Absence of SIX6 Mutations in Microphthalmia, Anophthalmia, and Coloboma

Abstract

purpose. To investigate whether 173 patients with microphthalmia, anophthalmia, and coloboma have mutations in the eye-development gene SIX6.

methods. The two exons of the SIX6 gene were amplified by PCR from patients’ genomic DNA and directly sequenced to search for mutations. The PCR products of 75 patients were also analyzed by denaturing high-performance liquid chromatography (DHPLC).

results. Six SIX6 polymorphisms were identified in the patient panel. Three of these polymorphisms change the encoded amino acid. However, all six polymorphisms were also identified in unaffected individuals. There was no statistically significant difference in genotypes between patients and control subjects.

conclusions. No evidence was found that SIX6 mutations underlie human congenital structural eye malformations.

Microphthalmia, anophthalmia, and coloboma (MAC) are congenital structural eye malformations that are typically associated with significant visual morbidity. A retrospective epidemiologic study of the incidence of MAC in Scotland gave a prevalence of 1.9 cases per 10,000 live births. ¹ A study of eye malformations in more than 200,000 consecutive live births gave a prevalence rate per 10,000 live births of 1.7 for microphthalmia, 0.23 for anophthalmia, and 1.4 for coloboma. ²  

Mutations in the autosomal CHX10, MAF, PAX6, PAX2, RAX, SHH, SIX3, and SOX2 genes have all been shown to underlie MAC phenotypes. ^{3 4 5 6 7 8 9 10 11} However, none of these can be considered a major MAC gene, because in each cohort of patients examined, mutations were found in only a small proportion of affected individuals. This indicates that MAC phenotypes are highly heterogeneous at the genetic level, reflecting the molecular complexity of eye development. ^{12 13} It seems likely that many other MAC genes remain to be uncovered. 

The SIX6 gene is an attractive candidate MAC gene on the basis of expression pattern, genomic map location, and functional studies. SIX6, also known as OPTX2, is a member of the Six family of transcriptional regulatory genes. SIX genes are highly conserved and have been implicated in a wide variety of developmental processes and diseases. ^{14 15} All Six proteins share two highly conserved motifs: a Six domain that is involved in protein–protein interactions and a homeodomain that binds DNA. ¹⁴ The human Six6 protein is 246 amino acids long and consists of an N-terminal peptide of 11 amino acids, a Six domain of 115 amino acids, a homeodomain of 60 amino acids, and a C-terminal domain of 60 amino acids. ¹⁶ The transcribed part of the gene is 1391 bp and spans two exons. ¹⁶ The SIX6 gene maps to 14q23, where it is found in a cluster with SIX1 and SIX4 (http://www.ensembl.org/). ¹⁷  

The ocular expression pattern of Six6 has been investigated in Xenopus, chick, and mouse. ^{18 22} Six6 is expressed in the eye field before the optic vesicle develops. ^{18 19} It is subsequently expressed in the optic stalk primordia, then in the ventral optic stalk and ventral prospective neural retina, ^{18 19 20} and later still, in the whole neural retina. ^{20 21 22}  

The Six6 protein is a tissue-specific transcriptional regulator that has been shown to interact directly with the corepressor proteins Tle1 (a member of the Groucho repressor family) and Dach1. ^{21 23} Six6 represses the promoter of P27Kip1, a cyclin-dependent kinase inhibitor gene, which is itself an inhibitor of retinal cell proliferation. ²¹ When overexpressed in the developing eye, the Six6 gene can cause a dramatic increase in ocular size, ¹⁸ and when ectopically expressed, it can induce development of ectopic eye tissue. ²⁴  

Interstitial deletions of human chromosome 14 at q22-q23 are consistently associated with anophthalmia. ^{16 25 26 27 28} Genomic analyses in one of the patients with the deletion demonstrated SIX6 hemizygosity, suggesting that SIX6 haploinsufficiency can result in failure of eye development. ¹⁶  

Given the expression pattern of Six6 in other species and the location of the SIX6 gene within the human anophthalmia deletion interval, we hypothesized that mutations of the SIX6 gene may underlie MAC phenotypes. We looked for intragenic SIX6 mutations in a panel of 173 patients with MAC. 

