Interactions of Endothelin-1 with Dexamethasone in Primary Cultured Human Trabecular Meshwork Cells

Abstract

purpose. Concentrations of aqueous humor endothelin (ET)-1 are increased in patients with primary open-angle glaucoma (POAG) as well as in animal models of glaucoma. Glucocorticoids have also been associated with glaucoma, in that topical administration of glucocorticoids can increase intraocular pressure by increasing outflow resistance in the trabecular meshwork (TM) in some individuals. Recent research has shown that dexamethasone (Dex), a synthetic glucocorticoid, can increase the release of ET-1 from human nonpigmented ciliary epithelial (HNPE) cells, a source of aqueous ET-1. In the present study, the downstream interaction of ET-1 with Dex in target TM cells, an action that may alter outflow resistance, was investigated.

methods. A normal primary human TM (NTM) cell line and a TM cell line derived from a glaucomatous eye (GTM) were used. The cells were treated with vehicle or Dex. The mRNA levels of prepro-ET-1, endothelin receptor A (ET_A), and endothelin receptor B (ET_B) were measured by quantitative RT-PCR (QPCR). The protein expression of ET_A and ET_B receptors were investigated by Western blot analysis using polyclonal anti-ET_A and anti-ET_B antibodies, respectively, on plasma membrane fractions. Intracellular Ca²⁺ ([Ca²⁺]_i) mobilization mediated by ET-1 was measured using the Fura-2 AM fluorescent probe technique as an index of ET receptor function. ET-1–stimulated nitric oxide (NO) release was measured using a Griess colorimetric NO synthase assay kit.

results. Both NTM and GTM cultured cells expressed prepro-ET-1 mRNA less abundantly than did HNPE cells, and Dex treatment had no effect on the mRNA expression of the ET-1 gene. TM cells expressed mRNA of ET_A receptors as detected by QPCR, whereas the ET_B message was not clearly delineated. Western blot analysis showed that both ET_A and ET_B receptor proteins were present. The ET_A receptor was linked to calcium mobilization as ET-1 produced an increase in intracellular calcium release, and this increase was blocked with a selective ET_A receptor antagonist. Dex failed to induce any change in the expression of the ET_A receptor in both NTM and GTM cells, and this was supported by the absence of a Dex effect on the ET-1–induced calcium response. However, Dex treatment diminished ET_B receptor protein expression and produced a decrease in ET-1–stimulated release of NO, a response mediated by ET_B receptors in TM cells.

conclusions. The Dex-induced increase in ET-1 released by HNPE cells coupled to the downstream Dex-induced specific suppression of ET_B receptor protein expression and declines in ET-1–mediated increase in NO released by TM cells could increase contraction and decrease relaxation of the TM and contribute to the declines in conventional aqueous humor outflow and increases in intraocular pressure that occur with glucocorticoids.

Glaucoma is commonly associated with elevated intraocular pressure (IOP), as occurs in POAG and results primarily from pathologic changes in the aqueous humor outflow pathway. Endothelin (ET)-1, a potent vasoactive peptide, may contribute to the etiology of POAG, as aqueous ET-1 concentrations are increased in POAG ¹ and in animal models of glaucoma. ² Moreover, chronic administration of ET-1 can produce optic neuropathy ^{3 4 5} and ET-1 has been proposed as a contributor to glaucoma pathophysiology. ⁶ In the anterior segment, HNPE cells have been shown to be a source for aqueous ET-1, as they endogenously synthesize and release ET-1. ^{7 8}  

Endothelin-1 has a variety of physiological and/or pathophysiological ocular functions depending on the receptor subtype present and the tissue involved. There are two major classes of endothelin receptors, ET_A and ET_B, that have been cloned and characterized in mammalian species. ^{9 10} Most commonly, ET_A mediates ET-1–induced increase in intracellular calcium [Ca²⁺]_i ¹¹ and vasoconstriction, ¹² whereas ET_B mediates vasodilation, apparently through increases in the production of NO. ¹³ ET_B receptors are also involved in the clearance of circulating ET-1. ^{14 15 16 17} Although it has been reported that ET-1 elicits [Ca²⁺]_i transients, ¹⁸ the expression and regulation of ET receptors in the trabecular meshwork (TM) and the downstream signaling events relating to outflow regulation are incompletely understood. 

