The Spectrum of Antimicrobial Peptide Expression at the Ocular Surface

Abstract

purpose. Antimicrobial peptides are the eukaryotic analogues of antibiotics. In addition to their antimicrobial activity, these peptides can signal to host cells and are therefore intermediaries between the innate and adaptive immune systems. Results in a prior study showed that β-defensins-1 and -2 are made by ocular surface epithelial cells. In the present study, a survey was made of antimicrobial peptide expression, including 17 previously described members of the β-defensin family, at the surface of the human eye.

methods. Total RNA was obtained from 43 fresh and cultured corneal and conjunctival samples, including 9 samples from patients with clinical infections. The expression of 21 antimicrobial peptides was determined using reverse transcription-PCR. Where detected, relative expression was quantitated using real-time PCR.

results. Expression of 7 of the 21 antimicrobial peptides investigated, β-defensin-1 to -4, liver expressed antimicrobial peptide (LEAP)-1 and -2, and LL37/cathelicidin, were detected frequently in samples of ocular surface epithelia. Distinct but overlapping profiles of expression were detected in cornea and conjunctiva, with expression of β-defensin-3 and -4 and LEAP1 and -2 most common in cultured corneal epithelia. Expression of β-defensin-3 was detected in a greater percentage of corneal and conjunctival samples with infection.

conclusions. Together with known lacrimal antimicrobial activities, these results extend the knowledge of antimicrobial activity at an important mucosal site, the ocular surface, allowing synergistic interactions to be investigated. The findings has significant implications both for the understanding of the normal homeostasis of mucosal surfaces and for antimicrobial and anti-inflammatory therapies.

Mucosal surfaces are under the constant threat of pathogenic attack. ¹ The eye is a particular case in point: In addition to elements common to other mucosal surfaces, the cornea is poorly served by blood vessels, and corneal damage, whether due to serious infection or the subsequent inflammatory response, can lead to visual loss. ² Like other mucosal surfaces, various mechanisms have evolved to protect the eyes from pathogen attack. For example, the external ocular surfaces are bathed in a liquid tear film. The strong antimicrobial nature of this tear film allows active reduction in microbial titer without the need for continuous (and potentially damaging) inflammatory responses. ^{2 3} The tear film is derived from two principle sources: the lacrimal glands and the secretions from the two ocular epithelial surfaces, the cornea and the conjunctiva. The production of antimicrobial peptides (AMPs) by the epithelial cells, in particular human β-defensin-1 and -2 (hBD1 and -2), has been demonstrated recently. ^{4 5 6 7} The epithelial production of AMPs is of particular significance, as many AMPs are inducible by inflammatory stimuli, and production is at the actual site of infection. Therefore, in common with other mucosal sites, the ocular surface is protected from pathogens, at least in part, by epithelial secretion of AMPs. 

More than 500 natural AMPs of four distinct structural classes are known, ⁸ though the defensin and cathelicidin families are numerically the most important in mammalian immunity. ⁹ AMPs are typically cationic peptides 20 to 40 amino acids long, interacting with bacterial membranes through charge interactions and hydrophobic amino acids. They are mainly expressed by epithelial cells at mucosal surfaces and by leukocytes and have been shown to exhibit broad-spectrum activity against Gram-positive and -negative bacteria, fungi, and certain enveloped viruses. ^{8 10 11} AMPs can also have a role in cell signaling, thus linking the innate and adaptive immune systems. ^{12 13 14} It has been suggested that, due to the large number of AMPs and their extraordinarily diverse activities, an important feature of the action of such peptides is that they act synergistically in defending the host against microbial pathogenesis. ^{11 14} However, due to the sheer number of potential interactions and the lack of knowledge of which antimicrobial activities are coexpressed at which sites, the analysis of antimicrobial synergy is still in its infancy. In this study, we conducted a systematic survey of the expression of AMPs at a mucosal site, the ocular surface, using reverse transcription (RT) and real-time PCR. 