Materials and Methods

Patients

Studies involving human subjects were performed in accordance with the tenets of the Declaration of Helsinki. We began by examining a cohort of 98 patients with MAC phenotypes (from DM, DFP, and VvH), but during the course of the study a second cohort of 75 patients became available (from NR and RC), giving a total of 173 affected individuals. The range of phenotypes was similar in both cohorts and tended to be toward the more severe end of the spectrum. Where possible, diagnoses were based on ultrasound scan data. Microphthalmia was diagnosed when the axial length of the globe was >2.5 standard deviations below the mean for age. Phenotypes are shown in Table 1 . 

Genomic DNA Extraction

Genomic DNA was prepared from peripheral blood samples using a DNA extraction kit (Nucleon; Tepnel Life Sciences, Manchester, UK). 

PCR Amplification of SIX6 Exons 1 and 2

For the patients in cohort 1, the whole coding region of exon 1 and the whole of exon 2, including the 3′ untranslated region, were amplified by PCR. For the patients in cohort 2, the whole coding region of exon 1 was amplified but the exon 2 amplicon was reduced in size and contained the coding region and the first 290 bases of the 3′ untranslated region. In addition, the DNA of patients in cohort 2 was amplified by nested PCR to improve the yield of product from this very GC-rich gene. 

In this study, the positions of all PCR primers were based on the BAC sequence AL122057, which contains the SIX6 gene and flanking DNA. Within AL122057 the SIX6 transcriptional start site is at position 159289 and the initiation codon begins at position 159384. ¹⁶ PCR primers are shown in Table 2 . 

For patients in cohort 1, exon 1 of the SIX6 gene was amplified as follows. Fifty nanograms of genomic DNA were amplified in a volume of 50 μL containing 1× PCR buffer (HotStarTaq; Qiagen, Crawley, UK), 10 μL Q solution (Qiagen), 0.2 mM dNTPs, 250 nM primer 062, 250 nM primer 063, and 2 U polymerase (HotStarTaq; Qiagen). PCRs were then performed (PTC225 system; MJ Research Inc., Waltham, MA). PCR conditions were 95°C for 15 minutes, 1 cycle; 94°C for 1 minute, 56°C for 1 minute, and 72°C for 1 minute, 35 cycles; and 72°C for 10 minutes, 1 cycle. Exon 2 was amplified with the same conditions, except the primers were 064 and 065. 

For patients in cohort 2, exons 1 and 2 of the SIX6 gene were amplified by nested PCR as follows: For exon 1, 50 ng genomic DNA was amplified in a volume of 50 μL containing 1× PCR buffer (HotStarTaq; Qiagen), 10 μL Q solution, 0.2 mM dNTPs, 250 nM forward primer 091, 250 nM reverse primer 165, and 2 U polymerase (HotStarTaq; Qiagen). PCR conditions were 95°C for 15 minutes, 1 cycle; 94°C for 30 seconds, 61°C for 30 seconds, and 72°C for 1 minute, 30 cycles; and 72°C for 5 minutes, 1 cycle. The primary PCR product was then diluted 1:50 with water. 

The secondary PCR reaction contained the same reagents as the primary reaction, except that the nested oligos 062 (forward) and 166 (reverse) were used, and the template was 5 μL of diluted primary product. PCR conditions were 95°C for 15 minutes, 1 cycle; 94°C for 30 seconds, 65°C for 30 seconds, and 72°C for 1 minute, 30 cycles; and 72°C for 5 minutes, 1 cycle. 

The exon-2 PCR reactions were performed as for exon 1, with the following modifications. The primary PCR primers were 121 (forward) and 065 (reverse), and the secondary primers were 064 (forward) and 122 (reverse). For the primary PCR, conditions were 95°C for 15 minutes, 1 cycle; 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute, 30 cycles; and 72°C for 5 minutes, 1 cycle. For the secondary PCR, conditions were 95°C for 15 minutes, 1 cycle; 94°C for 30 seconds, 59°C for 30 seconds, and 72°C for 1 minute, 30 cycles; and 72°C for 5 minutes, 1 cycle. 

After PCR, the products were run on a 2% agarose gel to ensure adequate yield and to check for the absence of nonspecific products. Before sequencing or genotyping, PCR primers and dNTPs were removed as follows. Five microliters of PCR product was incubated with 1 μL of exonuclease I and shrimp alkaline phosphatase enzyme mix (ExoSapIT; USB, Cleveland, OH) for 45 minutes at 37°C, followed by 20 minutes at 80°C, for enzyme inactivation. 

