 (ET_A antagonist; Peninsula-Bachem Laboratories, San Carlos, CA) were included to demonstrate ET receptor involvement. The hONAs were pretreated with PD142893, BQ788, or BQ610 for 30 minutes before the addition of agonists (ET-1 and/or S6C, an ET_B agonist). Statistical analyses were performed to determine significance of treatment over control treatments by using one-way ANOVA with multiple comparison tests, and, where applicable, Student’s t-test was also performed. The level of significance was set at P < 0.05. 

Formazan Cell Proliferation Assay

The formazan assay was performed as described previously. ⁴⁰ A commercially available one-solution cell proliferation assay with the tetrazolium compound MTS (CellTiter 96 Aqueous; Promega, Madison, WI), was used to evaluate the mitogenic effects of ET-1 on hONAs. The MTS compound is bioreduced to formazan by reduced nicotinamide adenine dinucleotide phosphate (NADPH) or reduced nicotinamide adenine dinucleotide (NADH) produced by metabolically active dehydrogenase enzymes of cells, which can be detected at 490 nm. After cell seeding (1000 cells/well in quadruplicate wells for each treatment) the cells were maintained in SC-DMEM overnight. The next day, hONAs were washed with serum-free DMEM (SF-DMEM) and treated with fresh SF-DMEM containing with ET-1 (1, 10, and 100 nM) for periods of 48 and 96 hours. In some experiments, hONAs were also pretreated with 1 μM PD142893, an ET_A/B mixed receptor antagonist, or BQ610, an ET_A antagonist, for 30 minutes, before the incubation with ET-1 for 96 hours. After the treatments, the culture media were discarded and to each well 100 μL of fresh SF-DMEM along with 20 μL of the MTS solution was added and incubated at 37°C for 30 minutes. The 96-well plate was then placed in a kinetic microplate reader (Molecular Devices, Sunnyvale, CA) and the absorbance was read at 490 nm. To determine the actual cell number from the absorbance values of the experimental samples, a standard curve was generated with known numbers of hONAs seeded per well. Cells grown in SC-DMEM were used as the positive control and those grown in SF-DMEM were used as the negative control. 

[³H]Thymidine Uptake Assay

The [³H]thymidine uptake assay is a widely used technique to measure the levels of DNA synthesis in brain astrocytes treated with endothelin ^{41 42} and was performed with a commercially available scintillation proximity assay (SPA) kit, according to the manufacturer’s instructions (Amersham Pharmacia Biotech, Piscataway, NJ). The SPA beads are fluromicrospheres, that have DNA-binding ability and bind to [³H]thymidine-incorporated newly synthesized DNA. The hONAs (3500 cells/well) were seeded into a 96-well culture plate with SC-DMEM in quadruplicate wells for each treatment and left to acclimatize for 24 hours. For agonist or antagonist treatments, the cells were washed with SF-DMEM and replaced with fresh SF-DMEM containing various agonists or antagonists along with 0.5 μCi/mL [³H]thymidine (50,000 counts per million [cpm]/well). SC-DMEM was used as a positive control, whereas the negative control consisted of cells grown in SF-DMEM. Cells were treated with the agonists ET-1 (10 and 100 nM) and S6C (100 nM), an ET_B agonist, in SF-DMEM for a period of 96 hours. Cells were pretreated with ET receptor antagonists, including PD142893 (mixed), BQ788 (ET_B selective), and BQ610 (ET_A selective) for 30 minutes before the addition of agonists. After 96 hours, the media were removed, cells were washed twice in 100 μL PBS, and fresh PBS (130 μL) was added. A mixture of lysis buffer and SPA beads (1:2 ratio, for a volume of 75 μL/well) was added to each well, and the 96-well plate was placed on a plate mixer for 5 minutes. An enhancer solution (25 μL/well) was then added to each well, and the plate was once again placed on the mixer for an additional 5 minutes. The contents of each well were then transferred into a scintillation vial containing scintillation cocktail and counted in a beta counter for 1 minute. The results were expressed as average counts per million per well, and the negative control count was taken as 100%. 