Methods

Corneal Cell Cultures

All tissues for this research were obtained with informed consent and local ethics committee approval; research was conducted in accordance with the tenets of the Declaration of Helsinki. Explant cultures of limbal–corneal epithelial cells were generated from the remaining corneoscleral rims after penetrating keratoplasty (n = 15; mean age, 51.7 years; range, 16–88; seven male, eight female donors). Donor tissue was provided for use in transplantation and research with the patients’ consent. All donor corneas were stored in organ culture medium for up to 1 month before transplantation. ¹⁵ Epithelial cell cultures were established in corneal epithelial medium (CEM) consisting of Dulbecco’s modified Eagle’s medium and Ham’s F12 (1:1 vol/vol; both Invitrogen, Paisley, UK) supplemented with fetal calf serum (FCS, 5% vol/vol; Invitrogen), cholera toxin (0.1 μg/mL; Calbiochem-Novabiochem, Nottingham, UK), insulin (5 μg/mL; Invitrogen), epidermal growth factor (10 ng/mL; R&D Systems, Oxford, UK), gentamicin (5 μg/mL; Invitrogen), and dimethyl sulfoxide (0.05% vol/vol; Sigma-Aldrich, Poole, UK). Explants were then incubated submerged in CEM at 37°C and 5% CO₂, with medium changed three times a week. Cell growth was assessed by phase-contrast microscopy, and RNA was isolated from subconfluent cultures. 

Impression cytology filters were used to obtain cells directly from the cornea (n = 9; mean age, 67.8 years; range, 49–79; six male, three female donors) or conjunctiva (n = 13; mean age, 65.8 years; range, 37–87; seven male, six female donors) for analysis. Several of the conjunctival and corneal filter samples were obtained from patients known to have ocular surface clinical infections at the time of sampling (Table 1) . Infections were caused by either herpes simplex virus (conjunctival n = 3, corneal n = 3) or bacterial ulceration (conjunctival n = 2, corneal n = 1). For sampling, small adherent filter discs (cellulose acetate; Millipore, Watford, UK) were placed over the anesthetized cornea and/or conjunctiva of consenting patients or control subjects and allowed to adhere for 10 to 15 seconds. The discs were then removed, taking with them a fine layer of cells from the ocular surface. Discs were stored in 0.5 mL stabilizing reagent (RNAlater; Ambion, Huntingdon, UK) at 4°C before isolation of RNA. 

Corneal epithelial cells were prepared from cadaveric donor eyes, with consent for use in research, by stripping the epithelial cells from the underlying stroma under a dissecting microscope (n = 6; mean age, 58.8 years; range, 35–78; three male, three female donors). After isolation, cells were placed directly in lysis buffer for RNA extraction. 

Isolation of RNA and cDNA Synthesis

Total RNA was isolated from the cell cultures, filter discs, and epithelial cells by using a commercial kit (RNeasy and Qiashredder columns, Qiagen, Crawley, UK) according to the manufacturer’s protocol. RNA was eluted into 1 mM sodium citrate (Ambion) and stored at −70°C. First-strand cDNA was prepared with dT-primed cDNA kits (Ready-to-Go; Amersham Biosciences, Little Chalfont, UK), according to the manufacturer’s instructions. 

Polymerase Chain Reaction

PCR was performed on each sample using primers for 21 human AMPs (Table 2) . Primers were designed based on retrieved GenBank sequences using Primer 3 software (http://www.wi.mit.edu/ Whitehead Institute, Massachusetts Institute of Technology, Cambridge, MA; and http://www.ncbi.nlm.nih.gov/Genbank/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). Each reaction was prepared with a commercial buffer (final concentrations: 60 mM Tris/HCl [pH 8.5], 15 mM (NH₄)₂SO₄, and 2 mM MgCl₂; Invitrogen), dNTP (0.25 mM final concentration; Invitrogen), 0.01% (vol/vol) Tween 20 (Sigma-Aldrich), 0.4 μM of each primer (final concentration; MWG Biotech, Ebersberg, Germany), 0.5 U Taq DNA polymerase (AmpliTaq Gold; Applied Biosystems Inc., Warrington, UK) and 0.5 μL first-strand cDNA, in a total volume of 25 μL. Reactions were cycled at 94°C for 10 minutes followed by 38 cycles of 94°C for 1 minute, 56°C for 1 minute, and 72°C for 1.5 minutes and a final incubation of 72°C for 20 minutes. The products of each PCR were analyzed on ethidium-bromide–stained 1.2% (wt/vol) agarose gels. ¹⁶ cDNA synthesis quality was assessed with primers targeted to hypoxanthine guanine phosphoribosyltransferase 1 (HPRT; Table 2 ; GenBank accession number NM_000194); only samples showing positive amplification for HPRT were analyzed further. 

