Advantages of Using Mitochondrial 16S rDNA Sequences to Classify Clinical Isolates of Acanthamoeba

Abstract

purpose. This work was intended to test the classification of Acanthamoeba into genotypes based on nuclear ribosomal RNA gene (18S rDNA, Rns) sequences. Nearly all Acanthamoeba keratitis (AK) isolates are genotype RnsT4. This marked phylogenetic localization is presumably either due to an innate potential for pathogenicity or to a peculiarity of the gene sequences used. To differentiate between these possibilities, relationships among isolates have been reexamined, using a second gene.

methods. Phylogenetic relationships among isolates of Acanthamoeba were studied, using sequences of the mitochondrial small subunit ribosomal RNA gene (16S rDNA; rns). Genotypes based on complete sequences of approximately 1540 bp were determined for 68 strains, by using multiple phylogenetic analyses.

results. Each strain’s mitochondria contained a single intron-free rns sequence (allele). The 68 strains had 35 different sequences. Twenty-eight strains had unique sequences, and 40 strains each shared one of the seven remaining sequences. Eleven mitochondrial rns genotypes corresponding to 11 of 12 previously described nuclear Rns genotypes were identified. Genotype rnsT4 was subdivided into eight distinct clades, with seven including Acanthamoeba keratitis (AK) isolates.

conclusions. The phylogenetic clustering of AK isolates was confirmed and thus is not specific to the nuclear gene. Rns and rns sequences are both suitable for genotyping of Acanthamoeba. However, the mitochondrial sequences are shorter and more consistent in length, have a higher percentage of alignable bases for sequence comparisons, and have none of the complications caused by multiple alleles or introns, which are occasionally found in Rns. In addition, the more common occurrence of strains with identical rns sequences simplifies identification and clustering of isolates.

Amoebae belonging to the genus Acanthamoeba have a worldwide distribution and inhabit a wide variety of environmental niches. They have been isolated from soil, fresh- and saltwater, air, humans, and various domestic and feral animals. ^{1 2} Until relatively recently, identification and classification of acanthamoebae involved in human diseases, including the sight-threatening eye infection Acanthamoeba keratitis (AK) and other often fatal infections, depended on morphologic or molecular characters that have been difficult to interpret. ^{2 3 4} However, the introduction of DNA typing has made it possible to characterize isolates on the basis of more consistent and readily interpreted characters. Classification of specimens into genotypic clades based on phylogenetic analysis of the nuclear 18S ribosomal RNA gene (Rns or 18S rDNA) has been particularly useful in taxonomic and epidemiologic studies of this genus. That approach has identified a genotype clade, RnsT4, which contains most of the AK isolates. ^{5 6 7} It has been assumed that phylogenetic trees based on the Rns sequences represent the evolutionary history of the genus. If this is correct, then it is likely that strains with the RnsT4 genotype especially, but also to a lesser extent the Rns T3 and T11 genotypes, share an evolutionary adaptation that enhances their ability to infect the eye. Alternatively, if the genotype clusters identified using Rns are anomalies that unite more distantly related strains, multiple explanations for the pathogenicity are more likely. The former correlation also is important if the Rns phylogeny is to have any value in revisions of the confused Acanthamoeba taxonomy in a way that will be epidemiologically useful. The possibility that the Rns phylogeny also represents the history of the genus is best tested by comparison of Rns trees with those obtained using sequences of other genes. Thus, in this study we asked how trees based on the mitochondrial small subunit rRNA gene (rns or 16S rDNA) compared with the Rns trees. The rns gene was selected because it has a function comparable to that of Rns but is likely to be under different evolutionary constraints because it is located within a cell organelle other than the nucleus. We also have examined the relative advantages of using either the mitochondrial or the nuclear rDNA genes for classification, tracking strains, or differentiating between closely related isolates. 

Materials and Methods

Cultures

Table 1 1 summarizes the Acanthamoeba isolates/strains used in this study, including those from AK cases. All strains were grown axenically in 25 cm² canted-neck tissue culture flasks containing 5 mL of Neff’s optimal growth medium (OGM) at 30°C, as described previously. ²³ Approximately 1 × 10⁶ cells of Acanthamoeba were harvested from each flask as soon as a confluent monolayer was observed. However, much smaller populations also were used and produced sufficient DNA for PCR applications. 

