Posterior Polymorphous Corneal Dystrophy in Czech Families Maps to Chromosome 20 and Excludes the VSX1 Gene

Abstract

purpose. Posterior polymorphous corneal dystrophy (PPCD) is an autosomal dominant disorder, affecting both the corneal endothelium and Descemet’s membrane. In the Czech Republic, PPCD is one of the most prevalent corneal dystrophies. The purpose of this study was to determine the chromosomal locus of PPCD in two large Czech families, by using linkage analysis.

methods. Linkage analysis was performed on 52 members of two Czech families with PPCD and polymorphic microsatellite markers and lod scores were calculated. The candidate gene VSX1 was also screened for mutations.

results. Significant lod scores were obtained with microsatellite markers on chromosome 20. Linkage analysis delineated the Czech PPCD locus to a 2.7-cM locus on chromosome 20, region p11.2, between flanking markers D20S48 and D20S139, which excluded VSX1 as the disease-causing gene in both families. In addition, the exclusion of VSX1 was confirmed by sequence analysis.

conclusions. This study reports the localization of PPCD in patients of Czech origin to chromosome 20 at p11.2. Linkage data and sequence analysis exclude VSX1 as causative of PPCD in two Czech families. This refined locus for PPCD overlaps the congenital hereditary endothelial dystrophy (CHED1) disease interval, and it is possible that these corneal dystrophies are allelic.

The corneal endothelium is the innermost layer of the cornea responsible for the maintenance of the osmotic balance of the cornea. A compromised function can result in edema, loss of transparency, and hence a decrease in visual acuity. Corneal dystrophies represent a heterogeneous group of inherited eye disorders, with three major corneal endothelial dystrophies described: Fuchs’ endothelial dystrophy (FECD, Online Mendelian Inheritance in Man [OMIM] 136800; http://www.ncbi.nlm.nih.gov/Omim/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), posterior polymorphous corneal dystrophy (PPCD; OMIM 122000), and congenital hereditary endothelial dystrophy (autosomal dominant CHED1; OMIM 121700, autosomal recessive CHED2; OMIM 217700). 

PPCD is a rare bilateral disorder, affecting both the corneal endothelium and Descemet’s membrane, which is inherited as an autosomal dominant trait. ^{1 2 3 4} PPCD is usually a nonprogressive disorder that does not severely affect vision. ^{4 5 6} On slit lamp examination PPCD is characterized by bilateral endothelial bands, vesicles, and polymorphous opacities at the level of Descemet’s membrane and endothelium ⁷ that can be accompanied by iridocorneal peripheral adhesions, iris atrophy, and corectopia. ^{4 8} The major morphologic change identified is the proliferation of epithelial-like cells, resulting in replacement of the hexagonal corneal endothelial cells. ^{9 10 11 12} Although PPCD is generally considered to be a rare disease, with affected patients largely asymptomatic, in the Czech Republic, PPCD is one of the most frequently occurring corneal dystrophies, often presenting with a severe phenotype, with a high percentage including secondary glaucoma and necessitating keratoplasty. ¹³ Several chromosomal loci for PPCD, CHED, and FECD have been reported. ^{14 15 16 17 18 19} The first localization of PPCD was to a 30-cM region spanning the centromere on chromosome 20 flanked by markers D20S98 and D20S108 (Fig. 1) . ¹⁴ Subsequently, CHED1 was mapped to an overlapping pericentromeric region on chromosome 20, between the markers D20S48 and D20S471, which suggests that these diseases may be allelic. ¹⁵  

Heon et al. ²⁰ identified mutations in visual system homeobox gene 1 (VSX1), a novel human paired-like homeodomain transcription factor ^{21 22} in patients with PPCD and keratoconus. 

The genetic heterogeneity of PPCD was exemplified by the mapping of a family with early-onset FECD to chromosome 1 at p34.3-p32 and the identification of mutations within the COL8A2 gene in patients with PPCD or FECD. ¹⁸ More recently, a large American family with PPCD was mapped to chromosome 10, further demonstrating the genetic heterogeneity of this disorder. ¹⁹  

In this study, we showed segregation of PPCD on chromosome 20p11.2 in two large Czech families with PPCD. Haplotype analysis refined the PPCD locus to a 2.7-cM interval, similar to that described for CHED1. Our linkage analysis excluded VSX1 as the causative gene for PPCD in two Czech families. 

Methods

Patients

The study had the approval of the Ethics Committee of General Teaching Hospital and 1st Medical Faculty of Charles University (Prague, Czech Republic) and adhered to the tenets of the Declaration of Helsinki. Informed consent was obtained from all participating subjects. The diagnosis of PPCD was based on family history, slit lamp examination, specular microscopy, and the presence of characteristic changes in the corneal endothelium of both eyes of the patients. 

In family I, blood samples for linkage analysis were obtained from 14 affected members, 7 unaffected first-degree relatives, and 5 spouses. In family II, blood samples were obtained from 14 affected members, 7 unaffected first-degree relatives, and 5 spouses. 