Reverse Transcription–Polymerase Chain Reaction

RT-PCR was performed as previously described by Prasanna et al., ⁴³ to determine whether hONAs express the mRNA for ET-1 (specifically, preproET-1), ET_A, and ET_B receptors. Briefly, hONAs were cultured either in SC- or SF-DMEM for 12 to 24 hours, and total RNA was isolated (phenol-chloroform-ethanol extraction; TRIzol B; Gibco). Five micrograms of total RNA was taken for reverse transcription with avian myeloblastosis virus (AMV) reverse transcriptase (Promega). PCR primers were purchased from Fisher-Genosys (Plano, TX). The expected product sizes for preproET-1, ET_A receptor, ET_B receptor, and β-actin are listed in Table 1 . PCR primers were either designed using the Primer 3 program (provided in the public domain at http://www.basic.nwu.edu/biotools/Primer3.html by the Massachusetts Institute of Technology, Cambridge, MA) or obtained from previous publications. A 2.5-μL sample of cDNA from each treatment was used for RT-PCR amplification of each primer in a DNA thermal cycler (Perkin-Elmer, Foster City, CA), using 40 cycles of denaturation at 94°C for 1 minute, annealing at 60°C for 1 minute and extension at 72°C for 2 minutes. The PCR products were run on a 1.1% agarose gel in parallel with 100-bp DNA markers and stained with ethidium bromide. 

Measurement of [Ca²⁺]_i

[Ca²⁺]_i measurements were recorded as previously described. ⁴⁴ Briefly, hONAs were seeded on coverslips in SC-DMEM, serum starved overnight, and incubated with 3 μM fura-2 dye (Molecular Probes, Eugene, OR) in a modified Krebs-Ringer buffer solution (KRB; 115 mM NaCl, 2.5 mM CaCl₂, 1.2 mM MgCl₂, 24 mM NaHCO₃, 5 mM KCl, 5 mM glucose, and 25 mM HEPES [pH 7.4]) for 30 minutes at 37°C. Fura-2 fluorescence from these cells was monitored at 37°C by the ratio technique (excitation at 340 nm and 380 nm, emission at 500 nm) using a microscope (Diaphot; Nikon, Melville, NY) with fluorescence-analysis software (Metafluor; Universal Imaging, West Chester, PA). [Ca²⁺]_i was calculated according to the formula by Grynkiewicz et al. ⁴⁵ Calibrations were performed so that conditions of high [Ca²⁺]_i were achieved by adding the Ca²⁺ ionophore, 4-bromo-A23187 (1–3 μM; Calbiochem, La Jolla, CA), whereas conditions of low [Ca²⁺]_i were obtained by adding EGTA (4–5 mM). Two or three coverslips were used for measuring [Ca²⁺]_i under each treatment condition, so that four to seven cells per coverslip were sampled each time. 

Results

Expression of mRNA for preproET-1, ET_A, and ET_B Receptors in hONAs

PreproET-1 (the primary gene transcript for ET-1), ET_A, and ET_B receptors have been observed in brain astrocyte cell cultures and in human and rat optic nerve head tissues and are present mainly in astrocytes. ^{26 28 29 37 46 47} RT-PCR showed the presence of preproET-1, ET_A, and ET_B in cultured hONAs, in both serum-containing and serum-free culture conditions (Figs. 1A 1B) . The presence of ET-1 mRNA is suggestive of hONAs acting as potential source cells for ET-1 synthesis and release in the optic nerve head region, which could act in an autocrine manner through both ET_A and ET_B receptors. β-Actin was used as an internal control. The size of the expected PCR product was confirmed using the 100-bp ladder that was run in parallel in the agarose gel, and the authenticity of the PCR product was confirmed by sequencing. 

Effect of ET-1 on Proliferation of hONAs

ET-1 has been shown to be a potent mitogen in brain astrocytes. ^{37 41 42} Our results demonstrate that ET-1 caused a significant increase in proliferation of hONAs, as detected by two different cell proliferation assays: the formazan assay and [³H]thymidine incorporation assay. 

In the formazan assay, the number of cells was calculated based on the line equation, y = −0.0735 + 0.00049x (R ² = 0.938), which was calculated from a standard curve using 500, 1000, 1500, and 2000 cells. Higher doses of ET-1 (10 and 100 nM) produced a time-dependent significant increase in hONA cells, whereas at the lower dose of ET-1 (1 nM) there was no difference in hONA cell proliferation compared with the control for both treatment times, as recorded in the formazan assay (Fig. 2) . Although a statistical significance between the two doses of ET-1 (10 and 100 nM) was not observed (P = 0.231), a trend toward an increase in cells was observed at both treatment times (48 and 96 hours), suggesting that a saturation response was reached (Fig. 2) . Treatment with ET-1 at 10 and 100 nM produced a 12% and 15% increase in cells, respectively, over the control (set at 100%) during a 48-hour treatment period (P = 0.02). In the 96-hour treatment period, however, 10 nM ET-1 caused a 23% increase in hONA cells, whereas 100 nM ET-1 resulted in a 32% increase in hONA cells over the control (P = 0.002). 