Real-Time PCR

For selected primers, real-time PCR analysis was performed to allow calculation of the relative abundance of transcripts. ¹⁷ Reactions were prepared with 12.5 μL 2× PCR master mix (Brilliant SYBR Green QPCR Master Mix; Stratagene, Amsterdam, The Netherlands), 0.25 μM final concentration of each primer, 0.75 μL reference dye (Stratagene), and 0.25 to 1 μL cDNA, in a final volume of 25 μL. Positive control (PCR-ready human testes cDNA; Ambion, and inflamed human tonsil cDNA) and negative control reactions were run simultaneously with all PCRs. Reactions were cycled in an real-time PCR machine (model MX4000; Stratagene) for 10 minutes at 95°C, followed by 40 cycles of 95°C for 30 seconds, 56°C for 1 minute, and 72°C for 1.5 minutes, followed by a preprogrammed dissociation step. ¹⁸ Successful amplification was assessed from agarose gel electrophoresis and dissociation data. ¹⁸ For specifically amplified products, the threshold cycle (C_t) for amplification of each target was normalized to the threshold cycle for an internal housekeeping control (HPRT), with the threshold cycle inversely proportional to the log of the initial copy number. ¹⁹ This calculation was performed as previously described, by calculation of PCR efficiency using linear regression in the window-of-linearity calculated from cycle number versus log(fluorescence) plots, followed by normalization of relative transcript starting concentration to that for HPRT. ^{17 20}  

Statistical Analysis

For each AMP expressed, the levels in different sample types were compared by Kruskal-Wallis test (i.e., not assuming Gaussian distribution) with posttest Dunn multiple-comparison test, only when significance (P < 0.05) was shown. 

Results

PCR Analysis of Ocular Expression of Known AMPs

PCR reactions were performed with a set of 21 primer pairs (Table 2)on cDNA prepared from 15 limbal explant cultures, 13 conjunctival impression cytology filters, 9 corneal impression cytology filters, and 6 corneal epithelial cell preparations. cDNA synthesis quality was assessed with primers to HPRT, and only samples showing positive amplification of HPRT were analyzed further. Expression of hBD1 and -2 was detected in all ocular samples analyzed (Figs. 1 2) . Product for hBD3 was present in all cultured cell samples tested (7/9 corneal filter samples and 4/6 corneal epithelial preparations) but was present in only 5 of 13 conjunctival filter samples (Fig. 2) . Whereas product for hBD4 was present in the majority (13/15) of cultured cell samples tested, it was not detected as frequently in any of the other sample types. Products for liver expressed antimicrobial peptide (LEAP)-1, LEAP2, and cathelicidin (LL37) were present in the majority of cultured cell samples tested (14/15 for each AMP), but were also detected frequently in the other sample types tested (Fig. 2) . Dermcidin expression was detected in only a single corneal filter sample. 

PCR Analysis of Ocular Expression of Putative Novel β-Defensins

PCR analysis was performed to assess expression of 13 putative novel β-defensin genes (DEFB105-DEFB129; Table 2 ) in ocular surface tissue. These genes were identified in the human genome as potentially capable of producing β-defensin-like antimicrobials. ²¹ PCR primers were made only for those genes whose genomic structure had been defined and had been identified in expressed sequence tag (EST) libraries. As most of them had been identified in EST libraries derived from human testes, ²² a commercial testes cDNA library was used as a positive control. 

PCR products for the 13 putative defensins were not detected in any of the 43 ocular surface samples tested (Fig. 1) . Products for 13 of 20 AMPs were amplified from testes cDNA (Fig. 1) . There was no evidence for expression of hBD1 and -2 in testes, but products for hBD3, hBD4, LEAP1, LEAP2, and cathelicidin (LL37) were present. Expression of 8 of the 13 putative β-defensins was also detected (Fig. 1) . 

Real-Time PCR Analysis of AMPs

Real-time PCR analysis was performed for 40 cycles for all 43 ocular samples, with only those primer sets (hBD1-4, LEAP1, LEAP2, LL37, and dermcidin) that had given one or more positive results for the samples by conventional PCR. Commercial testes cDNA and cDNA prepared from inflamed tonsil tissue were used as positive controls. Specificity of products was determined by agarose gel electrophoresis and dissociation data. ¹⁸ When products were not specific, normalized threshold cycles (C _t) were discounted from later analysis. A greater normalized C _t corresponds to a higher relative level of expression. 

