Two Mutations in the TGFBI (BIGH3) Gene Associated with Lattice Corneal Dystrophy in an Extensively Studied Family

Abstract

purpose. To determine the genetic basis for lattice corneal dystrophy (LCD) in an extensively studied family.

methods. Ten affected family members were examined clinically, and three individuals were studied with in vivo confocal microscopy and optical coherence tomography (OCT). Corneal tissues from eight affected family members were examined histopathologically. The status of the transforming growth factor β–induced gene (TGFBI) gene was determined in each consenting family member (six affected, seven nonaffected) by amplifying, sequencing, and analyzing exons 4 and 12 of TGFBI for mutations. All exons from the entire coding region of TGFBI of one affected person were analyzed for mutations.

results. Slit lamp biomicroscopy disclosed the clinical features of LCD in both eyes of affected individuals. In vivo confocal microscopy confirmed the presence of deposits as bright lesions within the corneal stroma. OCT revealed increased reflectivity within the corneal stroma. The corneal stroma in persons undergoing penetrating keratoplasty contained amyloid. Affected members of the family were found to have two heterozygous single-nucleotide mutations in exon 12 of the TGFBI gene (C1637A and C1652A) leading to predicted amino acid substitutions in the encoded TGFβ–induced protein (A546D and P551Q). Mutations were not detected in exon 4. In addition, an inconsequential single-nucleotide polymorphism T1620C (F540F) was found in some affected and nonaffected family members.

conclusions. Two mutations in the TGFBI gene (A546D and P551Q) cosegregated with LCD in an extensively studied family that lacked the R124C mutation that frequently accompanies this form of corneal amyloidosis.

The TGFBI (BIGH3) gene was identified by Skonier et al. ¹ in a study of genes induced by transforming growth factor-β (TGFβ) in a human adenocarcinoma cell line derived from the lung. It was named βig-h3 because the gene was induced by TGFβ in human clone 3, but numerous nonhuman species were later found to express the gene, and the initial term fell out of vogue. Currently, the most popular designation for this gene is TGFBI (transforming growth factor-β–induced). During the decade since its identification, a considerable amount of information has accumulated about this highly conserved gene and its induced product. TGFβ-induced protein consists of 683 amino acids and has a carboxyl terminal Arg-Gly-Asp (RGD) motif. It contains four tandemly repeated internally homologous domains of 140-amino acids that have a marked sequence similarity to regions within the insect cell adhesion molecule known as fasciclin 1. ² These four FAS1 domains correspond to amino acids 134-236 (Fas 1), 242-372 (Fas 2), 373-501 (Fas 3), and 502-632 (Fas 4). ³ Based on an analysis of its cDNA, the TGFBI gene encodes a protein of 68 kDa with an amino-terminal secretory signal peptide; however, in polyacrylamide gels, the protein has an apparent mass of only 63 kDa and an intact NH2-terminal when analyzed by mass spectrometry. ⁴ This difference in size presumably occurs because the extracellular protein lacks part of its COOH-terminal segment, including the RGD sequence (Klintworth GK, et al. IOVS 2002:43:ARVO E-Abstract 1737). 

The year 1994 was a watershed year for research on the TGFBI gene. During that year, a gene for several corneal dystrophies ⁵ and TGFBI ⁶ were mapped to human chromosome 5 (5q31) and we (Klintworth GK, et al. IOVS 1994;35:ARVO Abstract 3154) and another laboratory independently discovered that the protein product of TGFBI is expressed in the cornea. ⁷ This made TGFBI a strong candidate as the disease gene for the various corneal dystrophies that had been mapped to chromosome 5. Three years later Munier at al. ⁸ reported that these inherited corneal disorders are caused by different mutations in TGFBI. Moreover, they ⁸ reported a C-to-T mutation at nucleotide position 417 in exon 4 of this gene (R124C) at codon 124 in 14 individuals with lattice corneal dystrophy (LCD type I), from two families. Subsequently, most cases of this particular corneal dystrophy throughout the world have been attributed to the same mutation in TGFBI. ^{3 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24} The apparent universality of this association with the R124C mutation has given rise to the belief that this codon change is unique for this phenotype and that nucleotide changes at this site are critical to the accumulation of amyloid. 