Isolation, Amplification, and Sequencing of DNA

DNA was extracted as previously described, using a scaled-down version of the UNSET method or by using an extraction kit (DNeasy; Qiagen, Inc., Valencia, CA). ^{6 24} The final volume of extract was 30 μL in distilled water. Mitochondrial rns sequences were amplified by PCR using forward primers mt1 or tALA and reverse primer mt1541 (Table 2) . ²⁵ The primers were based on sequences of A. castellanii Neff. ²⁶ Primer mt1, designed for the 5′ end of the gene, did not work with some strains due to sequence variability sufficient to preclude amplification. In those cases, primer tALA (based on a conserved region in an alanine tRNA gene located upstream from rns) replaced mt1. One μL of whole-cell DNA extract was used for amplification of either complete or partial gene sequences. The PCR amplification program included 35 cycles of 1 minute at 94°C, 2 minutes at 45°C, and 3 minutes at 72°C. PCR products were cloned into PBSK+ (Stratagene, La Jolla, CA) or PCR II vector (Invitrogen, La Jolla, CA) to preserve the product for future reference. Internal primers were designed to sequence across the gene (Fig. 1 , Table 2 ). Initially, sequencing of either direct or cloned PCR products used direct double-stranded manual sequencing methods (ds Cycle Sequencing Kit; Gibco, Gaithersburg, MD). In direct sequencing of PCR products, multiple products were sequenced. The entire gene was sequenced, including more than 60% of the gene covered on both strands. In the cases in which the gene was cloned, the entire gene was sequenced in both directions. In later stages of the study, sequencing was performed with an automated fluorescent sequencing system (ABI 310; Applied Biosystems, Inc., Foster City, CA), using the same primers and a kit (ABI Prism BigDye Terminator Cycle Sequencing Kit; Applied Biosystems) according to the manufacturer’s protocols. 

Sequence Alignment and Phylogenetic Analysis

Sequences were aligned using ESEE and/or ClustalX. ^{27 28} Alignments were based on both primary sequence and secondary structure ²⁹ and are available from one of the authors (GCB; [email protected]). Twenty-two bases at the 5′ end and 19 bases at the 3′ end of the gene, which were determined by the primers, were excluded from the analysis. In the 68 sequences examined, 1312 sites (∼85% of the total number of sites) could be aligned unambiguously. Variation was at least ditypic at 236 sites, which therefore were considered phylogenetically informative. Distances were calculated from the aligned sequences in MEGA2.1 using the Kimura 2 parameter model. ³⁰ Phylogenetic gene trees were reconstructed in MEGA2.1 using maximum parsimony, neighbor-joining, and minimum evolution methods. Bootstrap analysis as a test of the reliability of the tree reconstruction was also performed in MEGA2.1. The trees were rooted with Balamuthia mandrillaris as an outgroup, because previous work in our laboratory on nuclear 18S rDNA showed that B. mandrillaris is closely related to the Acanthamoeba species. We have also obtained the mitochondrial 16S rDNA from a number of B. mandrillaris strains. ³¹ Analyses using the Balamuthia, Acanthamoeba, and mitochondrial 16S gene sequences from additional genera also support use of Balamuthia as an outgroup to Acanthamoeba species. The rns sequences obtained in this study have been deposited in GenBank (http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), and the accession numbers for each isolate are listed in Table 1 1 . 

