Mutation Analysis of Congenital Cataracts in Indian Families: Identification of SNPs and a New Causative Allele in CRYBB2 Gene

Abstract

purpose. To study some functional candidate genes in cataract families of Indian descent.

methods. Nine Indian families, clinically documented to have congenital/childhood cataracts, were screened for mutations in candidate genes such as CRYG (A→D), CRYBB2, and GJA8 by PCR analyses and sequencing. Genomic DNA samples of either probands or any representative affected member of each family were PCR amplified and sequenced commercially. Documentation of single nucleotide polymorphisms (SNPs) and candidate mutations was done through BLAST SEARCH (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?).

results. Several single nucleotide polymorphisms in CRYG, CRYBB2, and GJA8 genes were observed. Because they do not co-segregate with the phenotype, they were excluded as candidates for the cataract formation in these patients. However, a substitution (W151C in exon 6 of CRYBB2) was identified as the most likely causative mutation underlying the phenotype of central nuclear cataract in all affected members of family C176. Protein structural interpretations demonstrated that no major structural alterations could be predicted and that even the hydrogen bonds to the neighboring Leu166 were unchanged. Surprisingly, hydropathy analysis of the mutant βB2-crystallin featuring the amino acids at position 147 to 155, further increased the hydrophobicity, which might impair the solubility of the mutant protein. Finally, the Cys residue at position 151 might possibly be involved in intramolecular disulphide bridges with other cysteines during translation, possibly leading to dramatic structural changes.

conclusions. Exon 6 of CRYBB2 appears to be a critical region susceptible for mutations leading to lens opacity.

Congenital cataract is an important cause of visual impairment in children. Clinically, it features diverse etiologies. It may occur either isolated or associated with other ocular diseases or as part of a multisystemic disorder. Globally, the incidence is 1–6 per 10,000 live births. As per the recent population-based estimate in one of the southern states of India, cataract contributes to 15% of childhood blindness. ¹  

Approximately 50% of childhood cataracts are genetic; whereas one-quarter to one-third are familial; the majority are autosomal dominant. ² Phenotypes are described mainly based on the physical appearance and the site of occurrence of the opacity. Clinical and genetic heterogeneity of congenital cataracts are well substantiated. Over 21 autosomal dominant congenital cataract loci have thus far been mapped through linkage analysis. Autosomal recessive forms of cataract are rather rare and only a few have been reported. ^{3 4} Quite recently, a type of congenital nuclear cataract was mapped to the X-chromosome (Xp22.3-p21.1). ⁵ Thirteen of the mapped loci for isolated congenital or infantile cataracts have been associated with mutations in specific genes. About half of them involve mutations in crystallins, a quarter in connexins, and the rest are shared equally by aquaporin 0 (MIP) and the gene for beaded filament protein. ⁶  

Among the already characterized phenotypes, three genes or groups of genes are the most relevant for congenital cataracts. These are two genes of the CRYG gene cluster (CRYGC and CRYGD) on chromosome 2, the CRYBB2 on chromosome 22, and the GJA8 gene on chromosome 1. This feature is further supported by mutational analysis of concordant cataracts in the mouse model (for a recent overview, see Ref. ⁷ ). Therefore, it is appropriate to consider these genes as the top list of functional candidates in hereditary congenital (or juvenile) cataracts. 

Among the encoded lens proteins, crystallins constitute the major proteins of the vertebrate lens. They attribute to the clarity of the lens through their ordered spatial arrangement and are highly stable. Mutations in major vertebrate crystallin genes such as the αA-crystallin (CRYAA), ^{8 9} β-crystallin (CRYB), ^{10 11 12 13} and γ-crystallin (CRYG) ^{14 15 16 17 18 19} in humans have been well documented. Also, a comparable array of mutations has been reported from the murine counterparts. ⁷  

In the present study, identification of the disease loci underlying autosomal dominant and recessive cataracts was attempted by molecular analysis of nine afflicted families of Indian origin. 