PD142893 was added before ET-1 to determine whether it could block the effect of ET-1 on hONA proliferation. PD142893 was selected because it has been shown that both ET_A and ET_B receptors promote brain astrocyte proliferation. ^{41 42} The hONAs were pretreated with PD142893 followed by ET-1 (100 nM) for 96 hours. After the 96-hour treatment, ET-1 alone caused a 29% increase in hONAs, compared with the control (set at 100%; P = 0.002; Fig. 3A ). PD142893 treatment alone did not promote proliferation of hONAs, and results were similar to control results. However, in the combination treatment, PD142893 completely blocked the mitogenic effects of ET-1 (Fig. 3A ; P = 0.002). ET-1–induced hONA proliferation was also completely blocked by BQ610 (Fig. 3B ; P = 0.018), indicative of ET_A-receptor signaling in astrocyte proliferation, as shown in rat brain astrocytes by Stanimirovic et al. ⁴¹ Pretreatment with BQ788 (1 μM) also blocked ET-1–induced hONA cell proliferation (control: 100% ± 2%; 100 nM ET-1: 114% ± 2%; BQ788: 100% ± 4%; BQ788+ET-1: 92% ± 2%; P < 0.001; Fig. 3C ). These observations suggest that both ET_A and ET_B receptors participate in hONA proliferation. 

A [³H]thymidine uptake assay was also performed to confirm the findings of ET-1–induced hONA proliferation observed in the formazan assay. [³H]thymidine is incorporated into dividing cells and provides another quantitative method for assessing ET-1–induced hONA proliferation. As a control experiment, commercially available human U373MG astrocytoma cells (American Type Culture Collection [ATCC], Manassas, VA) were treated with ET-1 and S6C, in serum-free culture medium containing [³H]thymidine for 24 hours. Human U373MG astrocytoma cells are tumorigenic and are derived from the brain in glioblastomas. ⁴⁸ These cells are highly mitogenic compared with primary hONAs, with a doubling time of 24 to 48 hours compared with several weeks for hONAs. S6C (100 nM) and both ET-1 doses (10 and 100 nM) caused nearly a 30% to 50% increase over control (set at 100%) in [³H]thymidine incorporation, which was significant (P < 0.001; Fig. 4 ). In U373MG cells, ET-1–mediated [³H]thymidine uptake was significantly greater than that observed with S6C (100 nM; P = 0.01; Fig. 4 ). 

The optimal dose of ET-1 (100 nM) and treatment time (96 hours) determined from the formazan assay was used in the [³H]thymidine incorporation assay for hONAs. ET-1 caused a significant (31%) increase in the incorporation of [³H]thymidine over control (set at 100%) in hONAs (P = 0.001; Fig. 5A ). PD142893 (1 μM) blocked ET-1–induced [³H]thymidine incorporation in hONAs, but had no effect on its own uptake (Fig. 5A) . It has been demonstrated that activation of ET_B receptors in brain astrocytes can also increase [³H]thymidine incorporation, even though these cells may also express ET_A receptors. ⁴² Therefore, hONAs were treated for 96 hours with S6C (100 nM), a known potent ET_B agonist. S6C, like ET-1, also caused a 29% increase in [³H]thymidine incorporation, which was completely blocked by PD142893 (P = 0.026; Fig. 5B ). Thus, in our study, ET-1 was a mitogen for hONAs in culture. The increase in hONA proliferation after treatment with ET-1, as recorded in the formazan assay, was comparable with that observed in the [³H]thymidine assay. It is interesting that S6C, an ET_B agonist, mimics the effects of ET-1, which are blocked by BQ788, an ET_B antagonist, whereas BQ610, an ET_A antagonist, is able to block effects of ET-1 on proliferation of hONAs. These agonists’ effects can also be effectively blocked by PD142893, an ET_A/B receptor antagonist. 