Direct Sequencing

Sequencing was performed in a 96-well plate, with PCR products synthesized and cleaned as described earlier. For cohort 1, sequencing primers were 062 and 063 for exon 1 and 064 and 065 for exon 2 (Table 2) . Cohort 1 sequencing reactions were performed commercially (MWG Biotech UK, Ltd., Milton Keynes, UK) using the “value read” service. For cohort 2, sequencing primers were 061 and 166 for exon 1 and 064 and 122 for exon 2 (Table 2) . Cohort 2 sequencing reactions were performed in-house as follows. 

The cleaned PCR reaction (6 μL) was mixed with 2 μL dye terminator (BigDye Terminator; Applied Biosystems [ABI], Foster City, CA), 1 μL water, and 1 μL of sequencing primer (3.2 μM) and cycled as follows: 95°C, 30 seconds; 52°C, 20 seconds; and 60°C, 3 minutes for 40 cycles. Sequencing products were precipitated with 100% ethanol, washed with 70% ethanol, and air dried. Sequencing reactions were run on commercial systems (model 377 or 3730; ABI). Before loading, reactions were resuspended in formamide and loading dye (model 377; ABI) or in formamide alone (model 3730; ABI). 

For both cohorts, individual sequence traces were inspected by computer (Chromas; Technelysium Pty. Ltd., Tewantin, Australia). Multiple sequence traces were aligned and compared using programs from the Phrap/Consed package (http://www.phrap.org/index.html/ provided in the public domain by the Laboratory of Phil Green, Genome Sciences Department, Howard Hughes Medical Institute, University of Washington, Seattle, WA). All sequence variants were confirmed by independent PCR and sequence analysis of the patient’s DNA. Parental DNAs were examined when available. 

DHPLC Analysis

PCR products from patients in cohort 2 were further screened by heteroduplex-based mutation analysis using denaturing high-performance liquid chromatography (DHPLC; WAVE System DHPLC, with running conditions determined by WAVEMAKER 3.4.4 software; Transgenomic Inc., Omaha, NE). Exon 1 was screened at 63°C, 65°C, and 66°C, and exon 2 at 60°C, 63°C, and 66°C. 

Analysis of Control DNAs

Control DNAs were from apparently healthy adults and were maintained anonymously. Control individuals were not subjected to eye examination but matched the patients in ethnicity. Genomic DNA from 131 control subjects was amplified by PCR and examined for the presence of the six single nucleotide polymorphisms (SNPs) by a combination of sequencing and Snapshot genotyping. Snapshot analysis was performed on cleaned PCR products (Snapshot system; ABI) as described by Le Hellard et al. ²⁹ Genotyping primers are shown in Table 3 . 

The Fisher Exact Test

SNP frequencies were compared between the patient and control groups using the Fisher exact test (for the four SNPs where two different genotypes were observed), or a variant of the Fisher exact test, the Fisher 2 × 5 (for the two SNPs where three different genotypes were observed). The Fisher exact test calculation was performed using a tool available on the Internet (http://www.matforsk.no/ola/fisher.htm/ developed by Oyvind Langsrud and provided in the public domain by Matforsk AS, Norwegian Food Research Institute, Osloveien, Norway). The 2 × 5 calculation was performed using another tool (http://home.clara.net/sisa/fiveby2.htm/ Simple Interactive Statistical Analysis [SISA]developed by Daan Uitenbroek, Research and Statistical Consultancy, Hilversum, the Netherlands). 

Results

Mutation analysis of 173 MAC patients revealed six sequence variants, all single-nucleotide substitutions (Table 4) . Five of these are in the coding region and the sixth is in the 3′ untranslated region (Fig. 1) . Three of the substitutions cause an amino acid change. From here on, we will refer to all six substitutions as SNPs. Although we analyzed the patients in two separate cohorts, all individuals were assayed for the same six single nucleotide substitutions, and the data from the two groups were pooled. 

To determine whether these SNPs were present only in the affected individuals, we analyzed 131 control DNAs and the parents, when available. 

The first SNP, 116G→A, is located in the third base of codon 7 and results in the synonymous substitution of TTA (Leu) for TTG (Leu) (Fig 1) . This change has been reported previously. ¹⁶ Seven patients and six control subjects were heterozygous for this SNP (Table 5) . 

The second SNP (480G→A) has not been reported before and causes the amino acid change glutamate (GAA) to lysine (AAA) at codon 129 (Fig 1) , which is the second codon in the homeobox. Two patients were found to be heterozygous for this change. The first was a boy with bilateral colobomata of the retinas, maculae, and optic discs. He also had an abnormal left iris, left microphthalmia, and nystagmus. He had mild pectus excavatum, mild craniofacial dysmorphism, and mild learning difficulties. The other was a girl with unilateral (left-side) coloboma of the iris, retina, and macula. She has detachment of the left retina. Her right eye was normal, and there are no extraocular anomalies. 