This report documents two novel mutations in the TGFBI gene, A546D (alanine to aspartic acid), P551Q (proline to glutamine), in an African American family with LCD type I. Preliminary observations on this family have been published as an abstract (Sommer JR, et al. IOVS 1998;39:ARVO Abstract 2347). Studies of corneal tissue from members of this family were reported in a landmark paper that convincingly demonstrated that the characteristic lesions in LCD are amyloid, ²⁵ as well as in an article describing the deposition of amyloid within donor tissue in two siblings after penetrating keratoplasty. ²⁶  

Materials and Methods

Patients

Institutional Review Board approval was obtained for this study involving human subjects and the research adhered to the tenets of the Declaration of Helsinki. The proband was discovered in 1966 at Duke University Medical Center. Fourteen members of the family were examined clinically and histopathologically over almost four decades 1 . All individuals who participated in the molecular genetic portion of the investigation provided informed consent after an explanation of the nature and possible consequences of the study were explained. 

Clinical Evaluations

All subjects were evaluated by slit lamp biomicroscopy. The corneas of three affected individuals (cases 6, 12, and 13; 1 ) were studied in detail by in vivo confocal microscopy and optical coherence tomography (OCT; Confoscan confocal microscope; NIDEK Technologies, Greensboro, NC; OCT-III imaging system; Carl Zeiss Meditec, Dublin, CA). 

Histologic Evaluations

Corneal tissue was examined histopathologically from eight affected individuals, who had undergone penetrating keratoplasty for impaired visual acuity. Six of these patients (cases 1, 2, 3, 4, 6, and 7) underwent multiple keratoplasties, and 23 corneal buttons from this family were studied. Tissue sections of the corneal specimens were examined by light microscopy after being stained with hematoxylin and eosin, Masson trichrome, periodic acid Schiff, and Congo red, and five corneal buttons from three siblings (cases 1, 2, and 3) were evaluated with numerous special stains, as documented elsewhere. ²⁵ Corneal tissue obtained at penetrating keratoplasty was studied by transmission electron microscopy in several cases, and the findings in one of them were reported (case 1). ^{25 26}  

Molecular Analyses

The TGFBI gene was analyzed in all family members willing to provide blood for DNA analysis, and DNA was extracted from the blood (Puregene Blood Kit; Gentra Systems, Minneapolis, MN; QIAamp Blood Maxi Kit; Qiagen, Valencia, CA). Exons 4 and 12 of TGFBI of 13 family members were amplified, sequenced, and analyzed for mutations. To make sure that patients with LCD did not have a mutation in other exons, all exons from the entire coding region of TGFBI from one affected person was amplified by polymerase chain reaction (PCR), sequenced, and analyzed for mutations in comparison with the nucleotide sequences of normal individuals. The exons of TGFBI were analyzed in genomic DNA from this individual (case 6) by amplifying the extracted DNA with PCR, using the forward and reverse primers and the conditions described in 2 . The resultant PCR products were purified (QIAquick PCR Purification Kit; Qiagen) and sequenced on both strands using dye terminator chemistry (BigDye Terminator Cycle Sequencer; Applied Biosystems, Foster City, CA) combined with a DNA sequencer (Prism 377; Applied Biosystems). The resultant DNA-sequencing gel was then analyzed (Prism SeqScape Software; Applied Biosystems). The sequences of all exons were then aligned to the TGFBI cDNA using a Web-based sequence analyzing software (SeqWeb; Accelrys, San Diego, CA) program to detect any nucleotide changes and resultant, if any, predicted amino acid alterations when compared with the TGFBI cDNA. 