DNA was extracted from peripheral blood leukocytes using a DNA genomic DNA extraction kit (Nucleon III BACC3), according to the manufacturer’s instructions (GE Healthcare, Amersham, UK). 

Seven commercially available polymorphic microsatellite markers (D20S98, D20S114, D20S48, D20S605, D20S182, D20S139, and D20S106) and a novel dinucleotide marker (M189K21), designed from the chromosome 20 genomic sequence, were amplified by polymerase chain reaction (PCR; Table 1 ). Amplification was performed in 25-μL reaction volumes. Forty-nine individuals were genotyped for these markers. Alleles were sized on computer (Genescan and Genotyper software; analyzed on the Prism 3100 Genetic Analyzer; Applied Biosystems, Foster City, CA). Two-point lod scores were calculated between polymorphic markers and PPCD, with the program MLINK (a program of the LINKAGE package available at http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK) under the assumption of a dominant mode of inheritance and 0.001 frequency of the disease allele. Because of the variable expressivity of the disease phenotype, only affected individuals, obligate carriers, and spouses were included in the lod score calculation (Table 2) . 

Mutation screening of the five VSX1 coding exons was performed in all individuals from the two families using 50-ng template DNA, 50 picomoles of gene-specific primers, as previously described ²⁰ and 2.5 U Taq DNA polymerase (AmpliTaq; Applied Biosystems). The sequencing reaction was performed with dye-termination chemistry (Prism BigDye Terminator Cycle sequencing kit and the model n3700 DNA sequencing system; Applied Biosystems). 

Results

Clinical ascertainment demonstrated strikingly similar phenotypes between the two families with a high degree of intrafamilial phenotypic variability with some members being mildly affected. 

In family I (Fig. 2A) , 36 family members were examined Of these, 15 were found to be affected (5 male, 10 female). Four patients in this family showed signs of secondary glaucoma, and five had undergone corneal graft surgery (three bilateral). Although in family II (Fig. 2B) , 64 family members were examined, and only 16 were found to have PPCD (7 male, 9 female), seven patients had secondary glaucoma, and four underwent corneal graft surgery (two bilateral). The changes found on slit lamp examination in affected members of both families included pathologic endothelium, geographic lesions, vesicles, and polymorphous opacities at the level of Descemet’s membrane and the endothelium. Some family members exhibited corneal edema, band keratopathy, iridocorneal peripheral adhesions, iris atrophy, pupillary ectropion, and corectopia. The visual acuity in affected members in both families ranged from 1.0 to no light perception. 

Linkage analysis demonstrated that the disease-causing gene mapped to 20p11.2 in the two families tested. All five exons of the VSX1 gene were analyzed in the two families, and no sequence alterations were detected in affected individuals. The P247R change previously described by Heon et al. ²⁰ was observed in one branch of family I in an unaffected mother (III:14) and son (IV:11). Recombination events with the marker D20S106 were observed in both families, excluding VSX1 as the causative gene (Figs. 1 3) . In family I, the maximum lod score obtained was 5.09 with marker D20S139 at recombination fraction θ = 0 (Table 2) . Recombination with the marker D20S139 was detected in family II, refining the proximal crossover (Fig. 3B) . In family II, a distal crossover was seen with marker D20S48 (Fig. 3B) , and the maximum lod score was 3.22 with marker D20S605 at recombination fraction θ = 0 (Table 2) . As both families share a common phenotype and haplotype (Fig. 3) , it is likely that they are ancestrally related, and it is therefore possible to combine the lod scores of each family. For novel marker M189K21, the combined two-point lod score would be 6.557 at recombination fraction θ = 0 (Table 2) . Assuming that the two families are ancestrally related, the critical interval for Czech PPCD is delineated by the markers D20S48 and D20S139, spanning 2.7 cM (Figs. 1 3) . 

Discussion

Corneal dystrophies are generally considered to be rare diseases. However, 87 patients with PPCD were identified in the Department of Ophthalmology in Prague, and they represent the largest cohort of patients reported thus far. ¹³ The phenotype of Czech patients with PPCD is very severe, with variable expressivity. The disease is characterized by a high percentage of secondary glaucoma, which was present in 35% of patients, whereas 29% required corneal graft surgery (Letko E, et al. IOVS 1998;39:ARVO Abstract 382; Liskova P, et al. IOVS 2003;44:ARVO E-Abstract 4363). It is noteworthy that a French-Canadian family reported by Heon et al., ¹⁴ showed a high percentage of secondary glaucoma (42%) and corneal grafts (33%). 

In our study, linkage was found to chromosome 20, region p11.2, in both families. These families originate from the same region of Bohemia within the Czech Republic and it is likely that they have a common founder, as they share a similar haplotype (Fig. 3) . 