Results

DNA Sequence Heterogeneity of rns

Sequences were obtained for the rns coding region from all 68 isolates of Acanthamoeba. The gene ranged from 1514 to 1578 bp in length and averaged approximately 1540 bp. There were 35 different rns sequences among the 68 isolates. This is a significantly lower level of variation than found in the Rns genes. Although many copies of rns are expected in each amoeba, presumably in proportion to the number of mitochondria, there was no evidence for more than one kind of rns allele in any isolate. Similarly, no introns were found in the rns from any of the isolates. The most variable regions of the rns were observed in seven of nine regions identified by Lonergan and Gray ³² as being variable among different organisms. These variable regions constituted approximately 27% of the gene. Less concentrated sequence variation also occurred throughout the remainder of the gene. Sequence dissimilarities of 16S rns between previously identified genotypes (based on 18S Rns analysis) are presented in Table 3 . These calculated dissimilarities are based on the aligned sequences (see Fig. 1 ) and represent 1312 nucleotides of the 1692-bp alignment. Dissimilarities based on the entire sequence alignment (1668 bp, which excludes the 5′ and 3′ ends determined by the amplification primers) are also shown, in parentheses, in Table 3 . Dissimilarities within genotypes (where multiple strains were available) are also presented in Table 3 in bold font. Dissimilarities (expressed as percentages) between genotypes based on the aligned region ranged from 2.2% (T7 versus T9) to 14.0% (T3 versus T8). In general, as found in our previous studies of nuclear 18S Rns, the species A. astronyxis (T7), A. tubiashi (T8), and A. comandoni (T9) were the most distant from the remainder of the Acanthamoeba genotypes, with rns dissimilarities ranging from 12% to 14% versus the remaining genotypes. However, the dissimilarities between these three morphologic group I genotypes (T7, -8, and -9) ranged from 2.2% to 2.8% and, thus, were much lower than observed for the nuclear gene. ⁵ Even when the whole alignment is used to calculate dissimilarities, the range between these three genotypes is only 4.3% to 5.0%. 

Phylogeny and Correlations between Genotypes and Species

Phylogenetic relationships among isolates were examined using maximum parsimony (M), neighbor joining (N), and minimum evolution (E) analyses. M analysis identified a major clade, designated genotype rnsT4, which included 53 different strains having 22 different rns sequences. Six of the 22 sequences found within T4a, b, d, f, and h, occurred in more than one strain (Fig. 2 , Table 4 ). The rnsT4 clade was supported with an M bootstrap value of 100% of 100 replicates. Sequence dissimilarities among T4 strains ranged from 0% to 3.2% for the alignment data set used for phylogenetic reconstruction (0%–7.9% across entire alignment). The rnsT4 clade had eight identifiable branches that we designate rnsT4a to rnsT4h. One branch included a single strain (rnsT4c). The rest of the branches included clades of 2 to 10 sequences and each was supported by M bootstrap values of 100. Five of these six clades were also supported in N and E analyses, with bootstrap values ranging from 84% to 100%. Only clade rnsT4f, which contained the two strains A. castellanii strain Neff (ATCC 50373) and A. castellanii strain Pussard 425 (ATCC 30134) and was supported with a 100% M, was not supported by bootstrapping using the other two methods. Two of these branches each contained a species type-strain. These were rnsT4a (A. castellanii), and rnsT4e (A. royreba). In addition, although the type-strain was not tested here, rnsT4h included nine strains, all identified as A. mauritaniensis based on sequence identity with the nuclear Rns sequence of the species type-strain. Ten additional branches corresponded to the previously described nuclear Rns genotypes T1 to T3, T5, and T7 to T12. Thus, the corresponding mitochondrial genotypes were designated rnsT1 to -T5 and rnsT7 to -T12. No strain from the genotype designated RnsT6 was available for the present study and, therefore, a T6 mitochondrial rns could not be determined. 

With the exception of rnsT1, which includes a single strain that has not been assigned a unique species name, most of the genotypes included a single species type-strain. When there was more than one type-strain, the strain with taxonomic precedence was identified. The resultant correlations between genotypes and type-strains based on the currently available data are as follows: rnsT2 (A. palestinensis type-strain Reich, ATCC 30870), rnsT3 (A. griffini type-strain S7, ATCC 30731), rnsT5 (A. lenticulata type-strain PD₂S, ATCC 30841), rnsT7 (A. astronyxis type-stain Ray and Hayes, ATCC 30137), rnsT8 (A. tubiashi type-strain OC-15C, ATCC 30867), rnsT9 (A. comandoni type-strain A1P, ATCC 30135), and rnsT12 (A. healyi type-strain V013, ATCC 30866). A. castellanii type-strain Castellani (ATCC 50374) is the type-strain for rnsT4, and it also is the genus type-strain. All these correlations are consistent with genotype clusters previously based on Rns sequences. ^{5 6} With the exception of the relative similarity of the morphologic group I species, the only other departure of the current rns data with the nuclear Rns data were the 4.4% sequence dissimilarity between genotypes T3 and T11 (Table 3) . In the Rns analysis, we used a 5% sequence dissimilarity value to distinguish genotypes. Based on that criterion T3 and T11 were designated separate genotypes with a sequence dissimilarity of more than 5%. Although the selection of the 5% sequence dissimilarity was subjective, using the same criteria in the current rns study, we would fail to distinguish between the T3 and T11 genotypes, because the sequence dissimilarity is less than 5%. However, it should be noted that in the Rns study T3, T4, and T11 were phylogenetically very closely related to one another, and the relationship between T3 and T11 was therefore not unexpected. In fact, it supports the results of the Rns study that suggested a close relationship between these three genotypes. 