Materials and Methods

Clinical Documentation

A prospective study on clinical and genetic aspects of bilateral childhood cataracts (BCCs) was undertaken in collaboration with the Aravind Eye Hospital, Madurai, Tamil Nadu, South India, from January 1995 to August 1996. ^{20 21} Children below 15 years of age with bilateral childhood cataracts were recruited from the Pediatric Ophthalmology Unit of the Aravind Eye Hospital. The probands and the accompanying parents or relatives (when available) underwent clinical ocular examination by a senior pediatric ophthalmologist to assess the cataract phenotype through either slit lamp or direct ophthalmoscope, depending on the cooperation extended by the probands. Clinical details were recorded in a standard questionnaire for information pertaining to age at onset and diagnosis of the cataract in the proband, proband’s health history, parent’s medical history, and maternal reproductive and obstetric history. Molecular characterization of childhood cataracts in nine afflicted Indian families was attempted through candidate gene approach. Mutation screening included those genes coding for lens proteins, such as CRYG (A→D); CRYBB2, and GJA8. The cataract phenotype and other family details are outlined in Table 1 . The study was performed according to the Declaration of Helsinki; in particular, the families were fully informed of the nature of the study, its outcome, and their role in regional language before the informed consent prepared as per standard norms was obtained. 

Molecular Analysis

Five to 10 mL of blood samples for genomic DNA isolation were collected from probands, parents, siblings, and other available relatives of the families who expressed their willingness to be included in the study. ²² A DNA sample of one representative affected member of each family was PCR amplified and sequenced for the appropriate candidate genes such as CRYG (A→D), CRYBB2, and GJA8. Details on primers and PCR conditions for CRYG genes are described elsewhere. ¹⁸ Primers used for PCR amplification of CRYBB2 and GJA8 are outlined in Table 1 . 

All six exons of the CRYBB2 gene (Acc. no. Z99916) were analyzed after amplification of genomic DNA by PCR in reaction volumes of 20 μL with 95°C for 60 seconds (1 cycle), 40 cycles of 95°C for 45 seconds, 55°C or 60°C for 45 seconds, 72°C for 45 seconds or 60 seconds, and a final extension at 72°C for 5–10 minutes using either a DNA Engine Tetrad (Biozym, Hess. Oldendorf, Germany) or a Perkin Elmer Thermocyler (Perkin Elmer, Weiterstadt, Germany). PCR conditions for GJA8 includes 95°C for 2 minutes (1 cycle), 40 cycles at 95°C for 1 minute, 67°C for 1 minute, 72°C for 1 minute, and a final extension at 72°C for 5 minutes (1 cycle). Sequence analysis was performed commercially (SequiServe, Vaterstetten, Germany) after purification of PCR fragments through Nucleospin extraction columns (Macherey-Nagel, Düren, Germany). 

Molecular Modeling

For computer-assisted prediction, the Proteomics tools of the ExPASy server (http://www.expasy.ch; http://us.expasy.org/cgi-bin/protscale.pl) was used. Molecular modeling of wild-type βB2-crystallin and its W151C mutant were performed according to Schwede ²³ using ProModII (http://www.expasy.org/swissmod/SM_ProMod.html). The models were computed on the coordinates of 1BLB and 2BB2 (abbreviations of PDB entries at: http://www.ebi.ac.uk/pdb), which revealed highest similarities after a BLAST search and manual verification in ClustalX (http://www.embl.de/∼chenna/clustal/darwin). ²⁴ The modeling involved loop and final energy minimization and was verified by PROVE (http://biotech.ebi.ac.uk:8400) and WHAT_CHECK (http://www.cmbi.kun.nl/swift/whatcheck) packages. ^{25 26} Structure alignment and rendered displays were prepared by iMOL (available at www.pirx.com/iMol/). All hydropathies for both wild type and mutant are calculated in a default window size of 9. 

Results

Congenital/childhood cataracts in nine Indian families were characterized with respect to their morphology and mode of inheritance; five were autosomal dominant, and in four families the cataract appeared to be recessive (Table 2) . In the course of functional candidate gene analysis, several polymorphic sites were identified in all genes tested (Table 3) . There was no specific sequence variation neither in GJA8 nor in CRYG genes co-segregating with the disease phenotype in these families (n = 8). Hence, they had to be excluded as candidate genes for the causative mutation. The single exon of GJA8, besides the two sequence variant sites, did not feature any other polymorphic sites compared with either CRYG (A→D) or CRYBB2. The specific variation L7M was of low frequency and was most often encountered in affected than unaffected members of the same family. Since it might be impressive to see the spectrum of polymorphic sites in the distinct families, the polymorphisms were also grouped on the basis of the families (Table 4) . It is surprising that some of the CRYBB2 polymorphisms were very frequent in most of the families tested (Table 4) . 