Glucocorticoids, potent immunosuppressants and anti-inflammatory agents, are associated with primary open-angle glaucoma (POAG). It has been reported that patients with POAG have elevated levels of the endogenous glucocorticoid cortisol in the blood ^{19 20 21} and aqueous humor. ¹⁹ Ocular administration of glucocorticoids produces elevated IOP in some subjects. ^{22 23} It has been well established that glucocorticoids change the morphology and activity of TM, including altering cell size and cytoskeletal organization, ^{24 25} increasing extracellular matrix production, ^{26 27} decreasing extracellular metalloproteinase activity, ²⁸ and enhancing expression of a glaucoma gene, MYOC. ^{29 30} Overall, glucocorticoids increase extracellular matrix material deposition in the TM and subsequently increase outflow resistance and IOP. Recently, we have shown that glucocorticoids can increase the release of ET-1 from HNPE cells ³¹ and the HNPE cells may represent the cell source for ET-1 in the aqueous. A novel signaling pathway for glucocorticoids involving ET-1 may be implicated in the increase in outflow resistance by glucocorticoids. We therefore investigated whether the downstream actions of ET-1 on the target TM cells were affected by glucocorticoids. 

Material and Methods

Cell Culture

A primary normal TM cell line (NTM) from a 79-year-old normal white male donor, and a TM cell line from a 79-year-old white male donor who had had POAG (GTM) were used. These cells were isolated and propagated as previously described. ^{24 25 27 30} The cells were grown at 37°C and 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen-Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum and penicillin/streptomycin/glutamine (Invitrogen-Gibco) and 44 mM NaHCO₃. For experimental protocols, TM cells were grown to confluence, either on 100-mm culture dishes, 6-well culture plates (35-mm diameter/well), or 24-well culture plates (15-mm diameter/well). The culture medium was then changed to 5% FBS-DMEM and treated for 72 hours with an equivalent volume of vehicle (ethanol) or the glucocorticoid agonist dexamethasone (Dex; dissolved in ethanol; Sigma-Aldrich, St. Louis, MO), at a final concentration of 100 nM. RU486 (1 μM; Biomol Research Laboratories, Inc., Plymouth Meeting, PA), an antagonist of glucocorticoid receptors, was used in some experiments. HNPE cells and astrocytoma cells U373 MG were used as positive controls for ET-1 or ET-receptor expression. 

RNA Isolation and Quantitative Polymerase Chain Reaction

Total cellular RNA isolation and quantitative PCR (QPCR) were performed as previously described. ³¹ QPCR primers for human ppET-1, ET_A, ET_B, S15, and myocilin (Sigma-Genosys, The Woodlands, TX) are shown in Table 1 . The constitutively expressed “housekeeping” gene S15, a small ribosomal subunit protein, served as an internal control. Myocilin gene expression was used as an index of a glucocorticoid response. Myocilin primer pairs and QPCR amplification were designed according to Shepard et al. ³² The authenticity of QPCR products was confirmed by DNA sequencing and a BLAST search of the sequence through National Center for Biotechnology Information (http://www.ncbi.nim.nih.gov; data not shown). Quantification of relative RNA concentrations was achieved by using the comparative C_T method (as described in User Bulletin 2: http://docs.appliedbiosystems.com/pebiodocs/04303859.pdf; Applied Biosystems, Foster City, CA). 

Plasma Membrane Isolation and Western Blot Analysis

The isolation of plasma membranes and Western blot analysis were performed as previously described. ³¹ Briefly, after Dex treatment, plasma membrane fractions were isolated from both NTM and GTM cells. Protein concentration was determined using bicinchoninic acid (BCA) reagent. Western blot analysis for ET_A and ET_B receptors was performed using polyclonal anti-ET_A or anti- ET_B antibodies, respectively, with secondary horseradish peroxidase–conjugated donkey anti-rabbit IgG and visualized using an enhanced chemiluminescence (ECL) system. Nonspecific bands in the immunoblots were identified by preincubating the anti- ET_A or anti-ET_B antibodies with their respective receptor peptides. Densitometric analysis of the bands was accomplished using image-analysis software (Scion; National Institutes of Health, Bethesda, MD). 