Although there was very good agreement between the nuclear and mitochondrial rDNA trees in the distribution of isolates among the previously described genotypes, the same level of agreement was not seen in the distribution of isolates in clades within genotype T4. Because the T4 clades are distinguished with a higher level of significance in the rns tree compared to the Rns tree, and because two of the eight clades in this genotype are associated with single type-strains, these clades may serve as the best available molecular basis for differentiating among species within this genotype. A more conclusive position on this matter awaits determination of rns sequences from the remaining species type-strains for which sequences are not yet available. 

Discussion

Mitochondrial and Nuclear Small-Subunit rRNA Gene Phylogenies and the Genotype Trees

The similarity of the genotype clusters identified on the basis of sequences of both mitochondrial and nuclear small subunit rRNA genes suggests that they represent the main branches in the phylogeny of the genus. There are minor differences in the branching orders in the various phylogenetic analyses, but the major clades are remarkably consistent. The dissimilarity of only 4.4% in the rns tree (Table 3) between strains classified previously as T3 and T11 in nuclear Rns trees is not surprising. The dissimilarity between these genotypes was only 5.6% to 6.6% in the Rns trees, and the 5% cutoff point we have used for genotypes is arbitrary. ⁵ It remains to be determined whether there are any other characteristics that justify the distinction between T3 and T11 strains. In every other case where both Rns and rns sequences were available, isolates are assigned to the same genotype cluster by either gene sequence, although placement on different branches within a genotype has been observed. This becomes important only if these branches become useful as stable taxonomic units. At the present time, this appears to be a viable possibility, because species type-strains from 9 of the more than 20 described species correlate with individual genotypes or clades within genotypes. Sequences from the remainder of the species type-strains are currently being studied (Booton GC, Kelly DJ, unpublished results, 2002). 

The close agreement between the nuclear and mitochondrial gene trees strongly supports the conclusion that they reflect the evolutionary history of the genus rather than being the result of anomalous distributions. At present, then, it appears likely that any acanthamoebae with the RnsT4 or rnsT4 genotype would have the potential to cause keratitis. Whether they are the primary cause of encephalitis and other manifestations of infection is under study. Isolated cases suggest that other Acanthamoeba genotypes may also be pathogenic in non-AK diseases, including clinical manifestations of Acanthamoeba infections of the brain (granulomatous amebic encephalitis [GAE]), skin, and lung. 

Relative Diagnostic Values of Rns and rns Sequences

Sequences of either the nuclear or mitochondrial gene are suitable for identifying and classifying isolates. Rns sequences have the disadvantage of a larger size with highly variable insertions that are difficult or impossible to align reliably and thus are not included in comparisons. Moreover, some strains categorized in two of the genotypes, Rns T3 and Rns T5, have been shown to have introns that make the genes even larger. ^{33 34} As discovered by Chung et al., ³⁵ the introns can present diagnostic problems for genotype determinations based on the riboprinting of Rns, which has been suggested as an alternative to sequencing for identification of specimens. However, Rns sequences have a significant advantage when it is important to identify a strain more specifically than at the genotype level. This is the case, for example, when attempting to identify decisively the environmental source of a particular clinical isolate, or when trying to determine whether the same strain is present before and after drug treatment of an infection. ^{36 37 38} The nuclear sequences are preferable in these situations because they are more likely to be unique than the mitochondrial sequences. The 68 strains listed in Table 1 1 include 40 (59%) strains with rns sequences that occur in more than one strain (Table 4) . Thus, only 41% of the sequences are unique. When the 66 Rns sequences that are available from the same group of strains are considered (data not shown), 53 (80%) sequences are unique. In addition, because the presence of introns in Rns is relatively uncommon, they also have the potential to serve as unique markers. ³⁵ Use of the nuclear gene also has the present advantage that much more is known about the genotypic and generic specificity of various PCR amplimers and about their use in clinical diagnostics. An example is the use of the Rns sequence region designated diagnostic fragment (DF)-3 as a marker for exploring relationships between corneal scrapes of patients with Acanthamoeba keratitis, their contact lens paraphernalia, and their home water supplies. ³⁸  