VSX1 was considered a candidate gene as mutations have been associated with several abnormalities, including craniofacial anomalies; abnormal retinal and auditory bipolar cells ²³ ; PPCD; and keratoconus. ^{20 24} VSX1 was excluded by both sequence analysis and recombination events. The previously described P247R change was observed in unaffected individuals from a branch of family I and therefore does not segregate with disease. This result was not surprising, because this sequence variation has been described in control, unaffected chromosomes. ²⁰ Recently, Aldave ²⁵ has questioned the validity of screening VSX1 in all patients with CHED, PPCD, and keratoconus. ²⁵ The exclusion of VSX1 in our Czech patients with PPCD supports the conclusions of Aldave et al. ²⁶ and indicates that VSX1 may not be a common cause of corneal endothelial dystrophies. 

The genetic and phenotypic heterogeneity of PPCD has been reported with three different loci. ^{14 18 19} This study demonstrates the localization of PPCD in patients of Czech origin to chromosome 20 at p11.2, flanked by the markers D20S48 and D20S139, spanning an interval of 2.7 cM. Our refined critical interval for PPCD has the same distal flanking marker as the CHED1 locus, raising the possibility that these two corneal dystrophies are allelic. If they are indeed allelic, our data potentially reduce the critical interval by 20 kb. There are currently 20 annotated candidate genes within the shared disease interval for CHED1 and Czech PPCD. 

We have localized the disease interval for PPCD in two large Czech families to 20p11.2 and excluded VSX1 as a candidate gene. Therefore, the disease-causing gene in Czech PPCD remains to be identified. 

²  Contributed equally to the work and therefore should be considered equivalent authors.

 Supported by the Medical Research Council (RG); Grant Agency of the Czech Republic Grant GA-CR301/03/1040, The Charles University Mobility Fund, and The Ulverscroft Foundation (PL); Grant VZ 206 1011, Ministry of Education of the Czech Republic (MF, KJ, SK); and The Wellcome Trust (EJH, CLS, PD).

 Submitted for publication March 2, 2005; revised June 23, 2005; accepted October 17, 2005.

 Disclosure: R. Gwilliam, None; P. Liskova, None; M. Filipec, None; S. Kmoch, None; K. Jirsova, None; E.J. Huckle, None; C.L. Stables, None; S.S. Bhattacharya, None; A. J. Hardcastle, None; P. Deloukas, None; N. D. Ebenezer, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Figure 1.

 

Ideogram of chromosome 20 showing the PPCD and CHED loci. Markers highlighted in bold represent the minimum common haplotype region.

Table 1.

 

Polymorphic Microsatellite Markers Used for Genotype Analysis of Czech Families with PPCD

Marker	Label	Size (bp)	Alternative Marker Name
D20S98	FAM	259-275	AFM044XB4
D20S114	HEX	253-269	AFM210VB4
D20S48	FAM	200	IP20M12
D20S605	FAM	117	CHLC GATA83F12
D20S182	HEX	197-211	AFM242YF8
M189K21	NED	316	Forward primer: GAATTCATTGCTAGCAAATCTACC
			Reverse primer: CCTTCTTTGTGTTGTTATTGGTC
D20S139	FAM	138	C19(CA)
D20S106	FAM	316-332	AFM123YF8

 Markers are listed according to their chromosomal positions.

Table 2.

 

Two-Point Lod Scores for Linkage between PCD and Microsatellite Markers on Chromosome 20

Locus	Recombination Fraction
		0.00	0.05	0.10	0.20	0.30	0.40
Family I
D20S98	1.509	1.360	1.200	0.870	0.549	0.258
D20S114	5.032	4.554	4.058	3.012	1.901	0.785
D20S48	3.034	2.846	2.596	1.985	1.279	0.537
D20S605	2.273	2.048	1.812	1.326	0.836	0.377
D20S182	0.384	0.318	0.257	0.148	0.066	0.016
M189K21	3.827	3.419	3.002	2.152	1.313	0.556
D20S139	5.090	4.644	4.178	3.184	2.103	0.949
D20S106	−∞	0.540	0.631	0.532	0.343	0.153
Family II
D20S98	−∞	1.275	1.273	0.984	0.617	0.274
D20S114	−∞	2.250	2.182	1.710	1.089	0.472
D20S48	−∞	1.169	1.451	1.368	1.004	0.533
D20S605	3.216	2.872	2.520	1.795	1.074	0.443
D20S182	1.483	1.323	1.150	0.793	0.458	0.186
M189K21	2.730	2.510	2.267	1.729	1.159	0.588
D20S139	−∞	1.011	1.326	1.304	0.985	0.537
D20S106	−∞	0.601	0.924	0.936	0.668	0.317

Figure 2.

 

Pedigrees of Czech families I (A) and II (B), who participated in the study.

Figure 3.

 

Segregation of a common haplotype between families I (A) and II (B). Data from the eight polymorphic microsatellite markers are in the order shown.

The authors thank the patients who kindly agreed to take part in the study.