Glutamic acid is found at the second position in all known SIX homeodomains from Caenorhabditis elegans to humans. ^{30 31} The absolute conservation of glutamate at this position and its nonconservative substitution by lysine, strongly suggested that this might be a pathologic mutation. However, the same change was found in two control subjects (Table 5) and in the father of the affected boy. The father’s eyes were examined and found to be normal. (The parents of the second patient were not available for analysis.) It is therefore very unlikely that this is a causative mutation. 

The third SNP (516A→C) is also located in the homeobox and causes the amino acid asparagine (AAC) to change to histidine (CAC) at codon 141 (Fig 1) . 516A→C was a common polymorphism in patients and control subjects (Table 5) and has been reported previously. ¹⁶ This amino acid, at position 14 of the homeodomain, is very poorly conserved when the sequences of different Six proteins are compared, and it is evident that many different residues are tolerated at this location. ^{30 31}  

The fourth SNP (709T→G) is located in the C-terminal domain and causes the amino acid leucine (CTA) to change to arginine (CGA) at codon 205 (Fig 1) . In general, the C-terminal domain is very poorly conserved between different Six proteins. However, there is some homology between the C-terminal domains of Six6 and Six3 proteins from different vertebrates, and when these are compared, it can be seen that leucine 205 is highly conserved ^{16 22} (Hanson I, unpublished results, 2003). One patient was heterozygous for this SNP (Table 5) , a man with unilateral microphthalmia. He also had testicular cancer. His mother and his son both had unilateral microphthalmia, and both had the common T/T genotype. Therefore, there is no concordance between genotype and phenotype in this family. Two control subjects had the 709T→G change (Table 5) . 

The fifth SNP (731G→C) is located in the C-terminal domain and causes the synonymous replacement of ACG (Thr) by ACC (Thr) at codon 212 (Fig 1) . This change was found in one patient (Table 5) , a male with left-side anophthalmia and right-side optic nerve hypoplasia. He also has a left facial cleft, absent left naris, left clefting of lip and palate, abnormal left ear, and basal encephalocele. The 731G→C change was not detected in any of the control subjects; however, it was present in the patient’s father. The father had not had a full eye examination but had attended clinic, was of completely normal appearance, and had no reported visual problems. It is therefore very unlikely that this synonymous substitution is a causative mutation. 

The final SNP (937G→C) is located in the 3′ untranslated region, 101 bases downstream of the stop codon (Fig 1) . This is a common polymorphism (Table 5) and is present as rs1061108 in the National Center for Biotechnology Information (NCBI) SNP database (http://www.ncbi.nlm.nih.gov/ provided in the public domain by NCBI, Bethesda, MD). 

Having obtained genotype data for the six substitutions in the control and patient panels, we compared the two groups to see whether the frequency of any of the nucleotide changes was significantly different. A significant difference might indicate that a particular substitution predisposes to disease or is in linkage disequilibrium with a causative mutation, perhaps in the control regions of the gene that were not analyzed in the current study. We used the Fisher exact test for 116G→A, 480G→A, 709T→G, and 731G→C, and Fisher 2 × 5 for 516A→C and 937G→C. There was no statistically significant difference between the two groups (Table 5) . 

The 75 patients in cohort 2 were screened for sequence variants by both DHPLC and direct sequencing. In this study, direct sequencing gave the best detection efficiency. The exon 1 SNPs were resolved poorly by DHPLC, probably because this is a long, GC-rich amplicon. In exon 2, DHPLC analysis clearly detected the 709T→G and 937G→C changes but failed to pick up the 731G→C change. We confirmed that the 731G→C change was not a sequencing artifact by direct sequencing of independent PCR products and by genotyping (SNaPshot; ABI). 

Discussion

We looked for mutations of the SIX6 gene in 173 patients with congenital structural eye malformations in the MAC spectrum. Phenotypes ranged from bilateral anophthalmia to unilateral coloboma. Descriptive terms such as “bilateral microphthalmia” can cover a wide range of phenotypes, from a very small disorganized eye to a mildly abnormal eye, to significant asymmetry. However, many of our patients were toward the severe end of the spectrum. 