As demonstrated herein, however, the mitochondrial gene also has important advantages for strain comparisons. It has a more consistent length averaging approximately 1540 bp compared with the approximately 2300 to 3000 bp for Rns and a larger proportion of the base pairs can be aligned for comparisons of sequences. We are attempting to design genus-specific primers for the amplification of rns amplicons, but the very limited availability of suitable rns sequence information for organisms closely related to Acanthamoeba has been a hindrance. The apparent absence of introns in rns makes this gene more suitable for the use of restriction fragment length polymorphisms (RFLP) for the identification of isolates when DNA sequencing is not readily available. ³⁹ Another advantage of using rns for sequencing is the larger proportion of isolates with identical sequences. This is an advantage, because discovery of a sequence that is the same as one that already has been placed in a phylogenetic reconstruction eliminates the need to repeat these more complex evaluations. The clusters of isolates with identical rns sequences also may provide a consistent basis for establishing associations between morphologic species and sequence variants within the main genotypes that have been described. 

 Supported by National Eye Institute Grant EY09073 (PAF, TJB, GCB); the Egyptian Cultural Bureau (MHA); the Department. of Biotechnology, Government of India (SS, RKA); and the South African Medical Research Council and the Medical Faculty Research Endowment Fund of the University of Witwatersrand, Johannesburg, South Africa (MBM, IAN).

 Submitted for publication May 21, 2002; revised August 29, 2002; accepted October 22, 2002.

 Commercial relationships policy: N.

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Acanthamoeba Strains Used for Sequencing of rns and Rns