The highest normalized expression levels were for hBD1, -2, and -3 and LEAP2 (Fig. 3) . Expression of hBD4 was detected in 13 to 15 culture samples, but at a relatively low level. Statistically significant differences in expression were detected for LEAP1 (conjunctival filter versus corneal epithelium; P = 0.0040, conjunctival filter versus culture; P = 0.0011), LEAP2 (conjunctival filter versus culture; P = 0.0013, corneal filter versus culture; P = 0.0052) and cathelicidin (LL37) (corneal filter versus culture; P = 0.0006, corneal epithelium versus culture; P = 0.0035). 

Effects of Infection on Ocular Expression of AMPs

Several of the conjunctival and corneal filter samples were obtained from patients known to have ocular surface clinical infections at the time of sampling (Table 1) . Comparative analysis of data between those samples from an infected source and those from a noninfected source indicated that the number of samples expressing each antimicrobial was largely unaffected by infection, with the exception of hBD3 (Fig. 4) . It was detected in four of five infected compared with one of eight noninfected conjunctival samples and four of four infected compared with three of five noninfected corneal samples (significant by χ² test; P = 0.0149). 

Analysis of expression levels of AMPs in the conjunctival and corneal filter samples showed that expression was essentially unaltered by infection (Fig. 5) . Although average levels of expression typically increased with each of the antimicrobials tested, there were no statistically significant differences detected between any of the data sets for infected or noninfected samples. 

Discussion

The innate immune system plays a key role in the protection of mucosal surfaces from pathogen attack. AMPs are a significant element in this protection, but to our knowledge, a detailed survey of the antimicrobial agents present at a mucosal site has not been published to date. Such a survey is an essential prerequisite to the assessment of the synergistic interactions between the antimicrobial agents present. ^{11 14} The AMPs hBD1, -2, and -3 have been described at the surface of the eye, ^{4 5 6 7 23 24 25} and the antimicrobial agents present in the lacrimal secretions are relatively well defined. ^{2 26 27} In this study, PCR and real-time PCR have been used to characterize fully the spectrum of AMP RNA expressed by the epithelia at the ocular surface. 

Previous studies have shown that hBD1 and -2 are expressed in most samples of human cornea and conjunctiva. ^{4 5 6 7} In all the ocular surface samples analyzed in this study, hBD1 and -2 were detected by both conventional PCR and by real-time PCR. In contrast, in one previous study, hBD2 expression was detected only in the conjunctiva from subjects with dry eye disease ²⁵ and in another study was detected in only two of eight samples of cornea analyzed. ²³ Epithelial cell expression of hBD1 is reported to be constitutive, ^{28 29 30} whereas that of hBD2 is inducible. ³¹ Indeed, McDermott et al. ^{23 24} have demonstrated increased corneal expression of hBD2 in response to IL-1β stimulation and during epithelial cell growth in vitro. Despite the differences in hBD2 expression reported, it is clear that both the corneal and conjunctival epithelia can produce hBD1 and -2. 

The ocular expression of hBD3 has been described in only two previous studies, in which it was described in all conjunctival samples ²⁵ and five of eight corneal samples studied. ²³ We have similarly detected expression of hBD3 in both corneal and conjunctival samples, with hBD3 detected in more samples from cornea than conjunctiva. Expression of hBD3 was detected in all the corneal epithelial cultures; however, these cells are maintained in a highly stimulatory growth medium, ³² and so it is not possible to determine whether the increased expression of hBD3 is an effect of the stimulatory culture conditions or in response to epithelial cell growth. Although Narayanan et al. ²⁵ argued that expression of hBD3 is constitutive in the conjunctiva, this notion was based on data derived from cultured cells rather than direct analysis of ex vivo tissue. We have also provided evidence that hBD3 expression is inducible in ocular surface epithelial cells; hBD3 expression was detected in a greater percentage of corneal and conjunctival samples from infected patients than in those from control subjects and noninfected patients, although the actual level of expression did not increased significantly. In conclusion, although the control of expression is debated, hBD3 is nevertheless present in many ocular surface epithelial samples. 