Measurement of Intracellular Ca²⁺ Mobilization

Dynamic video imaging was used to measure intracellular Ca²⁺ within single cells according to a previously described method. ³³ Both NTM and GTM cells were grown on 25-mm diameter coverslips (Fisher Scientific, Pittsburgh, PA) inserted in six-well culture plates. After cells were washed three times with KRB buffer (in mM: 115 NaCl, 2.5 CaCl_2, 1.2 MgCl₂, 24 NaHCO₃, 5 KCl, 5 glucose, and 25 HEPES [pH 7.4]), cells were incubated with 3 μM Fura-2 AM dye (Molecular Probes, Eugene, OR) in KRB buffer at 37°C for 30 minutes. After this incubation period, cells were washed three times and were maintained in KRB buffer at 37°C. The [Ca²⁺]_i was measured with a fluorescence microscope (Nikon, Tokyo, Japan), using imaging software (MetaFluor; Universal Imaging Co., West Chester, PA), and fluorescence signal ratios were collected every 5 seconds at 340:380 nm excitation wavelengths. ET-1 (100 nM) was added to the buffer, and changes in fluorescence ratios were recorded. BQ610 (Peninsula Laboratory Inc., Belmont, CA), an antagonist of the ET_A receptor, was used at concentration of 1 μM to determine whether ET-1–induced-Ca²⁺ mobilization is mediated through the ET_A receptor. The antagonist was added 30 minutes before the addition of ET-1. To convert fluorescence ratios to calcium concentrations, maximum and minimum ratios of fluorescence were obtained by applying 1 μM of the calcium ionophore 4-bromo-A23187 (Calbiochem, CA), and 5 mM EGTA, respectively. The intracellular Ca²⁺ concentration ([Ca²⁺]_i) was then calculated by using the equation devised by Grynkiewicz et al. ³⁴  

Determination of Nitrite Accumulation in Culture Medium

After treatment with Dex for 72 hours, confluent NTM cells grown on 24-well culture plates were shifted to serum-free (SF) DMEM with 250 μL SF-DMEM in each well, supplied with 100 nM Dex and additional 100 nM ET-1. After this 24-hour incubation, culture media were collected and NO was measured as nitrite, the final oxidation breakdown product of nitric oxide (NO) released into the culture medium using Griess colorimetric NO synthase (NOS) assay kit (Calbiochem, San Diego, CA) according to the manufacturer’s protocol. Nitrite concentration in the culture medium was calculated from a constructed nitrite standard curve. An ET_B receptor antagonist (1 μM BQ788; Peninsula Laboratory Inc.) was added 30 minutes before the addition of ET-1 to determine the role of ET_B receptor on NO release induced by ET-1. 

Results

mRNA Expression of Prepro-ET-1, ET_A, and ET_B Receptors in NTM and GTM Cells

QPCR revealed that both NTM and GTM cells express prepro-ET-1 message; however, the prepro-ET-1 mRNA level was apparently much lower in TM cells than that in HNPE cells (Fig. 1) . Dex (100 nM) produced a significant increase in mRNA levels of prepro-ET-1 in HNPE cells, whereas it had no effect on prepro-ET-1 mRNA levels in TM cells (Fig. 1) . 

Both NTM and GTM cells expressed abundant mRNA of ET_A receptors, and Dex (100 nM) had no effect on the mRNA expression of ET_A receptors, although these cells responded to Dex (100 nM) by significantly increasing myocilin mRNA expression (Fig. 2) . ET_B receptor message expression was not detected in either NTM or GTM cells under control, Dex (100 nM), or serum-free overnight conditions, whereas as expected, ET_B receptor mRNA was present in positive control cells tested, including brain astrocytoma and HNPE cells (data not shown). 