Another variant at intron 3 (71307C→A) was observed in the affected individual from family C176 (Fig. 1 ; IV-3) and also in other affected members of the family tested (III-6; IV-2; IV-4; V-1), but it was not present in the two unaffected members tested of the family (III-7; IV-1). It was not possible to procure lens mRNA from the affected family members to ascertain whether this sequence variation might contribute to any alternative splicing and thereby to the disease. 

However, in exon 6 of the CRYBB2 gene, a change at position 465G→T was observed in the affected member IV-3, implying an amino acid substitution as W151C (Fig. 2A 2B 2C 2D) coupled with another silent polymorphism at position 495A→G (L10035.1). Both sequence variations were also observed in other affected family members (III-6; IV-2; IV-3; IV-4; V-1), but not in the two unaffected members of the family (III-7; IV-1). This particular sequence variation W151C was not observed in either the unrelated control or six other cataract probands, whereas the silent polymorphism at position 495A→G was observed in four other cataract probands (C107, C162, CCE10, and C180). The sequence variation 465 G→T was further confirmed by sequencing with the reverse primers in four affected members of this family (IV-2, IV-3, IV-4, and V-1). 

The phenotype of central nuclear cataract was observed from the second generation onwards of a five generation pedigree (Fig. 1) ; in general it followed an autosomal-dominant mode of inheritance. The proband V-1 was 6 years old at the time of case registration and was examined by a senior pediatric ophthalmologist through a slit lamp; the phenotype was documented to be a central nuclear cataract. All affected members spread out in the last three generations had central nuclear cataracts since birth and presented no other ocular or systemic ailments. 

First attempts in explaining the consequences on the folding properties came from the Prosite scanning (http://www.expasy.org/prosite); this program suggested that the mutation might be incompatible with the formation of the 4th Greek Key motif. To refine this, a more detailed modeling approach was chosen based on known structures of bovine βB2crystallin (1BLB and 2BB2), which revealed the identity of >96% amino acids. However, as demonstrated in Figure 3 , wild-type W151 and W151C mutant revealed the same-modeled structure. In particular, the side chain of W151 interacted with L166 via two hydrogen bonds; this interaction was predicted in the W151C mutant as well (not shown). 

Discussion

It is tempting to assume that mutations in any of the genes coding for crystallins, being lens specific proteins, could result in childhood cataract. ²⁷ In particular, the sequence variation W151C in the CRYBB2 gene reported here is very likely the molecular basis for the central nuclear cataract in the affected members of family C176, since it co-segregates perfectly with the phenotype in the affected members. To understand how this single amino acid exchange might influence the protein structure, several modeling approaches were undertaken. 

First, the Prosite program suggested that the 4th Greek Key motif will not be formed, since the mutation alters the first amino acid of its consensus sequence. However, according to a more detailed modeling (Fig. 3) , the W151 and C151 are buried between β-sheets of βB2-crystallin and contribute in the same way to the hydrogen bonds with L166. The structure prediction is based on amino acid similarities of known crystallized proteins. This does not exclude the possibility that during protein synthesis and folding, additional cysteine bridges with C48 or C67 might be formed in the W151C mutant. This would disrupt the folding and expose different amino acids at the accessible surface of the protein. 

However, hydropathy analysis revealed a significant variation in the physicochemical properties of the critical region in the W151C (Fig. 4B) mutant, compared with the wild-type βB2-crystallin (Fig. 4A) . The environment surrounding the amino acid “W” in the wild-type protein is more hydrophilic. In contrast, in the mutant form the hydropathy environment has become more hydrophobic, but as outlined in Figure 3 , it is not exposed to the surface of the protein. This is in line with the predicted identity of the isoelectric point of the mutated protein with the wild-type form (pH 6.5). Therefore, an increase in hydrophobicity might affect the solubility of the mutant protein and hence contribute to cataract formation since birth only, if the additional Cys residue in the mutant comes into another environment due to different folding during translation. 