Results

Clinical Findings

The affected members had several refractile lattice-like corneal stromal deposits characterized by branching and nonbranching lattice figures resembling pipe stems. These individuals also had delicate filamentous and discrete, short, irregularly shaped stromal deposits, along with corneal haze. Of note, the affected members of this family often had LCD diagnosed in the third or fourth decade of life, with symptoms of recurrent corneal erosion. Representative clinical photographs of the corneas of affected family members (cases 6 and 13) are shown in 2 . The corneal lesions appeared as bright irregular shaped opacities within the corneal stroma by confocal microscopy 3 . 4 shows noninvasive cross-sectional images of the cornea from a normal individual and two affected individuals by OCT (cases 6 and 13). In contrast to normal cornea 4 , the corneas of the affected individuals manifested an increased reflectivity in the stroma secondary to the scattering effect of the lesions 4 4 . This technique, however, illustrated the thickness and opacification of a markedly edematous failed graft 4 . 

The clinical features of these cases are summarized in 1 . 

Histologic Analysis

The initial corneal tissue excised from the corneas of all affected individuals was similar to that reported in an earlier study on this family ²⁵ and characterized by the presence of eosinophilic, variably sized, irregularly shaped, roundish deposits of amyloid within the corneal stroma. The deposits were situated mostly in the superficial central cornea. These accumulations, when stained with Congo red, exhibited apple-green dichroism when examined under polarized light. The deposits were metachromatic with crystal violet and toluidine blue. The accumulations in most individuals were autofluorescent, when viewed under ultraviolet light and exhibited fluorescence after staining with thioflavin-T. Transmission electron microscopic examination revealed delicate nonbranching fibrils (approximately 10 nm in diameter) in random array within the accumulations. Descemet’s membrane and the corneal endothelium were unremarkable in the initial grafts in all affected eyes. In a few regrafted specimens foci of amyloid were present within the donor tissue, as previously documented in two of the cases in 1982 (cases 1 and 2) ²⁶ ; however, most of the repeated grafts were for graft failure and bullous keratopathy was associated with deficient corneal endothelial cells, and amyloid deposition was not apparent in the originally grafted tissue. 

Molecular Genetic Analyses

Sequencing of exon 12 of the TGFBI gene in affected individuals disclosed two unique heterozygous nucleotide changes (substitutions of cytosine for adenosine at both nucleotides 1637 and 1652) that cosegregated with LCD in all affected individuals investigated (five males and three females): Neither of them was detected in six consenting members of the family who did not have LCD type I 5 . These nucleotide changes are predicted to change alanine to aspartic acid at codon 546 (A546D) and proline to glutamine at codon 551 (P551Q). We have not detected the P551Q change in an analysis of the TGFBI gene in more than 200 individuals, and others have not reported it in persons without corneal disease. In addition, we found another heterozygous single-nucleotide substitution (cytosine for thymine at position 1620) of exon 12 in this family, which neither cosegregated with the keratopathy nor changed the encoded phenylalanine (F540F). It is noteworthy that the site of most mutations in TGFBI that cause LCD (codon 124 of exon 4) was normal in all individuals. No other abnormalities were detected in an analysis of the entire coding region of case 6. 

Discussion

Because the two heterozygous nucleotide changes in exon 12 of TGFBI not only cosegregated with LCD type 1 in the family studied, but were also predicted to change two amino acids in the Fas4 domain of the encoded TGFβ-induced protein, it seems likely that one or both of these nucleotide changes are important disease-producing mutations. In this regard, it is noteworthy that other nucleotide changes at this site lead to corneal amyloidosis, but with different clinical phenotypes. ^{3 20 27} We recently discovered an association between the A546D mutation in TGFBI and corneal polymorphic amyloidosis. ²⁸ Clearly this change in codon 546 is sufficient to cause amyloid deposition within the cornea in the absence of the P551Q change. However, despite the fact that LCD and polymorphic corneal amyloidosis are both characterized by a deposition of amyloid within the corneal stroma, the phenotypes are different. LCD type I is typified by prominent delicate linear opacities that tend to be mainly in the superficial corneal stroma, with epithelial erosions being a common complication. The amyloid deposits in polymorphic corneal amyloidosis differ not only in appearance, but also in the site at which the amyloid initially becomes deposited. In the latter condition the variably shaped opacities first appear in the deep corneal stroma. The reason that the amyloid in these phenotypically dissimilar conditions accumulates in different sites and with variable shapes remains to be determined. The P551Q mutation may play a role in this regard, but an effect of yet to be identified modifier genes remains a possibility. Dighiero et al. ²⁷ reported A546T in a family with “ropy and thick lattice lines located predominantly in the central corneas, some nodular opacities, a diffuse haziness between the lines” and a history of recurrent epithelial erosions. Further studies on other families are needed to determine whether one or both of the nucleotide changes is significant in the pathogenesis of LCD type I. 