In contrast to hBD3, no previous studies of the ocular surface have included analysis of hBD4 expression. hBD4 was detected in only a single conjunctival sample derived from impression cytology, from two corneal epithelium samples, but from most of the corneal epithelial cultures. The protocol adopted for obtaining impression cytology samples with a filter paper avoids any contamination between conjunctival and corneal epithelium. Impression cytology picks up only the top two or three layers of cells from the patients’ eye, but the cadaveric samples included all the layers of the epithelium. It is possible that the basal epithelial layer accounts for the difference in hBD4 expression observed. Postmortem changes in cadaveric corneas could also have induced expression of hBD4. It therefore appears that the expression of this AMP is not typical at the ocular surface, but that expression can be induced in certain circumstances mimicked by the conditions required for the culture of corneal epithelial cells. A systematic study of the synergistic interactions of antimicrobial agents would therefore necessitate comparison of antimicrobial efficacy in both the presence and absence of hBD4. 

The β-defensin family extends beyond the studied members, hBD1 to -4. A hidden Markov model search of the human genome identified 28 novel β-defensin-like genes, many of which were also present in EST libraries, suggesting functional expression. ^{21 33} Primers were designed to amplify some of these novel defensins (primers DEFB105 to -129; Table 2 ), depending on whether the intron–exon structure of the gene was positively identified and they had been described in EST libraries. In this study, no expression of any of these proposed β-defensins was detected in the ocular epithelial samples analyzed. In the original description of the proposed β-defensins, several genes have been described in testis EST libraries. ²² PCR reactions using a human testis cDNA library were therefore used as a positive control for assessment of primer efficiency. Products were detected in testis for 8 of the 13 proposed β-defensins tested. This indicated that, for these products at least, there was no expression of the proposed β-defensins at the ocular surface. These results also confirm those in previous studies, suggesting a unique range of AMPs in the testes and epididymis, ^{34 35} with several of the proposed β-defensins present in the apparent absence of hBD1 and -2. 

The β-defensins are not the only AMPs present in the human genome. The related α-defensins are expressed in neutrophils (α-defensin-1 to -4) and intestinal Paneth cells (α-defensin-5 and -6). ^{8 9} Neutrophil degranulation as a result of active inflammation at the ocular surface would be expected to result in the presence of α-defensin-1 to -4 and azurocidin/CAP37, ³⁶ and these were therefore not included in this study. Indeed, there is evidence of a low level of polymorphonuclear neutrophil (PMN) activation at the ocular surface in the absence of clinical infection, especially when the eyes have been closed for a period during sleep. ^{2 26 37} The cathelicidins form a major family of AMPs in ruminants, but only one (variously referred to as human cathelicidin, FALL39, LL37, h-CAP18) has been described in humans. ^{38 39} The expression of this peptide had not been described in epithelial cells at the ocular surface, although there is a preliminary report of its identification by mass spectrometry in the tear film. ² In this study, LL37 mRNA expression was detected in most of the ocular surface epithelial samples analyzed. The blood-borne antimicrobials LEAP1 (hepcidin) and -2 were both originally identified in the liver. ^{40 41} Their expression had not previously been described at the ocular surface; expression was detected in the most of the corneal and conjunctival samples. Dermcidin is a constitutively expressed broad-spectrum AMP, originally described in the secretions of sweat glands. ⁴² It was detected in only a single ocular surface sample, an impression cytology filter from cornea, and does not therefore appear to play a significant role in the protection of the ocular surface. 

The antimicrobial activity at the surface of the eye is not solely dependent on the epithelial-cell–derived AMPs. The aqueous secretions of the lacrimal glands are known to include several antimicrobial species, including lactoferrin, lysozyme, and lipocalin-1, in addition to secretory antibodies. Lacrimal material was not analyzed in this study, but previous studies have shown that AMPs are present in both the lacrimal gland and tears. ^{2 4 5 27 43} The results of this study indicate that the spectrum of antimicrobial species present at the ocular surface includes the seven AMPs produced by the epithelial cells, the antimicrobial activities from the lacrimal secretions, and the potential presence of α-defensin-1 to -4 and azurocidin derived from degranulating neutrophils. To our knowledge, this is the first attempt to define fully the repertoire of antimicrobial activities present at a mucosal site. 