As mentioned above, the wild-type βB2-crystallin has two cysteine residues. Since the mutant allele of CRYBB2 (W151C) has an additional Cys at position 151, intramolecular disulphide formation of these cysteines, as suggested by Slingsby et al., ²⁹ might severely change the structure during the translation of the mutated protein. This argument further draws support from the report of disulphide bond formation of cysteine-37 and cysteine-66 of βB2-crystallin in human nuclear cataract. ²⁹ Such cysteine-mediated disulphide bridges could internalize the hydrophobic residues and render them inaccessible to aqueous solvents. 

Several other cataract mutations, both in mouse ^{31 32 33} and human, ^{10 11 12 13} affect the CRYBB2 gene, which therefore is one of the most important genes for lens transparency. The CRYBB2 gene product was earlier considered as the “basic principle β-crystallin” because of its abundance in water-soluble lens extracts, ³⁴ and presently, this protein is referred to as βB2-crystallin. The first mutation identified in the CRYBB2 gene was causative for a cerulean cataract (CCA2: congenital cataract of cerulean type 2) featuring peripheral bluish and white opacities in concentric layers with occasional central lesions arranged radially. Litt et al. ¹⁰ mapped this particular type of cataract to a region of human chromosome 22 containing the cluster encoding four CRYB genes. Sequence analysis revealed that a chain-termination mutation at the beginning of exon 6 of the CRYBB2 gene (C475T; Gln155X) is associated with this particular type of cataract. Surprisingly, the same mutation was also found in a family suffering from a Coppock-like cataract ¹² and in a five-generation Indian family with suture cataract and cerulean opacities. ¹³ The authors explain the identity of the three mutations by a gene-conversion mechanism between the CRYBB2 gene and its flanking pseudogene; the diversity of the phenotypes might be caused by variations in the promoter region, possibly influencing the expression of CRYBB2 in the lens or other crystallin genes as modifiers from surrounding loci. 

In mice, two mutant lines have been reported to involve the Crybb2 gene: the Philly mouse ³¹ and the Aey2 mutant line. ³² Both cataracts are progressive and recognizable from the second week after birth as an anterior suture and as a subcapsular opacity. In the Philly mouse, the ultimate phenotype is characterized as a strong opacity of the lens nucleus and of the anterior suture at the age of 6 to 7 weeks. ³³ In Aey2 mutants, gradual opacification of the whole lens was completed at the age of 11 weeks. ³² Phenotypically, the novel human CRYBB2 mutation reported here resembles the Coppock-like cataract ¹² and the Philly mouse. On the other hand, the sutural-cerulean cataract ¹³ corresponds phenotypically to the Aey2 mouse mutant. ³² The exchange of Val at position 187 by Glu (V187E) ³² affects the same region as the Philly allele. 

It is interesting to note that all known human and mouse Crybb2/CRYBB2 mutations are clustered in exon 6. Further biophysical characterization of these altered βB2-crystallins will establish the underlying pathogenesis in the diverse phenotypes. 

³  Present affiliation: Science Center, Manipal Academy of Higher Education, Manipal, India.

 Supported in part by the German Federal Ministry of Research and Technology, Grant BMBF/DLR, IND-99/021 (JG), and the Indian Council of Medical Research and the Government of India (PMG and STS).

 Submitted for publication February 25, 2004; revised May 17, 2004; accepted May 27, 2004.

 Disclosure: S.T. Santhiya, None; S.M. Manisastry, None; D. Rawlley, None; R. Malathi, None; S. Anishetty, None; P.M. Gopinath, None; P. Vijayalakshmi, None; P. Namperumalsamy, None; J. Adamski, None; J. Graw, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Oligonucleotides Used as Primers for PCR Amplification of Human CRYBB2 and GJA8 Genes