All inherited corneal disorders caused by mutations in TGFBI are associated with an extracellular deposition of protein within the cornea. In these conditions, the protein probably represents the entire mutated TGFβ-induced protein or a part of it. In many of these conditions, evidence to support this hypothesis has been obtained immunohistochemically, ²⁹ but in most of these disorders an indication of its identity has not been established with certainty. The nature and source of the amyloid that occurs in individuals with mutations in the TGFBI gene has been a subject of interest to several laboratories. Attempts have been made to identify the nature of the amyloid deposits in these inherited disorders, using immunohistochemical and biochemical analytical methods. We have shown that the amyloid deposits in LCD type I, and other abnormal proteinaceous accumulations in corneal dystrophies caused by mutations in the TGFBI gene, cross react with antibodies to TGFβ-induced protein. ³⁰ Using indirect antibody-based methods Korvatska et al. ³¹ concluded that the deposits in the R124L mutation were full-length TGFBIp and a COOH-terminal fragment of TGFBIp. Using mass spectrometry; however, Hedegaard et al. ⁴ found that corneas with the R124L mutation accumulated vast quantities of a normal-sized TGFBIp and 40-kDa fragments of TGFBIp that lacked parts of the NH2- and COOH-terminals. Because TGFBI is normally transcribed in the corneal epithelium, where it is preferentially expressed on the corneal external surface, ⁷ the corneal epithelium is suspected of being a major source of the amyloid that accumulates in LCD type I. 

Mutations in the TGFBI gene are responsible for a variety of inherited corneal stromal diseases. ³² At least 15 different mutations in TGFBI are accompanied by amyloid deposition in the cornea in families with different clinical variants of LCD (R124C, R124H, L518P, P501T, L527R, A546T, L569R, A622H, H620R, H626R, L527R, A546T, A546D, H620R, 9-bp insertion at nt1885-1886 and missense at nt 1887) ^{32 33} or polymorphic corneal amyloidosis. ²⁸ The most common amyloidogenic mutation in TGFBI (R124C) is on the N-terminal side of its Fas1 domain, ^{3 34} but others are in the Fas3 domain (P501T) ³⁵ and, particularly, the Fas4 domain (L518P, ^{10 24 36 37} L527R, ^{9 10 27 38 39} A546T, ^{16 22 27} L569R, ³³ H620R, ¹⁶ A622H, ⁴⁰ H626R, ^{22 40} 9-bp insertion at nt1885-1886, and missense at nt 1887 ⁴¹ ). Both of the nucleotide changes in our reported family involve the Fas4 domain. In persons with the R124H mutation, the amyloid deposition is accompanied by an associated accumulation of fuchsinophilic material that has a characteristic crystalloid appearance by transmission electron microscopy. Surprisingly, amyloid deposition is not a feature of the R124L or A124S mutations. ^{32 42} The reason that amyloid deposition is a prominent manifestation of certain, but not all, TGFBI mutations remains to be established. 

 Supported by Grant R01EY2712 from the National Eye Institute. NAA is the recipient of a Research Career Development Award from Research to Prevent Blindness.

 Submitted for publication November 11, 2003; revised January 6, 2004; accepted January 6, 2004.