Effects of Dex on ET_A and ET_B Receptor Protein Expression in NTM and GTM Cells

Because there was mRNA expression of ET_A receptors while ET_B receptor mRNA was not detected, we next determined whether TM cells express ET_A and ET_B receptor proteins and whether their levels would be regulated by Dex. Western blot analysis revealed that both ET_A and ET_B receptor proteins were present in NTM and GTM cells. Anti-ET_A antibody recognized an approximate 43-kDa band (Figs. 3A 3D) , and ET_A receptor peptide completely blocked the recognition of this band (Figs. 3B 3E) . Therefore, this 43-kDa protein was the ET_A receptor. Treatment with Dex for 72 hours did not alter protein levels of the ET_A receptor (Figs. 3C 3F) . 

Anti-ET_B antibody recognized three bands sized approximately 80, 65, and 38 kDa (Figs. 4A 4D) . Competing ET_B peptide completely blocked the recognition of only the lowest band, whereas the other bands remained (Figs. 4B 4E) . Therefore, the high molecular weight bands appear to be nonspecific bands, and the protein recognized with a size of 38 kDa is the ET_B receptor. Dex treatment for 72 hours significantly decreased the protein levels of ET_B receptors in both NTM and GTM cells (Figs. 4C 4F) . Treatment with RU486 (1 μM), an antagonist of glucocorticoid receptors, did not block Dex-induced decrease of ET_B receptor protein and, of particular interest, RU486 alone showed partial agonist activity, as it also decreased the level of ET_B receptors (Figs. 4G 4H) . 

Effects of Dex on ET-1–Mediated [Ca²⁺]_i Mobilization

To determine whether ET_A receptor function was altered by Dex treatment, the effects of ET-1 on [Ca²⁺]_i were measured in both NTM and GTM cells under vehicle control and Dex treatment conditions. As expected, primary TM cells produced a significant increase in [Ca²⁺]_i in response to 100 nM ET-1, and this response showed a typical biphasic phenotype with a transient spike followed by a sustained plateau (Figs. 5A 5D) . This plateau was maintained even after ET-1 was removed (data not shown). The initial increase in [Ca²⁺]_i peaked at Ca²⁺ concentrations well over 1 μM, whereas baseline levels were initially below 100 nM (Table 2) . Dex (100 nM) treatment for 72 hours did not alter ET’s Ca²⁺ response phenotype in both NTM and GTM cells (Figs. 5B 5E) , and Dex did not change the basal levels of [Ca²⁺]_i nor the ET-1–induced peak response in [Ca²⁺]_i in these TM cells. Preincubation with BQ610, an antagonist of ET_A receptors, completely blocked ET-1–mediated [Ca²⁺]_i mobilization (Fig. 5C) . This finding indicates that ET-1–mediated [Ca²⁺]_i mobilization occurs through activation of ET_A receptors in TM cells. 

Effects of Dex on ET-1–Induced NO Release from NTM Cells

To determine whether the decrease in the level of ET_B receptors by Dex causes a similar decrease in functional response in TM cells, the effect of Dex on ET-1–induced release of NO was measured. A Griess colorimetric assay was used to detect the nitrite (the final oxidation product of NO) in culture medium. ET-1 (100 nM) significantly elevated nitrite concentrations in medium compared with that observed in control cells without ET-1 treatment, and BQ788 1 μM, an ET_B receptor antagonist, completely blocked the elevation of nitrite by ET-1 (Fig. 6) . This result indicates that ET-1–mediated NO release occurs through activation of ET_B receptors in TM cells. Dex (100 nM) alone did not alter NO release compared with the vehicle control; however, Dex treatment significantly decreased the ET-1–mediated NO release compared with cells without Dex treatment. This was consistent with the finding that Dex decreased ET_B receptor expression in TM cells (as reported earlier in this paper) and that ET-1 stimulated NO release by activating ET_B receptors. 

Discussion

It was postulated that aqueous ET-1 could influence the downstream effects of Dex on TM because it is known that ET-1 could contract TM and that TM contraction increases outflow resistance, whereas TM relaxation increases outflow facility. ^{35 36} However, it was not known whether TM cells express ET-1 or whether Dex treatment stimulates expression of ET-1. In this study, QPCR detected weak expression of prepro-ET-1 mRNA in both NTM and GTM cells. Dex treatment did not change prepro-ET-1 mRNA expression in these cells. Compared with TM cells, HNPE cells expressed approximately four times higher basal levels of prepro-ET-1 mRNA in control cells, and Dex treatment caused a further threefold increase of prepro-ET-1 message. After Dex (100 nM) treatment, HNPE cells expressed more than 10 times higher levels of prepro-ET-1 mRNA compared with TM cells. We propose that NPE cells are the source of aqueous humor ET-1 and that released ET-1 may have downstream actions in TM. The finding that Dex treatment also enhanced ET-1 expression and release suggests that ET-1 may mediate Dex effects on target tissues such as TM cells. 