Designation Gene (Lab-No)	Sequence (5′ → 3′)	Tm(°C); Fragment Size
CRYBB2-Ex1-L2 (27325)	TCTGTGGGCATTTGCTGACCC	55; 300
CRYBB2-Ex1-R2 (27326)	GCTAACAGCATTGAAGTCTCTGCCC
CRYBB2-Ex2-L1 (22206)	GACCCCACAGCTCTGGGACAGTC	60; 400
CRYBB2-Ex2-R1 (22207)	GGAGGGACTTTCAGTATCAGCTCCAAC
CRYBB2-Ex3-L1 (22208)	CACGGCTGCTTATAGCCACAGCC	60; 450
CRYBB2-Ex3-R1 (22209)	TCTATCTGACTGCAAAGCATGAATTATCTCC
CRYBB2-Ex4-L2 (22576)	GCTTTGGGCACAGCGATGTTCTG	60; 750
CRYBB2-Ex4-R2 (22577)	GGCCCCTTCCTGGTCCCCA
CRYBB2-Ex5-L2 (22578)	AGTGGTCATAGACACGTAGTGGGTGCAC	60; 700
CRYBB2-Ex5-R2 (22579)	CTGTTCCCAAACTTAGGGACACACGC
CRYBB2-Ex6-L2 (22580)	CCCCTCGTTCACCCTCCCATCA	60; 520
CRYBB2-Ex6-R2 (22581)	CACTGTGTCCAAGGTCACACAGCTAAGC
GJA8-L5 (38999)	CGGGGCCTTCTTTGTTCTCTAGTCC	67; 750
GJA8-R2 (39000)	AGGCCCAGGTGGCTCAACTCC
GJA8-L6 (39001)	CAGCCGGTGGCCCTGCC	66; 770
GJA8-R2 (39002)	GTTGCCTGGAGTGCACTGCCC

Table 2.

 

Candidate Genes Excluded for Mutation in Probands of Childhood and Congenital Cataracts

Medical Registry Number	Case No.	Phenotype Description	Age at Onset/Diagnosis	Inheritance Pattern	Generation (N)	Affected (N)/Unaffected (N)	Candidate Gene Excluded
129950	C99*	Zonular with nuclear opacity and microcornea	7 y	AD	3	6/18	CRYG (A→D)
								GJA8
847096	C107	Variable-lamellar (Proband) nuclear (Proband’s father)	SB / 3 y	AD	4	8/18	CRYG (A→D)
								CRYβB2
								GJA8
684150	C132*	Lamellar (stationary nonprogressive)	4 y	AD	3	16/37	CRYG (A→D)
								GJA8
43614	C162	Total cataract	12 y	AR	1	3/1	CRYG (A→D)
							CRYβB2
							GJA8
137718	C172	Posterior subcapsular (Proband) Variable (Sib LE: Post. polar RE: Blue Dot)	9 y	AR	1	2/2	CRYG (A→D)
								CRYβB2
								GJA8
75386	C176	Central dense (nuclear) cataract	SB	AD	3	7/18	CRYG (A→D)
								GJA8
22619	CCE10	Zonular cataract	6 m / 4 y	AD	2	2/1	CRYG (A→D)
							GJA8
1480287	C180, †	Post. polar cataract & post. lenticonus & capsular dehiscence	8 y	AR	1	1/4	CRYG (A→D)
10669	CCE25	Lamellar	8 y / 14 y	AR	1	2/3	CRYG (A→D)
							GJA8

 SB, since birth.

*  Not screened for CRYBB2.

†  Not screened for GJA8.

Table 3.

 

Single Nucleotide Polymorphisms Documented in Some Cataract Families of Indian Origin