 Disclosure: G.K. Klintworth, None; W. Bao, None; N.A. Afshari, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Figure 1.

 

Pedigree of family with lattice corneal dystrophy showing affected and unaffected persons as well as indicating individuals in whom the TGFBI gene was analyzed. Affected individuals were heterozygous for both A546D and P551Q (individuals II-4, III-1, III-3, III-10, IV-1, and IV-2). Some affected and unaffected members of the family had an inconsequential polymorphism (F5440F) in the TGFBI gene (individuals II-4, III-6, III-8, III-9, IV-1, IV-2, IV-3, IV-5, V-1, and V-2). This polymorphism was homozygous in four individuals (III-9, IV-3, V-1, and V-2).

Table 1.

 

 

Summary of the Clinical Findings in the Affected and Unaffected Family Members

Table 1.

 

Summary of the Clinical Findings in the Affected and Unaffected Family Members

Case	Family	TGFBI Analysis	TGFBI Amino Acid Change	Status	Tissue Diagnosis	Current Age (y)	Age of Onset (y)	Age at Corneal Graft Left Eye (y)	Age at Corneal Graft Right Eye (y)	Recurrence in Graft	Remarks
1	II1	No	N/A*	Affected	Yes	74, † (deceased)	17	36	39	Yes
2	II3	No	N/A	Affected	Yes	62 (deceased)	22	31	31	Yes	Case 2 in Klintworth et al.26
3	II4	Yes	F540F	Affected	Yes	79	28	35	37	Yes	Case 1 in Klintworth et al.26
			A546D
			P551Q
4	II6	No	N/A	Affected	Yes	75 (deceased)	∼20	36	41	Yes
5	III1	Yes	A546D	Affected	Yes	51	32	38	50	Yes
			P551Q
6	III3	Yes	A546D	Affected	Yes	54	31	37	47	Yes
			P551Q
7	III6	Yes	F540F	Not affected	N/A	55	N/A	N/A	N/A	N/A
8	III8	Yes	F540F	Not affected	N/A	60	N/A	N/A	N/A	N/A
9	III9	Yes	F540F	Not affected	N/A	50	N/A	N/A	N/A	N/A
10	III10	Yes	A546D	Affected	Yes	47	22	26	23	Yes
			P540F
11	III11	No	N/A	Affected	Yes	69	25	32	36	Yes
12	IV1	Yes	F540F	Affected	Yes	36	34	N/A	N/A	N/A
			A546D
			P551Q
13	IV2	Yes	F540F	Affected	Yes	35	30	N/A	N/A	N/A
			A546D
			P551Q
14	IV3	Yes	F540F	Not affected	N/A	47	N/A	N/A	N/A	N/A
15	IV5	Yes	F540F	Not affected	N/A	42	N/A	N/A	N/A	N/A
16	V1	Yes	F540F	Not affected	N/A	28	N/A	N/A	N/A	N/A
17	V2	Yes	F540F	Not affected	N/A	27	N/A	N/A	N/A	N/A

* Not applicable.

† Age at death.

Table 2.

 

 

Summary of the Primers and Annealing Temperatures Used for the Amplification of the 17 Exons of the TGFBI Gene

Table 2.

 

Summary of the Primers and Annealing Temperatures Used for the Amplification of the 17 Exons of the TGFBI Gene