ET-1 has diverse biological activities through different receptor subtypes, ET_A, and ET_B receptors. ^{6 37} Although ET-1 has significant actions on the regulation of IOP, ³⁸ functional ET receptor expression in TM, a tissue regulating outflow resistance, is not certain. Previously, ET_A receptor mRNA but not ET_B receptor message in TM cells was identified by RT-PCR. ¹⁸ Presently, only ET_A receptor mRNA was detected by QPCR, whereas the ET_B receptor message was not clearly delineated. However, Western blot analysis showed that both ET_A and ET_B receptor proteins were present. The reason for this apparent difference between message and protein could be due to the finding that ET_B mRNA has a short intracellular half-life as the 3′ noncoding region contains an AUUUA motif implicated in selective destabilization of mRNA. ¹⁰ The finding that ET_B receptor expression was not readily detected could reflect instability of the ET_B mRNA in TM cells. 

Western blot analysis revealed that the ET_A receptor protein had a molecular mass of 43 kDa, whereas the ET_B receptor was at slightly less than 40 kDa. Previously, we found ET_A and ET_B receptors had similar molecular weights in HNPE cells. ³¹ There have been numerous reports of different molecular weights for ET_A and ET_B receptors that range between 30 to 70 kDa. ^{39 40 41 42 43} The ET_A gene has a single transcription start site, whereas the murine and bovine ET_B gene has been reported to have alternative transcriptional initiation sites. ^{44 45} An ET_B splice variant from alternative RNA splicing was identified in various human tissues. ⁴⁶ Moreover, a metalloproteinase cleavage site was identified in the ET_B protein sequence. ⁴⁷ Overall, the apparent differences in reported molecular weights could be attributed to the source of antibodies, species or tissue specificity, posttranslation modification, different proteolytic processing, or ultimately the result of inaccuracy inherent in the estimation of the molecular weight of membrane proteins by SDS-PAGE. 

QPCR and Western blot analysis demonstrated that 100 nM Dex treatment for 3 days did not alter ET_A receptor mRNA and protein levels. In contrast, Dex treatment decreased ET_B receptor protein levels. There are several mechanisms that could account for the effect of glucocorticoids on the regulation and expression of ET_B target gene. Activated glucocorticoid-receptor complex can either bind to the glucocorticoid response element in target genes to regulate the transcription of these genes, or perhaps interfering with other transcription factors, such as NF-κB and AP-1, and thereby preventing the actions of these transcription factors. ⁴⁸ Some other glucocorticoid responses may involve glucocorticoid receptor activation of a primary response gene whose gene product in turn secondarily activates other genes. ³² However, the precise mechanism of glucocorticoid regulation of ET_B receptor expression remains unclear. There is also very little information available on the regulation of endothelin receptor gene expression. Therefore, further experiments are needed to delineate the pathways that may be involved in the regulation of ET_B receptor expression by Dex in TM cells. 

RU486 did not block Dex’s effects on the ET_B receptor protein. It also appears that RU486 may function as a partial agonist, in that it had its own effect on ET_B receptor protein level. In fact, RU486, a classic antagonist for both progesterone and glucocorticoids receptors, interferes with steroid-mediated activation but often confers an agonist activity on steroid receptors. ^{49 50 51} RU486 could also function as a partial agonist in TM cells and HNPE cells. ^{31 32} This partial agonist activity may explain the inability of RU486 to block the Dex-mediated decrease in ET_B receptors. 