Gene	bp (Acc. No.)	cDNA; aa	Frequency*
CRYGA: Intron A	198 G→A (M17315)	IVS1+ 82 G→A; noncoding	4/9 (4/9)
Exon 3	196 T→C (M17316)	443 C→T; L148P	9, #/9 (9/9)
CRYGB: Promoter	2104 T→C (M19364)	−47 T→C; noncoding	7/9 (8/13)
Exon 2	2437 C→T (M19364)	192 C→T; P64P	7, §/9 (10/12; 5, #/12)
	2463 G→T (M19364)	218 G→T; S73I	2/9 (2/12)
Exon 3	5391 C→A (M19364)	331 C→A; L111I	5/9 (5/9)
CRYGC Exon 2	18542 C→T (M19364)	33 C→T; A11A	1/9 (1/12)
	18652 G→A (M19364)	143 A→G; R48H	2/9 (3/12)
CRYGD Exon 2	286 T→C (K03005)	51 T→C; Y16Y	5/9 (5/9)
Intron B	517 T→C (K03005)	IVS2+ 30 T→C; noncoding	9, #/9 (9/9)
Exon 3	74 G→A (K03006)	285 G→A; R94R	4/9 (6/12)
	92 A→G (K03006)	303 A→G; Q100Q	9/9 (12/12)
	93 G→A (K03006)	304 G→A; V101M	9/9 (12/12)
3-UTR	326C→T (K03006)	537 C→T; noncoding	4/9 (6/12)
	353 A→T (K03006)	564 A→T; noncoding	1/9 (2/12)
CRYβB2 Exon 1
Intron 1	65894 A→G (Z99916.1)	IVS1+ 84 A→G noncoding	6/7 (6/7)
Intron 2	-	-
Exon 3	71307 C→A (Z99916.1)	IVS3 + 120 C→A	1/6 (4/11)
	73528 A→T (Z99916.1)	IVS3-476 A→T noncoding	1/4 (1/4)
Intron 3	73644 A→G (Z99916.1)	IVS3-360 A→G; noncoding	4/4 (4/4)
	73667 G→A (Z99916.1)	IVS3-337 G→A; noncoding	2/4 (2/4)
Exon 5	75738 G→A (Z99916.1)	IVS5+ 9 G→A; noncoding	4/5 (4/5)
Intron 5	75811 G→A (Z99916.1)	IVS5+ 82 G→A; noncoding	1/5 (1/5)
Exon 6	77788 G→A (Z99916.1)	G161G	5/6 (9/12)
GJA8 Exon 1	19 C→A (XM_001660)	L7M	1/8 (9/20)
	804 C→T (XM_001660)	L268L	2/8 (2/10)

*  Since not all family members could be tested, frequency is given based on number of families screened. Values in parentheses denote the number of persons screened.

#  All homozygotes.

§  Only two families are homozygous: C172, C176.

Table 4.

 

Single Nucleotide Polymorphisms in Candidate Genes Screened in Probands of Congenital/Childhood Cataracts

Family	Gene
		CRYBB2 cDNA; aa	CRYG cDNA; aa	GJA8 cDNA; aa
C99	ND	CRYGA: IVS1 + 82 G→A; noncoding	804 C→T; L268L
		443 C→T; L148P
		CRYGB: −47 T→C; promoter
		192 C→T; P64P
		331 C→A; L111I
		CRYGD: 51 T→C; Y16Y
		IVS2 + 30 T→C; noncoding
		303 A→G; Q100Q
		304 G→A; V101M
C107	65894 A→G; (IVS1 + 84 A→G)	CRYGA: IVS1 + 82 G→A; noncoding	-
	73644 A→G; (IVS3-360 A→G)	443 C→T; L148P
	75738 G→A; (IVS5 + 9 G→A)	CRYGB: −47 T→C; promoter
	77788 G→A; (G161G)	192 C→T; P64P
		218 G→T; S73I
		331 C→A; L111I
		CRYGC: 143 A→G; R48H
		CRYGD: IVS2 + 30 T→C; noncoding
		285 G→A; R94R
		303 A→G; Q100Q
		304 G→A; V101M
		537 C→T; 3′-UTR
C132	ND	CRYGA: IVS1 + 82 G→A; noncoding	19 C→A; L7M
		443 C→T; L148P
		CRYGB: −47 T→C; promoter
		192 C→T; P64P
		331 C→A; L111I
		CRYGD: IVS2 + 30 T→C; noncoding
		285 G→A; R94R
		303 A→G; Q100Q
		304 G→A; V101M
		537 C→T; 3′-UTR
		564 A→T; 3′-UTR
C162	65894 A→G; (IVS1 + 84 A→G)	CRYGA: 443 C→T; L148P	804 C→T; L268L
	73528 A→T;	CRYGB: −47 T→C; promoter
	73644 A→G; (IVS3-360 A→G)	192 C→T; P64P
	75738 G→A; (IVS5 +9 G→A)	CRYGD: 51 T→C; Y16Y
	77788 G→A; (G161G)	IVS2 + 30 T→C; noncoding
		303 A→G; Q100Q
		304 G→A; V101M
C172	65894 A→G; (IVS1 + 84 A→G)	CRYGA: 443 C→T; L148P	-
	73644 A→G; (IVS3-360 A→G)	CRYGB: 192 C→T; P64P
	73667 G→A; (IVS3-337 G→A)	CRYGD: 51 T→C; Y16Y
	75738 G→A; (IVS5 + 9 G→A)	IVS2 + 30 T→C; noncoding
	75811 G→A; (IVS5 + 82 G→A)	303 A→G; Q100Q
		304 G→A; V101M
C176	65894 A→G; (IVS1 + 84 A→G)	CRYGA: IVS1 + 82 G→A; noncoding	-
	71307 C→A; (IVS3 + 120 C→A)	443 C→T; L148P
	73644 G→A; (IVS3-360 G→A)	CRYGB: 192 C→T; P64P
	73667 G→A; (IVS3-337 G→A)	218 G→T; S73I
	77788 G→A; (G161G)	331 C→A; L111I
		CRYGD: IVS2 + 30 T→C; noncoding
		285 G→A; R94R
		303 A→G; Q100Q
		304 G→A; V101M
		537 C→T; 3′-UTR
CCE10	65894 A→G; (IVS1 + 84 A→G)	CRYGA: 443 C→T; L148P	-
	75738 G→A; (IVS5 + 9 G→A)	CRYGB: −47 T→C; promoter
	77788 G→A; (G161G)	331 C→A; L111I
		CRYGC: 143 A→G; R48H
		CRYGD: IVS2 + 30 T→C; noncoding
		285 G→A; R94R
		303 A→G; Q100Q
		304 G→A; V101M
		537 C→T; 3′-UTR
C180	65894 A→G; (IVS1 +84 A→G)	CRYGA: 443 C→T; L148P	ND
	77788 G→A; (G161G)	CRYGD: 51 T→C; Y16Y
		IVS2 + 30 T→C; noncoding
		303 A→G; Q100Q
		304 G→A; V101M
CCE25	-	CRYGA: 443 C→T; L148P	-
		CRYGB: −47 T→C; promoter
		192 C→T; P64P
		CRYGD: 51 T→C; Y16Y
		IVS2 + 30 T→C; noncoding
		303 A→G; Q100Q
		304 G→A; V101M