Acanthamoeba Species Isolates	rDNA Genotype Clades, *	Source, †	GenBank Accession Number
Morphological group I species
A. astronyxis Ray and Hayes, 1954 8
1. Type-strain,, ‡ Ray and Hayes, ATCC 30137	T7	Lab water (Washington state, USA)	AF479546
A. tubiashi Lewis and Sawyer, 1979 9
2. Type-strain, NMFS OC-15C, ATCC 30867	T8	Freshwater (Maryland, USA)	AF479545
A. comandoni Pussard, 1964a 10
3. Type-strain, A1P, ATCC 30135	T9	Soil (France)	AF479544
Morphological group II species
A. castellanii Douglas, 1930 11
4. Type-strain, Castellani, ATCC 50374	T4	Yeast culture (UK)	AF479528
5. Ma, ATCC 50370	T4	Keratitis (New York, USA)	AF479533
6. Neff, ATCC 50373	T4	Soil (California, USA)	AF479560
7. CDC V014	T4	Keratitis (India)	AF479550
8. CDC V042, ATCC 50493	T4	Keratitis (USA)	AF479529
9. CDC 0180:1	T4	Lung infection (Pennsylvania, USA)	AF479520
10. Pussard 425, §, ATCC 30134 (formerly A. terricola Pussard, 1964b 12 )	T4	Soil (France)	AF479561
11. JAC E2, § , ∥	T4	Keratitis (Japan)	AF479497
12. JAC E3, § , ∥	T4	Keratitis (Japan)	AF479498
13. JAC E4	T4	Keratitis (Japan)	AF479555
A. griffini Sawyer, 1971 13
14. Type-strain, S7, ATCC 30731	T3	Beach bottom (Connecticut, USA)	AF479562
A. mauritaniensis Pussard and Pons, 1977 14
15. SAWE 90/1, ∥, ATCC 50676	T4	Keratitis (South Africa)	AF479510
16. SAWE 92/2, ∥, ATCC 50677	T4	Keratitis (South Africa)	AF479511
17. SAWE 95/6, ∥, ATCC 50684	T4	Keratitis (South Africa)	AF479512
18. SAWE 93/3, ∥, ATCC 50678	T4	Keratitis (South Africa)	AF479513
19. SAWE 94/4, ∥, ATCC 50679	T4	Keratitis (South Africa)	AF479514
20. SAWE 94/5, ∥, ATCC 50680	T4	Keratitis (South Africa)	AF479515
21. SAWL 93/1, ∥, ATCC 50681	T4	Keratitis (South Africa)	AF479516
22. SAWL 91/3, ∥, ATCC 50682	T4	Keratitis (South Africa)	AF479517
23. SAWL 91/4, ∥, ATCC 50683	T4	Keratitis (South Africa)	AF479518
A. polyphaga (Puschkarew), Page, 1967 15
24. JAC/S2, ATCC 50372	T4	Soil (Japan)	AF479527
25. CEI 73-01-16, ATCC 50371 (also identified as A. lugdunensis 16 )	T4	Keratitis (Texas, USA)	AF479557
26. CDC V029, ATCC 50495	T4	Keratitis (Massachusetts, USA)	AF479526
27. Sawyer, CCAP 1501/3C	T2	Freshwater (USA)	AF479543
28. TV8, ATCC 30921	T4	Shore (Antarctica)	AF479522
29. UNAM HC-2	T4	Keratitis (Mexico)	AF479496
30. CCAP, 1501-3D, ATCC 30873	T4	Keratitis (UK)	AF479537
31. Panola Mtn., ATCC 30487	T3	Soil (Georgia, USA)	AF479535
A. rhysodes Singh, 1952 17
32. CEI:85-6-116, ATCC 50368	T4	Keratitis (Texas, USA)	AF479553
Morphological Group III Species
A. culbertsoni Singh and Das, 1970 18
33. Diamond	T4	Keratitis, (Ohio, USA)	AF479521
34. CDC 409, §.	T10	Horse brain (USA)	AF479542
A. healyi Moura, Wallace and Visvesvara, 1992 19
35. Type-strain, CDC V013, ATCC 30866	T12	GAE, brain (British West Indies)	AF479548
A. lenticulata Molet and Ermolieff-Braun, 1976 20
36. Type-strain, PD2S, ATCC 30841.	T5	Swimming pool, France	AF479541
37. SAWS 87/1, ATCC 50685	T5	Sewage sludge (South Africa)	AF479538
38. SAWS 87/2, ∥, ATCC 50686	T5	Sewage sludge (South Africa)	AF479539
39. SAWS 87/3, ∥, ATCC 50687	T5	Sewage sludge (South Africa)	AF479540
A. palestinensis Reich, 1935 21
40. Type-strain Reich, ATCC 30870	T2	Soil (Israel)	AF479563
A. royreba Willaert, Stevens and Tyndall, 1978 22
41. Type-strain, Oak Ridge.	T4	Human tissue culture	AF479559
Strains with no species identification
Acanthamoeba species
42. CEI 82-12-324, ATCC 50496	T4	Keratitis (Texas, USA)	AF479499
43. CEI 88-2-27, ATCC 50369	T4	Keratitis (Texas, USA)	AF479558
44. CEI 88-2-37, ATCC 50497	T4	Keratitis (Texas, USA)	AF479554
45. CDC V125, ATCC 50498	T4	Keratitis, (California, USA)	AF479524
46. Liu-E1, ATCC 50709	T4	Keratitis (China)	AF479500
47. JAC 324, Galka	T4	Keratitis, (Texas, USA)	AF479505
48. LVPEI 402/97	T4	Keratitis (India)	AF479506
49. LVPEI 773/96	T4	Keratitis (India)	AF479507
50. LVPEI 1060/96	T4	Keratitis (India)	AF479549
(continues)

Table 1A.