We did not find any evidence of clearcut pathologic mutations, such as nonsense mutations, disruption of splice sites, creation of cryptic splice sites, and frame-shift insertions or deletions, all of which are common mechanisms by which one allele of a gene can be inactivated. 

We identified six different single nucleotide substitutions in the gene, three of which resulted in an amino acid change. One of the substitutions, 480G→A, resulted in the replacement of glutamate at position 2 in the homeodomain by lysine. Glutamate is found at this position in all Six-family homeodomains. ³⁰ A priori, this seemed a likely pathologic mutation, as missense mutation of highly conserved residues is a well-established mechanism of human genetic disease, ³² including congenital eye malformations. ^{33 34} However, the same change was found in the normal father of one of the patients and with identical frequency in control subjects. To our knowledge, mutations affecting the second homeodomain codon in other homeobox genes have not been described. 

There is increasing awareness of oligogenic mechanisms of disease inheritance, in which mutations at two loci are necessary for expression of the disease phenotype. ³⁵ The requirement for mutations at two loci can result in non-Mendelian patterns of inheritance, as is frequently observed for MAC phenotypes,and could also explain how a mutation can be passed from parent to child with discordance in phenotype. In Bardet-Biedl syndrome, where triallelic inheritance has been demonstrated in a number of families, missense mutations are common, suggesting that certain “weak” or hypomorphic alleles, which are present in the normal population and appear to have no effect individually, may be pathologic when combined. ^{36 37} An oligogenic model of MAC etiology, with SIX6 as one of the contributing loci, could explain many of our observations. However, it would be expected that the frequency of any pathologic variant would be significantly enriched in the patient cohort, ³⁷ and this was not observed in our study. All six SNPs were found in both patients and controls and/or unaffected parents. Furthermore, there was no statistically significant difference in the genotype frequencies between the two groups. Consequently, there is no evidence that these changes predispose toward congenital eye malformations. 

Recent data have shown that Six6 may be involved relatively late in eye development. In Xenopus, Six6 appears to act downstream of other eye development genes such as Pax6, Rx/Rax and Six3. ¹³ Evidence is also emerging that SIX6 is expressed in the adult eye and other adult tissues, suggesting an unascertained function that spans late developmental processes and that may be important in the stable postdevelopmental phenotype in these tissues (Aijaz S, Clark BJ, Hanson I, manuscript in preparation). Furthermore, homozygous Six6 knockout mice were recently generated and found to have a phenotype of pituitary hypoplasia, retinal hypoplasia, and anomalies of the optic chiasm and optic nerve. ²¹ This phenotype is remarkably mild when compared to the human phenotype of anophthalmia that is proposed to result from deletion of just one copy of the SIX6 gene. ¹⁶ It seems unlikely therefore that the phenotype associated with 14q deletions is solely attributable to loss of one copy of SIX6 but rather may be caused by loss of several genes within the 14q22-23 region. These could include OTX2 (3.7 Mb from SIX6), which is necessary for early patterning of the eye field, ^{13 38 39} and BMP4 (6.5 Mb from SIX6), which controls optic vesicle development and lens induction. ^{40 41}  

In conclusion, the weight of evidence suggests that intragenic mutations of SIX6 are not associated with congenital structural abnormalities of the eye in the MAC spectrum. 

 Supported by a grant from the Birth Defects Foundation, United Kingdom (SA, BJC, IH). IH holds a Career Development Award from the UK Medical Research Council. NR is a Senior Surgical Scientist supported by the Academy of Medical Sciences/The Health Foundation.

 Submitted for publication June 3, 2004; revised August 2, 2004; accepted August 9, 2004.

 Disclosure: S. Aijaz, None; B.J. Clark, None; K. Williamson, None; V. van Heyningen, None; D. Morrison, None; D. FitzPatrick, None; R. Collin, None; N. Ragge, None; A. Christoforou, None; A. Brown, None; I. Hanson, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Classification of 173 Patients with MAC Phenotypes

Phenotype	No.
Bilateral anophthalmia	14
Bilateral anophthalmia with orbital cysts	4
Unilateral anophthalmia with contralateral microphthalmia	15
Anophthalmia, laterality unknown	2
Unilateral anophthalmia with contralateral normal eye or minor defect (e.g., myopia)	12
Bilateral microphthalmia	25
Bilateral microphthalmia with bilateral colobomata	16
Bilateral microphthalmia with unilateral coloboma	3
Unilateral microphthalmia with bilateral colobomata	7
Unilateral microphthalmia with unilateral coloboma (same eye)	9
Unilateral microphthalmia with contralateral coloboma	2
Unilateral microphthalmia	34
Microphthalmia, laterality unknown	2
Bilateral colobomata	11
Unilateral coloboma	9
Other (e.g., microphthalmia with contralateral retinal defect)	8

Table 2.