Effect of ET-1 on [Ca²⁺]_i Mobilization in hONAs

We used fura-2 [Ca²⁺]_i imaging to determine whether ET-1 alters [Ca²⁺]_i concentrations in cultured hONAs. ET-1 has been shown to be a potent activator of [Ca²⁺]_i and is capable of triggering Ca²⁺ waves in brain astrocytes. ^{49 50} Furthermore, ET-induced elevation of [Ca²⁺]_i is also linked to increased cell proliferation in brain astrocytes in rat type I astrocytes. ⁴¹ As seen in brain astrocytes, ET-1 caused an increase in [Ca²⁺]_i, which was characteristically biphasic, consisting of a transient spike followed by a sustained plateau phase that was greater than the original baseline (Figs. 6A 6B) . This effect was observed in all hONAs treated with either 10 or 100 nM ET-1. The peak [Ca²⁺]_i at the 10- and 100-nM doses of ET-1 was similar (Table 2) . The baseline [Ca²⁺]_i for hONAs before treatment with ET-1 was between 20 and 45 nM (Table 2) . 

To determine the involvement of ET receptor activation and [Ca²⁺]_i, hONAs were pretreated with PD142893 for 30 minutes and then stimulated with ET-1. PD142893 alone did not cause an increase in [Ca²⁺]_i in hONAs. As is shown in Table 2 , ET-1–induced [Ca²⁺]_i in the presence of PD142893 was significantly attenuated (by 60%–75%) compared with that observed with ET-1 alone (P < 0.001). The transient peak that was seen with ET-1 treatment was totally abolished when the cells were pretreated with BQ610 (1 μM; Fig. 6C ; Table 2 ). Thus, PD142893 and BQ610 were able to block ET-1–mediated receptor activation of the calcium response effectively, in addition to blocking cell proliferation in hONAs. 

Discussion

In the present study, results of two different cell proliferation assays showed that ET-1 was a mitogen for cultured hONAs. Furthermore, these cell-proliferative effects were shown to be mediated through ET receptors, in that treatment with PD142893, an ET_A/B mixed antagonist, completely blocked the effect of ET-1 on hONAs in both cell proliferation assays. 

ET-1 is a potent mitogen for brain astrocytes, which results in astrogliosis when levels become elevated under conditions of experimental or clinical neurotrauma and disease. ^{37 51 52 53} In primary rat striatal astrocyte cultures treated with 50 nM ET-1 for 24 hours, [³H]thymidine incorporation increased by nearly 50% over the control, ⁴² whereas 10 nM ET-1 increased the same cultures by 100% over the control in rat cortical astrocytes. ⁴¹ Also MacCumber et al. ³⁷ found that ET-1 (1–100 nM) treatment for 24 hours caused a 50% increase in cells over the control in C6 glioma cells, while also causing an approximate 15% increase in primary rat cerebellar astrocytes. In all these studies, the control count was set 100%. Using the formazan assay, Hama et al. ³³ observed a 54% increase over control in rat cerebral astrocyte cells after treatment with ET-1 for 24 hours. In the present study, ET-1 stimulated human U373MG astrocytoma cell proliferation to the same extent as that observed in rat striatal astrocytes (i.e., 50% over control) as shown by Lazarini et al. ⁴² However, ET-1 treatment of hONAs for 96 hours induced [³H]thymidine incorporation 30% over the control, suggesting that these ONAs are not as sensitive to ET-1 as brain astrocytes or U373MG astrocytoma cells. Moreover, U373MG astrocytoma cells are tumorigenic and highly mitogenic compared with primary hONAs, in that the doubling time is approximately 24 to 48 hours for U373MG cells compared with 2 to 3 weeks for hONAs. 

Endothelins stimulate [Ca²⁺]_i in brain astrocytes, which results in increased cell proliferation. ⁴¹ Similar to our findings in hONAs, the coupling of the ET_A receptors to calcium signaling has been demonstrated in cortical astrocytes, and in those studies the responses to ET-1 were also biphasic. ^{41 47} The increase in [Ca²⁺]_i after treatment with ET also results in the transmission of mitogenic signals in Swiss 3T3 fibroblasts, ⁵⁴ vascular smooth muscle cells, ⁵⁵ and type I astrocytes. ⁵⁶ The downstream effects of [Ca²⁺]_i signaling, include PKC-dependent and -independent mechanisms (by the mitogen activating protein [MAP] kinase pathway), which are observed after ET-1–mediated proliferation of cortical astrocytes. ^{41 42}  