ET-1 can mediate [Ca²⁺]_i and contraction of TM ³⁵ through ET_A receptors. ¹⁸ This was supported by the finding that the ET_A receptor antagonist, BQ610, completely blocked this calcium mobilization. Dex treatment had no effects on ET_A mRNA and protein levels, as detected by QPCR and Western blot analysis, and Dex also did not alter the function of ET_A receptors, because both the baseline and ET-1–induced peak increase in [Ca²⁺]_i was similar under Dex treatment and control conditions. This normal function of ET_A receptors is important in considering Dex’s effect on aqueous humor outflow, particularly because Dex increased the ET-1 released from HNPE cells and ET-1 targets normally functioning ET_A receptors on TM cells. Such an action could cause more intensive contraction of the TM. 

The finding that TM cells expressed not only ET_A but also ET_B receptors suggested a complex regulation function. ET_B receptors most commonly regulate vasodilatation or relaxation. ⁵² The signaling pathway coupled to ET_B receptors has been linked to NO production. ET-1 activates endothelial NOS (eNOS) and hence NO production through ET_B receptors in vascular endothelial cells. ¹³ ET-3 increases retinal blood flow through activation of ET_B receptors, which also is dependent on NO production. ⁵³ ET-1 and -3 also enhance inducible NOS (iNOS) expression, and this is mediated by ET_B receptors in glial cells. ⁵⁴ TM cells have been shown to express different isoforms of NOS and produce NO. ^{55 56 57} In the present study, we determined that the ET_B receptors were linked to NO production in NTM cells. We detected basal levels of NO production in NTM cell culture media and showed that 100 nM ET-1 markedly increased NO release. An ET_B receptor antagonist BQ788 completely blocked this stimulation of NO by ET-1. These findings indicated that ET-1–induced NO release is mediated by ET_B receptors. Dex treatment decreased the ET_B receptor protein level and also reduced ET-1–induced NO release, further implicating ET_B in ET-1–induced release of NO in TM cells. There are several reports that NO donors could relax TM and lower IOP. ^{58 59 60} This decrease of ET_B receptor level and subsequent decrease of ET-1–induced release of NO by Dex could reduce NO mediated relaxation of TM. Moreover, ET_B receptors are known to mediate ET-1 clearance. ^{14 15 16 17} The decrease of ET_B receptors in TM cells by Dex could also potentiate ET-1-mediated contraction of TM through ET_A receptors. 

In conclusion, Dex-induced specific suppression of ET_B receptor protein expression and reduction in the ET-1–mediated increase in NO levels in TM cells with the concomitant increase of ET-1 release from HNPE cells by Dex could increase contraction and decrease relaxation of TM and reduce the intratrabecular space. This may exacerbate the effects of Dex on the outflow pathway, leading to increased outflow resistance and, consequently, elevated IOP. 

 Supported by Grant EY11979 from the National Eye Institute and the Advanced Technology Program, Texas Higher Education Coordinating Board.

 Submitted for publication May 14, 2003; revised July 21, 2003; accepted August 11, 2003.

 Disclosure: X. Zhang, None; A.F. Clark, Alcon Research, Ltd. (E); T. Yorio, Alcon Research, Ltd. (F, P)

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Quantitative PCR Primer Sequences and Expected Product Sizes

Gene	Sense	Anti-Sense	Size (bp)
ppET-1*	TATCAGCAGTTAGTGAGAGG	CGAAGGTCTGTCACCAATGTGC	180
ETA	GTTGAACAGAAGGAATGGCAGC	ATTCACATCGGTTCTTGTCC	181
ETB	TCACTGTGCTGAGTCTATGTGC	AGCAGATTCGCAGATAACTTCC	206
Myocilin	GCCCATCTGGCTATCTCAGG	CTCAGCGTGAGAGGCTCTCC	82
S15	TTCCGCAAGTTCACCTACC	CGGGCCGGCCATGCTTTACG	361

*  ppET-1 represents prepro-ET-1.

Figure 1.

 

The mRNA expression of prepro-ET-1 in NTM and GTM cells as determined by QPCR. (A) HNPE cells were used as positive controls and treated for 24 hours with vehicle control (lane1), 1 nM Dex (lane 2), 10 nM Dex (lane 3), and 100 nM Dex (lane 4). NTM cells vehicle control (lane 5), 100 nM Dex (lane 6), GTM cells vehicle control (lane 7), and 100 nM Dex (lane 8). S15 was used as an internal control. (B) QPCR data are presented as the mean percentage ± SEM of the vehicle control value in HNPE cells. Experiments were repeated three times for each culture cell line. *Statistical significance of Dex treatment versus vehicle control in HNPE cells; **statistical significance of vehicle control or Dex treatment in TM cells versus vehicle control in HNPE cells; one-way ANOVA and Student-Newman-Keuls multiple-comparison test (P < 0.05).