 

(continued). Acanthamoeba Strains Used for Sequencing of rns and Rns

Acanthamoeba Species Isolates	rDNA Genotype Clades, *	Source, †	GenBank Accession Number
51. LVPEI 749/98	T4	Keratitis (India)	AF479552
52. LVPEI 1002/99	T4	Keratitis (India)	AF479551
53. LVPEI 1035/99	T4	Keratitis (India)	AF479508
54. LVPEI 98/00	T4	Keratitis (India)	AF479509
55. CDC V504	T4	Keratitis (Italy)	AF479519
56. CDC V017	T4	Nasal sinus infection (USA)	AF479523
57. OHSU M002, §	T4	Keratitis (Oregon, USA)	AF479504
58. CDC V328	T4	GAE	AF479501
59. CDC V382	T4	Skin infection (USA)	AF479502
60. CDC V390	T4	Skin infection (USA)	AF479503
61. CDC V383	T4	Keratitis (Argentina)	AF479534
62. CDC V168	T4	Skin infection (USA)	AF479525
63. CDC V006	T1	GAE, brain (Georgia, USA)	AF479547
64. JAC 9E′	T4	AK (Japan)	AF479556
65. JAC Kamph, ∥	T4	AK (Japan)	AF479532
66. JAC 473U, ∥	T4	AK (Japan)	AF479530
67. JAC E7, ∥	T4	AK (Japan)	AF479531
68. OHSU M001	T11	Keratitis (Oregon, USA)	AF479536

Table 2.

 

PCR and Sequencing Primers

	Sequences (5′ to 3′) and Location in rns *	Genome Location, †
PCR primers
Forward.mt1	CCGCGGGTCGAC/T1TGTATAAACAATCGTTGGGT21	6184–6204
Forward.tALA	TCGATTCTGATTGCGTCC
Reverse.mt1541	CCCGGGGGATCC/A1541AAATTTTGTCCAGCAGCA1523	7706–7724
Sequencing primers
Reverse.mt243	260CAAACCAGCTAAGCATCG243	6426–6443
Forward.mt400	277CATTGGGACTGAAAACGG294	6460–6477
Reverse.mt515	532AACCACCTACGCACCCTT515	6698–6715
Reverse.mt900	895CAAATTAAACCACATACT878	7061–7078
Forward.mt600	622AAGTGTAAAGGTGAAATT639	6805–6822
Forward.mt1037	1037TGTCGGCAGTTCGTGTTG1054	7220–7237
Reverse.mt1230	1224GCTTCACATTGTAATTAC1207	7390–7407
Reverse.mt1180	1197ACGTGTGTAGCCCAACCT1180	7363–7380
Forward.mt1353	1353CTTTGTACACACCGCCCG1370	7536–7553

Figure 1.

 

Location of primers and aligned regions in the mitochondrial 16S rDNA used in this study. Regions that were included in the alignment correspond to six regions of A. castellanii, Neff. ¹⁸ The base positions of our alignment in the reference A. castellanii Neff sequence are as follows: 23 to 150, 172 to 774, 788 to 928, 1021 to 1094, 1120 to 1399, and 1468 to 1522. These regions are shown by the black boxes in the figure. Primer locations (see Table 2 for primer details) and direction of extension (direction of arrowhead) are shown above the schematic of the gene.

Table 3.

 

Percent Dissimilarity between Genotypes

	T1	T2	T3	T4	T5	T7	T8	T9	T10	T11
T2	8.0*	2.4 , †
	(13.9)	(7.1)
T3	7.8	6.1	2.4
	(13.0)	(12.1)	(6.9)
T4	6.1	5.4	5.6	2.0
	(11.5)	(10.9)	(11.1)	(5.2)
T5	8.0	7.1	7.9	6.4	0.2
	(15.8)	(14.6)	(14.6)	(13.0)	(0.2)
T7	13.2	13.4	13.5	12.2	13.2
	(18.6)	(18.2)	(18.4)	(17.0)	(20.0)
T8	13.7	13.6	14.0	12.4	13.1	2.8
	(19.4)	(18.5)	(18.7)	(17.6)	(19.4)	(5.0)
T9	13.1	13.3	13.2	12.0	12.8	2.2	2.7
	(19.3)	(18.9)	(17.9)	(17.3)	(18.9)	(4.7)	(4.3)
T10	7.6	6.9	6.5	6.6	7.7	13.7	13.4	13.3
	(12.9)	(13.1)	(12.3)	(12.8)	(14.2)	(19.5)	(19.2)	(19.3)
T11	7.5	6.1	4.4	5.7	7.0	13.7	14.0	13.5	6.2
	(12.8)	(12.7)	(9.9)	(11.7)	(14.0)	(18.8)	(19.2)	(18.4)	(12.6)
T12	7.4	6.1	6.5	5.8	6.9	13.5	13.3	13.0	5.3	6.3
	(11.6)	(13.1)	(11.5)	(11.4)	(13.2)	(18.3)	(18.3)	(17.9)	(10.6)	(12.9)

Figure 2.