In many studies, ET-1–induced proliferation of astrocytes has been linked to both the upregulation and activation of ET_B receptors. ^{26 33 34 37 42} These proliferative effects are blocked by treatment with an ET_B antagonist BQ788, or mimicked with the ET_B-selective agonists IRL-1620 or Ala ^{1 3 11 15} -ET-1. ^{34 36 42} The present observation that S6C, an ET_B-selective agonist, also stimulated cell proliferation in hONAs suggests ET_B receptor involvement in these cells. Our finding that BQ788 was able to block ET-1–induced proliferation of hONAs is further suggestive of a mitogenic signaling cascade linked to ET_B receptors. In fact, the expression level of ET_B receptors in astrocytes may depend on the state of cell differentiation, so that differentiation itself would more likely induce ET_B expression. ³³ However, the roles of ET_A receptors in cell proliferation cannot be ruled out, because these receptors have been shown to be involved in the proliferation of rat type I cortical astrocytes. ⁴¹ Also, our findings demonstrate that BQ610, an ET_A receptor antagonist, was able to completely block cell proliferation and calcium signaling in hONAs. An intriguing finding in the BQ788 studies was that ET-1–induced hONA proliferation was approximately 14% compared with 30% observed in other studies. This could be due to a donor age effect, in that we used hONAs from an 81-year-old donor for BQ788 studies, compared with those from a 90-year-old donor used in some of the other studies. However, the overall effects of the mitogenic activity of ET-1 were significant in hONAs from both donor age groups, and both BQ788 and BQ610 completely blocked the effects of ET-1. 

To further complicate the matter, the existence of an atypical ET receptor in primary rat astrocytes has been suggested, which may either be a novel receptor with unusual binding properties for ET-1 and ET-3 (an ET_B agonist) or a product of heterodimerization of ET_A and ET_B receptors capable of distinct ligand-specific signaling. ^{48 57 58 59} In these and other reports, ⁶⁰ primary rat astrocytes expressed mRNA for both ET_A and ET_B receptors, whereas binding studies point to the existence of only one population of ET receptors on these cells. ^{33 48 54 61} Based on our RT-PCR experiments, hONAs also expressed mRNA for both ET_A and ET_B receptors. However in most cases, blocking only one of these ET receptors using selective antagonists did not fully prevent the effects of ET-1 effects in brain astrocytes, and complete inhibition was obtained only in the presence of ET receptor antagonists or mixed antagonists. ^{50 58} In hONAs, PD142893 and BQ788 blocked ET-1–induced cell proliferation completely, but PD142893 only partially blocked the calcium response. The ET_A antagonist BQ610 completely blocked both cell proliferation and the calcium response. These findings suggest that both ET receptors participate in hONA proliferation; therefore, the use of mixed ET receptor antagonists would be required to block the effects of ET-1. Although the contribution of each receptor to ET-1–induced proliferation of hONAs is presently unknown, the finding that a mixed antagonist is very effective suggests that multiple receptors are involved. Whether an atypical ET receptor may contribute to hONA proliferation awaits further studies involving receptor binding and antagonist dose–response curves. 

The exact mechanism(s) of the effects of ET-1 on the optic nerve head remain unclear. It is possible that increased ET-1 levels in glaucoma, either in addition to or as a consequence of elevated IOP (as seen in POAG), plays a role in the astrocyte proliferation and astrogliosis that occurs in the glaucomatous optic nerve head. ⁵ Although ET-1 levels in aqueous humor are greater in patients with POAG than in age-matched control subjects, the corresponding plasma levels are similar. ¹⁵ It is presently unclear why this is so. In a congenital canine model of glaucoma (beagle), it has been shown that ET-1 levels in aqueous humor are four times higher in glaucomatous eyes than that in normal eyes. ⁶² These observations suggest that elevated IOP induces increased ET-1 synthesis and release from intraocular ET sources, including ciliary epithelium, ⁶³ retinal pigmented epithelium, and optic nerve head astrocytes. ²⁹ The presence of preproET-1 mRNA in hONAs supports this possibility, because the optic nerve head is subject to mechanical effects of elevated IOP. ⁵ In fact, mechanical stretching has been shown to stimulate production of ET-1 in brain astrocytes. ⁶⁴ Endogenous ET-1, thus produced, could influence astrocyte morphology and behavior by autocrine or paracrine actions and promote astrogliosis through functional ET receptors. Changes in the glaucomatous optic nerve head namely, cupping of the optic disc and the compression, stretching, and rearrangement of the cribriform plates of the LC ^{7 8} are mainly due to astrocyte activation. Astrocyte activation also results in extensive remodeling of the extracellular matrix, and these combined actions are considered to be important detrimental elements leading up to axonal degeneration. ^{4 5 65 66 67}  