The detection of AMP protein expression is not straightforward. The results described in this study have been obtained exclusively with PCR, as antibodies to most of the AMPs are currently unavailable. Although it is therefore uncertain whether these peptides are actually produced, other studies have identified the protein products of AMPs at the ocular surface. ² Despite this supporting evidence, detection of protein production would be necessary to prove the synthesis of the other peptides at the ocular surface. This would also provide evidence indicating the relative levels of AMPs present, information that cannot be derived by PCR data, whether quantitative or not. With the paucity of antibodies available for detection of AMPs, further mass spectrometric analysis of tear fluid would be a feasible alternative methodology, as the peptides are short and therefore amenable to direct mass spectrometric detection. 

AMPs are microbicidal at micromolar concentrations, interacting with the negatively charged surface of the microbe. ¹¹ The exact mechanism of action has yet to be defined, but it is thought that disruption of the integrity of the microbial membrane leads to osmotic imbalance and subsequently death. ^{8 11} With the exception of hBD3, AMPs are typically reported to be sensitive to salt concentration, with most showing reduced killing activity in high-salt medium. ⁸ This finding appears to be anomalous, as the majority of mucosal surfaces are moist, and this liquid film is typically at physiological salt concentrations at which many AMPs lose their antimicrobial activity, which suggests that either the principle role of AMPs is not antimicrobial, but as intercellular signaling molecules, ^{12 13} or that the full function of AMPs is not apparent when they are studied in isolation. ^{11 14} Synergy between AMPs has also been hypothesized to explain why so many peptides exist and why the extraordinary diversity in activities occurs. ^{11 14} Synergy has been noted between lysozyme and lactoferrin, ^{44 45} and these in turn are reported to act synergistically with hBD2. ⁴⁶ Previous studies of the activities of antimicrobial agents against known ocular pathogens have assessed the activity of AMPs in isolation or in pairs. ^{47 48} However, to assess the full potential of synergistic interactions, it is first necessary to define the spectrum of the antimicrobial activities present. 

These data will enable detailed studies of synergistic interactions between these innate yet highly important antimicrobial agents to proceed. Furthermore, this research has significant implications both for the understanding of the normal homeostasis of mucosal surfaces, such as that of the eye, and for future pharmacological antimicrobial and anti-inflammatory therapies. 

 Supported by Grant Ha00303-OR2002-18d from the Guide Dogs for the Blind Association.

 Submitted for publication May 27, 2004; revised November 1, 2004; accepted November 9, 2004.

 Disclosure: R.S. McIntosh, None; J.E. Cade, None; M. Al-Abed, None; V. Shanmuganathan, None; R. Gupta, None; A. Bhan, None; P.J. Tighe, None; H.S. Dua, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Details of Infected Patient and Control Impression Cytology Filter Sample

Type	Total (n)	Mean Age (y)	Age Range	M/F (n)
Conjunctiva
Control	8	66.8	52–87	4/4
Infected	5	64.4	37–77	3/2
Total	13			7/6
Corneal
Control	5	65.4	49–79	3/2
Infected	4	70.8	64–77	3/1
Total	9			6/3

Table 2.

 

Details of Antimicrobial Peptide PCR Primer Nucleotide Sequences

Target	Primer Sequence	Product Size (bp)
HPRT	GACCAGTCAACAGGGGACAT	160
	CGACCTTGACCATCTTTGGA
HBD1	GCCTCCAAAGGAGCCAGCCT	215
	CTTCTGGTCACTCCCAGCTCA
HBD2	CAGCCATCAGCCATGAGG	204
	TGGCTTTTTGCAGCATTTT
HBD3	AGCCTAGCAGCTATGAGGATC	205
	CTTCGGCAGCATTTTCGGCCA
HBD4	TTGTGCTGCTATTAGCCGTTT	160
	CTGTATTCTTGGCTGCGACA
LEAP1	CAGACAGACGGCACGATG	127
	GCAGCTCTGCAAGTTGTCC
LEAP2	TCCCTCAGGCCTATTGGAG	137
	GGAGGTGACTGCTGTCCTTT
LL37	CAGGACGACACAGCAGTCAC	145
	CAGCAGGGCAAATCTCTTGT
Dermcidin	CCAAGGAAGCAGAGATCCAG	201
	TGCTGCTCCTGGGTATCATT
DEFB105	TGTTCTTCATTTTGGTTCAACTG	170
	GTTCAGCCTGCAATTTCCAT
DEFB107	TTTGGCTGCTCTCATTCTTC	161
	TGCAGCAAAATGGTGCTAA
DEFB108	TGCTGTCCTCTTCTTCACCA	159
	CAGCAGGGTCGGCTATTTA
DEFB118	GGCTCTTCCTATGCTTGTGC	205
	ACTCAAGGGTGTGGGAGATG
DEFB119	GTCTGCCAGCCATGAAACTT	220
	TCCTCTTTGCCAGAAATGCT
DEFB120	GTTTCTTGCCATCCTTCTGG	211
	TGTGGACATCTGAGGAGTGG
DEFB121	CCACACAGCACTTAGCCTCA	249
	TTGAAGATCACGGTGAGCAG
DEFB122	AGCTGAGCCTTGGAATTCTG	215
	TGGTAAATGTGGCTGGTCCT
DEFB123	TTGACTGTGCTGCTGCTCTT	182
	TAAAATGGCCACCACCTTTC
DEFB125	TTATCTGTGGGTTGCTAACTCG	191
	CACAGGAAATGCTGGTCGT
DEFB126	TCCCTACTGTTCACCCTTGC	182
	TCAGCTGGAACACAGCAGTC
DEFB127	TGCAATTCTGCTGTTCCAGA	269
	GTGTCTTCAGGCTTGGGAAA
DEFB129	TTTGCCAGCCTCATGCTAC	293
	TTTGATTTGGGGGAGAACAG