Figure 2.

 

Effects of Dex on the expression of the mRNA of ET_A receptors in NTM and GTM cells, as determined by QPCR. (A–C) NTM cells; (D–F) GTM cells. QPCR data are presented as the mean percentage ± SEM of mRNA levels of ET_A or myocilin from Dex treatment compared with the respective vehicle control. *Statistical significance of the mean percentage ± SEM of myocilin from Dex treatment versus the control; Student’s t-test (P < 0.001). Experiments were repeated three times for each culture cell line.

Figure 3.

 

Effects of Dex on the protein expression of ET_A receptors in NTM and GTM cells, as determined by Western blot analysis. (A–C) NTM cells; (D–F) GTM cells. Western blot analysis of ET_A receptor using anti-ET_A receptor antibody without (A, D) and with preincubation with ET_A receptor peptide (B, E). The quantification of band intensity (C, F) is represented as the mean percentage ± SEM compared with the corresponding vehicle control band in the same blot. There was no statistically significant difference; Student’s t-test in three repeated experiments for each culture cell line.

Figure 4.

 

Effects of Dex on the protein expression of ET_B receptors in NTM and GTM cells, as determined by Western blot analysis. (A–C) NTM cells; (D–F) GTM cells; (G, H) the effects of RU486 on the action of Dex on the level of ET_B receptors in NTM Cells. Western blot analysis of ET_B receptor using anti-ET_B receptor antibody without (A, D, G) and with preincubation with ET_B receptor peptide (B, E). The quantification of band intensity (C, F, H) is represented as the mean percentage ± SEM compared with the corresponding vehicle control band in the same blot. *Statistical significance of Dex and/or RU486 treatment versus vehicle control; **statistical significance from RU486 treatment versus Dex treatment as determined by Student’s t-test or one-way ANOVA and Student-Newman-Keuls multiple comparison test (P ≤ 0.001). Experiments were repeated three times for each culture cell line.

Figure 5.

 

Effects of Dex on ET-1–mediated intracellular Ca²⁺ mobilization in NTM and GTM cells. NTM cells treated with vehicle (A) or 100 nM Dex (B). NTM cells preincubated with ET_A receptor antagonist, BQ610 1 μM (C). GTM cells treated with vehicle (D) or 100 nM Dex (E).

Table 2.

 

Summary of ET-1–Mediated [Ca²⁺]_i Peak Response in TM Cells

Cell Line/Treatments	Baseline	Peak	Cells (n)
NTM Control	87.08 ± 9.45	1157.03 ± 164.67*	51
NTM Dex	73.54 ± 7.37	1183.34 ± 204.37*	50
GTM Control	45.70 ± 5.16	1295.64 ± 211.76*	20
GTM Dex	44.81 ± 6.98	1230.11 ± 218.71*	20
NTM BQ610	21.31 ± 2.60	23.16 ± 2.95	13

 ET-1 was applied at 100 nM. Data are expressed as mean Nanomolar ± SEM.

*  Statistical significance was determined by t-test at P < 0.001 between baseline and ET-1–induced peak level.

Figure 6.

 

Effects of Dex on ET-1–induced NO release from NTM cells. Data are expressed as the mean micromolar ± SEM of nitrite released in culture medium. *Statistical significance of vehicle control+ET-1 (100 nM) treatment versus vehicle control; **statistical significance vehicle control+BQ788 (1 μM)+ET-1 (100 nM) versus vehicle control+ET-1 (100 nM); ***statistical significance of Dex+ET-1 (100 nM) versus vehicle control+ET-1 (100 nM), as determined by one-way ANOVA and Student-Newman-Keuls multiple-comparison test (P < 0.05) in three repeated experiments on NTM cells.

The authors thank Jerry Simecka for his assistance with quantitative PCR, and Ganesh Prasanna, Raghu Krishnamoorthy, and Santosh Narayan for helpful discussions.