The concentration of ET-1 in the optic nerve head in glaucoma is presently unknown. In experimental models of glaucoma involving administration of ET-1 to the retrobulbar region, which results in loss of axons, ET doses ranged from 1.8 × 10⁻⁴ to 0.36 nmol for 3 days in rabbits ⁶⁸ and up to 80 nmol/d in primates for 2 to 6 months. ⁶⁹ Oku et al., ²² observed axon loss, gliosis, and optic cup enlargement after intravitreal injection of ET-1 (0.01 nmol for 1 month) in rabbits. Therefore, the 2 to 20 pmol (10–100 nM) of ET-1 used in this study to demonstrate hONA proliferation appears to be lower than that used in previous reports, and ET levels could in fact be higher in the glaucomatous optic nerve head. 

In conclusion, we have demonstrated that cultured human optic nerve head astrocytes respond to the effects of ET-1 through cell proliferation, which can be blocked by ET receptor antagonists. Astrogliosis may contribute to the development of glaucoma, and such an ET-mediated mechanism may cause optic nerve damage. 

 Presented at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May 2001.

 Supported by National Eye Institute Grant EY11979 (TY) and AHAF Grant G200006P (GP).

 Submitted for publication December 7, 2001; revised March 28, 2002; accepted April 9, 2002.

 Commercial relationships policy: E (AFC); N (all others).

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

PCR Primers and Expected Product Size

Gene	Primer (Sense) 5′ → 3′	Primer (Antisense) 5′ → 3′	Size (bp)
PreproET-1	TGCCAAGCAGGAAAAGAACT	TTTGACGCTGTTTCTCATGG	204
ETA	CCTTTTTGCAGAAGTCCTCG	GGACAGGATCCAGATGGAGA	561
ETB	ATGGCCCAAGGGTTCCAACGC	AGCTGTCTTCTGAACGGGATGAA	634
β-Actin	TGTGATGGTGGGAATGGGTCAG	TTTGATGTCACGCACGATTTCC	514

 Primers were used to detect expression of the listed genes in hONAs.

Figure 1.

 

Expression of preproET-1, ET_A, and ET_B receptor mRNA in serum-containing (S) or serum-free (SF) culture conditions, as determined by RT-PCR. (A) PreproET-1 mRNA expression and (B) ET_A and ET_B receptor mRNA expression. Total RNA was isolated from hONAs (from a 66-year-old and/or a 90 year-old donor) from which cDNA was prepared, and RT-PCR was performed using the primers listed in Table 1 . PCR products were separated on a 1.1% agarose gel containing ethidium bromide, and bands were visualized under UV light.

Figure 2.

 

ET-1 caused time- and dose-dependent cell proliferation in hONAs, determined by a formazan cell proliferation assay. The hONAs were treated with ET-1 (1, 10, and 100 nM) for 48 and 96 hours in SF-DMEM. After treatment, the media were discarded, and the formazan assay was performed. The number of cells was calculated based on a standard curve. *denotes statistical significance of mean number of cells (±SE) in the control versus ET-1 (10 and 100 nM) over 48 hours and **denotes the same over a 96-hour treatment period as determined by one-way ANOVA and Student-Newman-Keuls multiple comparison test at P < 0.05.

Figure 3.