 

16S mitochondrial rDNA (rns) bootstrapped maximum parsimony phylogenetic tree. Strain details are in Table 1 . Branches having several strains with identical rns sequences are indicated on the tree by strain labels with superscript numbers 1 to 7 (see Table 4 ). A consensus maximum parsimony tree is presented, and numbers at nodes preceded by M are bootstrap percentages based on 100 bootstraps in maximum parsimony. The other two numbers at the nodes are bootstrap values (1000 bootstraps) from neighbor joining (N) and minimum evolution (E) analyses. Terminal lineages that contain one or more isolates from cases of Acanthamoeba keratitis are shown on the tree by the abbreviation AK. Acanthamoeba species type-strains are underscored. Aast, A. astronyxis; Acas, A. castellanii; Acom, A. comandoni; Acul, A. culbertsoni; Agri, A. griffini; Ahea, A. healyi; Alen, A. lenticulata; Alug, A. lugdunensis; Amau, A. mauritaniensis; Apal, A. palestinensis; Apol, A. polyphaga; Arhy, A. rhysodes; Aroy, A. royreba; Asp, Acanthamoeba species; Atub, A. tubiashi.

Table 4.

 

Clusters of Strains with Identical rns Sequences

Cluster 1 (rnsT4a)*		Cluster 2 (rnsT4a)		Cluster 3 (rnsT4b)
A. castellanii: Castellanii, †		A. castellanii: JAC E2, †	AK, ‡	A. castellanii: 0180:1, † , §
A. castellanii: V042	AK	A. castellanii: JAC E3	AK	Acanthamoeba species: V125, §	AK
A. polyphaga: JAC S2		A. polyphaga: UNAM HC-2		A. culbertsoni: Diamond	AK
Acanthamoeba species: JAC 473U	AK	Acanthamoeba species: 82-12-324	AK	A. polyphaga: TV8
Acanthamoeba species: JAC E7	AK	Acanthamoeba species: Liu-E1	AK	Acanthamoeba species: V017
Acanthamoeba species: JAC Kamph	AK	Acanthamoeba species: V328		Acanthamoeba species: V504
A. castellanii: Ma	AK	Acanthamoeba species: V382
		Acanthamoeba species: V390
		Acanthamoeba species: OHSU M002	AK
		Acanthamoeba species: 324.jpn	AK
Cluster 4 (rnsT4d)		Cluster 5 (rnsT4f)		Cluster 6 (rnsT4h)
A. castellanii: JAC E4, †	AK	A. castellanii: Neff, †		A. mauritaniensis: SAWE 90/1	AK
Acanthamoeba species: JAC 9E	AK	A. castellanii: Pussard 425 (partial Rns)		A. mauritaniensis: SAWE 92/2	AK
Acanthamoeba species: 88-2-37	AK			A. mauritaniensis: SAWE 93/3	AK
				A. mauritaniensis: SAWE 94/4	AK
				A. mauritaniensis: SAWE 94/5	AK
Cluster 7 (rnsT5)				A. mauritaniensis: SAWE 95/6, †	AK
A. lenticulata: SAWS 87/1, †				A. mauritaniensis: SAWL 91/3	AK
A. lenticulata: SAWS 87/2				A. mauritaniensis: SAWL 91/4	AK
A. lenticulata: SAWS 87/3				A. mauritaniensis: SAWL 93/1	AK

The authors thank Takuro Endo, Japanese National Institutes of Health, Tokyo for isolates 7 to 9 and 48 to 52; William Mathers and Trisha Hannan, Casey Eye Institute, Oregon Health Sciences University, Portland, for isolates 57 and 68; and Govinda S. Visvesvara, Centers for Disease Control and Prevention, Atlanta, GA, for isolates 5, 6, 10, 12, 16, 66 and 70. Other strains were collected by the authors, were obtained from American Type Culture Collection [ATCC], or were gifts acknowledged previously. ⁵