 ND: not done.

Figure 1.

 

Pedigree of family C176. The mutation is transmitted in an autosomal-dominant manner. Family members participating in this study are indicated by an asterisk.

Figure 2.

 

CRYBB2 encoding βB2-crystallin. The CRYBB2 gene consists of six exons; each of the exons 3 to 6 encodes one Greek Key motif (a). The genomic sequence of an unaffected (III-7; b) and an affected (III-6; c) member of the family C176 is given at the end of intron 5 and the beginning of exon 6. The border is indicated by a small vertical line. The position of the mutation is indicated by an arrow. The heterozygous situation is obvious in the affected member III-6. DNA sequence (d) from the affected members of pedigree C176 of CRYBB2 (exon 6 and a part of intronic upstream sequences). Exon sequences are in capital letters. Amino acid sequences are shown in single letter code. Exon sequences and amino-acid residues are numbered from the start codon ATG for M as +1. The G → T transition at position 465 converts the Trp codon 151 for TGG to the Cys codon TGT. This particular sequence is free of any restriction site.

Figure 3.

 

Model of the W151C mutation in human βB2-crystallin. (A) The predicted structure of the mutant and wild-type form of the βB2-crystallin is given as an overlay of the wild type (in yellow) and the mutant (in blue). Arrows represent β-sheets, cylinders the loops. Magnifications (B) and (C) show the positions of W151 (green) and C151 (pink) within the βB2-crystallin viewed from the same angle (B) as in (A) and turned 90°(C). It is obvious that W151 occupies some more space than the smaller C151.

Figure 4.

 

Hydropathy plot of wild-type and mutated βB2-crystallin. Hydropathy is plotted for the wild type and the mutated form (family C-176). X-axis represents position of amino acids. Y-axis represents hydropathy value in a default window size of 9 calculated according to Guex and Peitsch. ²⁸ The region of interest is boxed; it is obvious that the mutated form has a higher hydrophobicity in this region compared with the wild-type form.

Oligonucleotides were synthesized by Utz Linzner (GSF Institute of Experimental Genetics). The authors thank the family members for their kind cooperation, and Erika Bürkle (GSF National Research Center, Neuherberg, Germany) for her expert technical assistance.