 

Effect of endothelin receptor antagonists (PD142893, BQ610, and BQ788) on ET-1–induced cell proliferation of hONAs during a 96-hour treatment period, determined by a formazan assay. Results are expressed as percentage of change over control (set at 100%). (A) ET-1–induced cell proliferation was completely blocked by PD142893. Statistically significant difference between *control and ET-1 and **between ET-1, PD142893, and PD142893+ET-1 was determined by one-way ANOVA and Tukey’s multiple comparison test at P < 0.05. (B) ET-1–induced hONA proliferation was blocked by pretreatment with BQ610. Statistically significant difference between *control and ET-1 and **between ET-1, BQ610, and BQ610+ET-1 was determined by one-way ANOVA and Student-Newman-Keuls multiple comparison test at P < 0.05. (C) ET-1–induced hONA proliferation was blocked by BQ788. Statistical significance of difference between *control and ET-1 and **between ET-1, BQ788, and BQ788+ET-1, determined by one-way ANOVA and Student-Newman-Keuls multiple comparison test at P < 0.05. In experiments in (A) and (B), hONAs of a 90-year-old donor were used, whereas those of an 81-year-old donor were used in experiments in (C).

Figure 4.

 

ET-1 and S6C caused increased [³H]thymidine incorporation in human U373MG astrocytoma cells during a 24-hour treatment period. A [³H]thymidine incorporation assay was performed, in which U373MG astrocytoma cells were incubated with [³H]thymidine (2.5 μCi/mL) in the presence and absence of agonists (ET-1 and S6C) for 24 hours. Data represent the average percentage of [³H]thymidine uptake, where control uptake was set at 100%. Statistical significance of difference between *control and agonist treatments, determined by one-way ANOVA and Dunnett’s multiple comparison test (P < 0.05) and **between ET-1 (10 and 100 nM) and S6C treatments, determined by one-way ANOVA and Student-Newman-Keuls multiple comparison test (P < 0.05).

Figure 5.

 

Effects of ET-1 and S6C on hONA cell proliferation, as determined in a 96-hour [³H]thymidine uptake assay. (A) ET-1 (100 nM)–induced hONA proliferation for 96 hours was blocked by PD142893 (1 μM). (B) S6C mimicked the mitogenic effects of ET-1 on hONAs and its effects were also blocked by PD142893. Treatment with PD142893 alone did not induce [³H]thymidine uptake in hONAs. The hONAs were incubated for 96 hours with 0.5 μCi/mL [³H]thymidine in SF-DMEM, in the presence or absence of ET-1 or S6C. After the incubation period, the [³H]thymidine incorporation assay was performed. Data are expressed as the mean percentage of [³H]thymidine uptake, where control uptake was set at 100%. In both (A) and (B), statistical significance of difference between *control and treatments and **between ET-1 or S6C versus other treatments, which was determined by one-way ANOVA and Student-Newman-Keuls multiple comparison test (P < 0.05).

Figure 6.

 

Representative graphs of single cell measurements depicting the effect of ET-1 on [Ca²⁺]_i mobilization in hONAs, determined by fura-2 calcium imaging. Effect of (A) 10 nM and (B) 100 nM ET-1 on [Ca²⁺]_i. (C) Effect of BQ610 on ET-1 (100 nM)-induced [Ca²⁺]_i. The hONAs were preincubated with BQ610 for 30 minutes before the addition of ET-1 and the fura-2 assay was performed. A23187 (1 μM) is the calcium ionophore used for calibration purposes.

Table 2.

 

Effects of ET-1 and PD142893 on [Ca²⁺]_i in hONAs under Serum-Free Culture Conditions, by the Fura-2 Calcium Imaging Technique

Treatments	Baseline [Ca2+]i (nM)	Peak [Ca2+]i (nM)	Cells (n)
ET-1 (10 nM)	44 ± 7	914 ± 97	19
ET-1 (100 nM)	22 ± 5	1230 ± 266	13
PD142893 (1 μM)+ ET-1 (100 nM)	21 ± 3	394 ± 40*	17
BQ610 (1 μM)+ ET-1 (100 nM)	48 ± 5	52 ± 5	12

 Data are expressed as the mean ± SE of [Ca²⁺]_i measured either at baseline or at the peak [Ca²⁺]_i after ET-1 treatment.

*  Statistical significance of difference in mean [Ca²⁺]_i level between ET-1 (100 nM) and PD142893 (1 μM) + ET-1 (100 nM), as determined by Mann-Whitney test (P < 0.05). The hONAs were pretreated with PD142893 (1 μM) or BQ610 for 30 minutes before the addition of ET-1. PD142893 partially blocked ET-1-mediated [Ca²⁺]_i in these cells, whereas BQ610 completely blocked the effects of ET-1.

The authors thank Santosh Narayan, Christina Hulet, and Sherry English-Wright for excellent technical assistance.