 

SIX6 PCR Primers

Primer	Exon	Sequence (5′–3′)	Location*
062	1 (F)	ATCAACAAGCGCCTGGCACA	159288–159307
063	1 (R)	CGGAGGCCTCTAGGTACCGA	c159957–159976
064	2 (F)	GCTGTGTTACGAGCTGTGAC	161025–161044
065	2 (R)	AGGAATCTGAGAGCAGCTCC	c161793–161812
091	1 (F)	GAAATAGTCCTGGCGTGCTG	159031–159050
121	2 (F)	CTTAACTGCTGGGGTCTTCG	160944–160963
122	2 (R)	GTTCCGAAGGAGACTTTGC	c161506–161523
165	1 (R)	CTGAATTGGAGTCGCCAGG	c160036–160054
166	1 (R)	GTAAGGGCGCCAGAGGTGC	c160010–160029

 F, forward; R, reverse.

*  Location within the genomic sequence AL122057. For reverse oligos, c indicates that the primer is complementary to the stated nucleotides.

Table 3.

 

Primers for SIX6 Genotyping

Primer	Exon	SNP	Sequence (5′–3′)	Location*
117	1	116G→A	GTTCCAGCTGCCCATCTT	159386–159404
082	1	480G→A	GAAGCAGTGTGTCTTCTGTT	c159769–159785
067	1	516A→C	ACCACTCGCGTAGCAGGT	c159804–159822
099	2	709T→G	GGGTTCCGGGCGGGCAC	161093–1611109
169	2	731G→C	GACGCCCAGCACCTCTGG	c161132–161150
114	2	937G→C	CCTGCAAATCCAGCGCCA	161320–161337

*  Location within the genomic sequence AL122057. For reverse oligos, c indicates that the primer is complementary to the stated nucleotides.

Table 4.

 

Six SNPs in the Human SIX6 Gene

SNP	Exon	Location*	Codon	Amino Acid Change
116G→A	1	N-terminal domain	7 TTG→TTA	Leu→Leu
480G→A	1	Homeodomain	129 GAA→AAA	Glu→Lys
516A→C	1	Homeodomain	141 AAC→CAC	Asn→His
709T→G	2	C-terminal domain	205 CTA→CGA	Leu→Arg
731G→C	2	C-terminal domain	212 ACG→ACC	Thr→Thr
937G→C	2	3′UTR	N/A	N/A

*  3′ UTR, 3′ untranslated region. Nucleotide numbers correspond to the SIX6 mRNA sequence. ¹⁶

Figure 1.

 

Schematic diagram of the human SIX6 gene and the six single-nucleotide substitutions identified in this study. Coding regions are represented by rectangles. The N-terminal domain is stippled, the six domain (SD) is shaded, the homeodomain (HD) is hatched, and the C-terminal domain is open. Thick lines: The 5′ and 3′ untranslated regions; thin lines: flanking and intronic DNA. Horizontal arrows: PCR primers used to amplify exons 1 and 2. The positions of the six single nucleotide substitutions are shown, together with representative sequence traces that illustrate the different genotypes observed in this study. The polymorphic position is indicated by an arrow in each case.

Table 5.

 

Genotypes of the Six SNPs in Patients and Control Subjects

SNP	Genotypes					P *
116G→A
Patients	GG = 160	GA = 7	AA = 0	1.000
Controls	GG = 120	GA = 6	AA = 0
480G→A
Patients	GG = 167	GA = 2	AA = 0	1.000
Controls	GG = 126	GA = 2	AA = 0
516A→C
Patients	AA = 59	AC = 79	CC = 31	0.904
Controls	AA = 46	AC = 63	CC = 21
709T→G
Patients	TT = 166	TG = 1	GG = 0	0.574
Controls	TT = 119	TG = 2	GG = 0
731G→C
Patients	GG = 166	GC = 1	CC = 0	1.000
Controls	GG = 124	GC = 0	CC = 0
937G→C
Patients	GG = 137	GC = 26	CC = 5	0.127
Controls	GG = 109	GC = 17	CC = 0

*  By the Fisher exact test. For all six SNPs; P > 0.05.

The authors thank the patients, their families, and their clinicians for their cooperation.