Figure 1.

 

Example of PCR amplification for AMPs expressed at the ocular surface. PCR reactions were performed for 38 cycles with cDNA derived from (top) corneal epithelial cells isolated on an impression cytology filter and (bottom) a commercial human testes cDNA library. Samples were amplified with primers targeted to HPRT (lane 1); β-defensin-1 to -4 (lanes 2–5); dermcidin (lane 6); LEAP1 and -2 (lanes 7 and 8), cathelicidin (LL37; lane 9); and DEFB105, -107, -108, -118, -119, -120, -121, -123, -125, -126, -127, and -129 (lanes 10–21). Lane M: molecular weight markers.

Figure 2.

 

Expression of AMPs at the ocular surface. Expression of AMPs was assessed with PCR and real-time PCR on cDNA derived from cultured limbal explants (culture), conjunctival epithelial cells from impression cytology filters (Filter/conj.), corneal epithelial cells from impression cytology filters (Filter/cornea), and corneal epithelium (Epithelium). Samples were amplified with primers targeted to β-defensin-1 to -4 (BD1 to -4), LEAP1 and -2, cathelicidin (LL37), and dermcidin. The percentage of each sample type that expressed each AMP tested is shown.

Figure 3.

 

Expression levels of AMPs at the ocular surface. Relative expression of β-defensin-1 (A), -2 (B), -3 (C), -4 (D); LEAP1 (E) and -2 (F); LL37 (G); and dermcidin (H) was assessed by real-time PCR with cDNA derived from conjunctival epithelial cells (FCJ) and corneal epithelial cells (FCO) from impression cytology filters, corneal epithelium (E), and cultured limbal explants (CEC). For PCR-positive samples, relative expression was normalized to an internal standard (HPRT). Horizontal lines: mean expression levels of positively amplified samples.

Figure 4.

 

Effect of infection on expression of AMPs at the ocular surface. Expression of AMPs was assessed by using PCR and real-time PCR on cDNA derived from (A) conjunctival and (B) corneal epithelial cells, both from impression cytology filters. Samples were divided into those from patients with known clinical infections at the time of sampling and noninfected patients and control subjects and were amplified with primers targeted to β-defensin-1 to -4 (BD1 to -4); LEAP1 and -2, cathelicidin (LL37), and dermcidin. The percentage of each sample type that expressed each AMP tested is shown.

Figure 5.

 

Effect of infection on expression levels of AMPs at the ocular surface. Expression of AMPs was assessed using real-time PCR on cDNA derived from impression cytology filters of (A) conjunctival epithelial cells and (B) corneal epithelial cells. Samples were divided into those from noninfected patients and control subjects (uninfected) and those from patients with known clinical infections at the time of sampling (Infected). For PCR-positive samples, relative expression is shown normalized to an internal standard (HPRT). Horizontal lines: mean expression level for positively amplified samples for each sample type. Samples were amplified with primers targeted to β-defensin-1 to -4 (hBD-1 to -4), LEAP1 and -2, cathelicidin (LL37), and dermcidin. Data sets are not shown when no specific products were amplified