Exon	Primers	Sequence	Annealing Temp (°C)	References
1	1F	GCGCTCTCACTTCCCTGGAG	55	Afshari et al.20
	1R	GACTACCTGACCTTCCGCAG
2	2F	GGTGGACGTGCTGATCATCT	55	Afshari et al.20
	2R	AGCCAGCGTGCATACAGCTT
3	3F	ACCTGTGAGGAACAGTGAAG	55	This study
	3R	GCCTTTTATGTGGGTACTCC
4	4F	CCCCAGAGGCCATCCCTCCT	58	Munier et al.8
	4R	CCGGGCAGACGGAGGTCATC
5	5F	TAAACACAGAGTCTGCAGCC	55	Munier et al.8
	5R	TTCATTATGCACCAAGGGCC
6	6F	TGTGTTGACTGCTCATCCTT	50	Munier et al.8
	6R	CATTCAGGGGAACCTGCTCT
7	7F	TTCAGGGAGCACTCCATCTT	55	Munier et al.8
	7R	ATCTAGCTGCACAAATGAGG
8	8F	CTTGACCTGAGTCTGTTTGG	55	Afshari et al.20
	8R	GAAGTCGCCCAAAGATCTCT
9	9F	ACTTTTGAACCCACTTTCTC	55	Munier et al.8
	9R	CAATCTAACAGGGATGCCTT
10	10F	TCTGGACCTAACCATCACCC	55	Munier et al.8
	10R	CAGGAGCATGATTTAGGACC
11	11F	CTCGTGGAAGTATAACCAGT	55	Modified from Munier et al.8
	11R	TGGGCAGAAGCTCCACCCGG
12	12F	CATTCCAGTGGCCTGGACTCTACTATC	58	Munier et al.3
	12R	GGGGCCCTGAGGGATCACTACTT
13	13F	GGGATTAACTCTATCTCCTT	50	Afshari et al.20
	13R	TGTGTATAATTCCATCCTGG
14	14F	CTGTTCAGTAAACACTTGCT	58	Munier et al.3
	14R	CTCTCCACCAACTGCCACAT
15	15F	CACTCTGGTCAAACCTGCCT	55	Munier et al.8
	15R	AGGCTAGGCGCAAACCTAGC
16	16F	CAGTTGCAGGTATAACTTTC	50	Munier et al.8
	16R	TAAACAGGTCTGCAATGACT		Modified from Munier et al.8
17	17F	GGGAGATCTGCACCTATTTG	55	Afshari et al.20
	17R	TGGTGCATTCCTCCTGTAGT

Figure 2.

 

Clinical photographs of corneas in two representative affected family members. (A, B) Case 13 at 35 years of age, showing a network of linear opacities associated with other smaller opaque spots. (C, D) Appearance of corneal grafts in case 6 at 54 years of age. The left cornea (C) contains opacifications from presumed recurrent disease 10 years after a penetrating keratoplasty. The right eye (D) contains a markedly opaque vascularized failed graft after numerous penetrating keratoplasties.

Figure 3.

 

Images of the stroma of a normal cornea and of two representative corneas of affected family members (cases 6 and 12) by confocal microscopy. (A) The normal anterior corneal stroma illustrating a regular pattern of keratocytes. (B) Posterior corneal stroma of normal cornea. Variable shaped opacities are shown as bright deposits within the corneal stroma of a nongrafted cornea in case 12 (C) and within the corneal graft of the right eye of case 6 with probable recurrent disease (D).

Figure 4.

 

Images of the normal cornea and of corneas of two affected family members, by OCT. (A) OCT scan of a normal cornea showing minimal reflectivity within the corneal stroma. (B) OCT scan of patient 6 at 54 years of age showing an increased reflectivity within the corneal stroma because of the corneal opacities. (C) OCT scan of corneal graft of right eye in patient 6 showing markedly increased reflectivity due to probable recurrent disease within the graft. (D) OCT scan of a failed, opaque corneal graft in the left eye of patient 6, showing increased reflectivity throughout a markedly thickened cornea. The anterior curve corresponds to a bandage contact lens.

Figure 5.

 

Partial nucleotide sequences of exon 12 of the TGFBI gene in affected and unaffected family members. (A) Sequence in affected person, showing the presence of heterozygous substitutions of cytosine for adenosine in nucleotides 1637 and 1652, which is predicted to alter amino acids at codons 546 (A546D) and 551 (P551Q). (B) Unaffected family members and the general population lack these nucleotide changes.

 

The authors thank Greg Hofmeyer, manager of the OCT reading center, Duke University Eye Center, who obtained all OCT images.