February 2005
Volume 46, Issue 2
Free
Retina  |   February 2005
Early-Onset Macular Degeneration with Drusen in a Cynomolgus Monkey (Macaca fascicularis) Pedigree: Exclusion of 13 Candidate Genes and Loci
Author Affiliations
  • Shinsuke Umeda
    From the National Institute of Sensory Organs, National Hospital Organization Tokyo Medical Center, Tokyo, Japan; the
    Department of Biomedical Science, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan; the
  • Radha Ayyagari
    Department of Ophthalmology, Kellogg Eye Center, University of Michigan, Ann Arbor, Michigan; the
  • Rando Allikmets
    Departments of Ophthalmology and Pathology, Columbia University, New York, New York; The
  • Michihiro T. Suzuki
    Corporation for Production and Research of Laboratory Primates, Ibaraki, Japan; the
  • Athancios J. Karoukis
    Department of Ophthalmology, Kellogg Eye Center, University of Michigan, Ann Arbor, Michigan; the
  • Rajesh Ambasudhan
    Department of Ophthalmology, Kellogg Eye Center, University of Michigan, Ann Arbor, Michigan; the
  • Jana Zernant
    Departments of Ophthalmology and Pathology, Columbia University, New York, New York; The
  • Haru Okamoto
    From the National Institute of Sensory Organs, National Hospital Organization Tokyo Medical Center, Tokyo, Japan; the
  • Fumiko Ono
    Corporation for Production and Research of Laboratory Primates, Ibaraki, Japan; the
  • Keiji Terao
    Tsukuba Primate Center for Medical Science, National Institute of Infectious Diseases, Ibaraki, Japan; and the
  • Atsushi Mizota
    Department of Ophthalmology, Juntendo University Urayasu Hospital, Chiba, Japan.
  • Yasuhiro Yoshikawa
    Department of Biomedical Science, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan; the
  • Yasuhiko Tanaka
    From the National Institute of Sensory Organs, National Hospital Organization Tokyo Medical Center, Tokyo, Japan; the
  • Takeshi Iwata
    From the National Institute of Sensory Organs, National Hospital Organization Tokyo Medical Center, Tokyo, Japan; the
Investigative Ophthalmology & Visual Science February 2005, Vol.46, 683-691. doi:10.1167/iovs.04-1031
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Shinsuke Umeda, Radha Ayyagari, Rando Allikmets, Michihiro T. Suzuki, Athancios J. Karoukis, Rajesh Ambasudhan, Jana Zernant, Haru Okamoto, Fumiko Ono, Keiji Terao, Atsushi Mizota, Yasuhiro Yoshikawa, Yasuhiko Tanaka, Takeshi Iwata; Early-Onset Macular Degeneration with Drusen in a Cynomolgus Monkey (Macaca fascicularis) Pedigree: Exclusion of 13 Candidate Genes and Loci. Invest. Ophthalmol. Vis. Sci. 2005;46(2):683-691. doi: 10.1167/iovs.04-1031.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. To describe hereditary macular degeneration observed in the cynomolgus monkey (Macaca fascicularis), which shares phenotypic features with age-related macular degeneration in humans, and to test the involvement of candidate gene loci by mutation screening and linkage analysis.

methods. Ophthalmic examinations with fundus photography, fluorescein angiography (FA), indocyanine green angiography (IA), electroretinography (ERG), and histologic studies were performed on both affected and unaffected monkeys in the pedigree. The monkey orthologues of the human ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes were cloned and screened for mutations by single-strand conformation polymorphism (SSCP) analysis or denaturing high-performance liquid chromatography (DHPLC) and direct sequencing in six affected and five unaffected monkeys from the pedigree and in six unrelated, unaffected monkeys. Subsequently, 13 human macular degeneration loci including these five genes were analyzed to test for linkage with the disease. Nineteen affected and seven unaffected monkeys in the pedigree were analyzed by using human microsatellite markers linked to the 13 loci.

results. Yellowish white spots were observed in the macula and fovea centralis, and in some cases the spots scattered to the peripheral retina along the blood vessels. FA showed hyperfluorescence corresponding to the dots except in the foveola. No anomalies were found by IA and ERG. Histologic studies demonstrated that the spots were drusen. Mutation analysis of the ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes identified a few sequence variants, but none of them segregated with the disease. Linkage analysis with markers linked to these five genes and an additional eight human macular degeneration loci failed to establish linkage. Haplotype analysis excluded the involvement of the 13 candidate loci for harboring the gene associated with macular degeneration in the monkeys.

conclusions. Significant homology was identified between monkey and human orthologues of the five macular degeneration genes. Thirteen loci associated with macular degeneration in humans or harboring macular degeneration genes were excluded as causal of early-onset macular degeneration in the monkeys. It is likely that none of these loci, but rather a novel gene, is involved in causing the observed phenotype in this monkey pedigree.

The inherited macular dystrophies comprise a heterogeneous group of blinding disorders characterized by central visual loss and atrophy of the macula and underlying retinal pigment epithelium (RPE). 1 The complexity of the molecular basis of monogenic macular disease is being elucidated through identification of many of the disease-causing genes. 2 3 4 5 6 7 8 Because of limitations associated with studies in humans, nonhuman species with phenotypes similar to human macular degeneration have been used as model systems to study these diseases. Rodent models generated by altering the genes homologous to the disease-causing genes in humans are most extensively used in such studies; however, rodents do not have a defined macula and, hence, the clinical symptoms observed in humans with macular degeneration cannot be fully replicated. 9 10 11 Because the macula is found only in primates and birds, a monkey model of macular degeneration would be extremely valuable for studies elucidating the mechanism and etiology underlying these diseases. A primate model for macular degeneration is much needed to develop sensitive diagnostic techniques and potential therapeutic strategies to cure or prevent the disease. Furthermore, such models are of particular value if their genetic basis is understood. 
Macular degeneration in monkeys was first described by Stafford in 1974. 12 He reported that 31 (6.6%) of eyes of elderly monkeys showed pigmentary disorders and/or drusen-like spots. In 1978, El-Mofty et al. 13 reported a high incidence (50%) of maculopathy in a closed rhesus monkey colony at the Caribbean Primate Research Center of the University of Puerto Rico. The latest report from the center states that specific maternal lineages have a statistically significant higher prevalence of drusen. 14 Although they suspected the involvement of hereditary factors, genetic analysis of the macaque population has not been reported. 
We have reported a high incidence of macular degeneration in one of the cynomolgus monkey (Macaca fascicularis) colonies at the Tsukuba Primate Center. 15 16 This macular degeneration originated from one affected male monkey, which showed phenotypic characterization of macular degeneration. The disease affects the central retina specifically, with yellowish white dots in the macula and lipofuscin deposits in the RPE, consistent with the phenotype observed in the early stages of age-related macular degeneration (AMD). These symptoms appear at the age of ∼2 years and progress slowly throughout life. Mating experiments have demonstrated that this familial macular degeneration is segregating as an autosomal dominant trait. 17  
AMD is currently considered a multifactorial disorder involving both environmental and genetic factors. Recent studies have substantiated the evidence for AMD as a complex genetic disorder in which one or more genes contribute to an individual’s susceptibility to the development of the disease. 18 19 20 To date, full-genome scan studies have indicated that some regions of the genome harbor AMD-predisposing genes. 21 22 However, most genes associated with susceptibility to AMD have not been identified, presumably because of a complex pattern of inheritance, late age of onset, and difficulties in obtaining large pedigrees for standard linkage analysis. Genes implicated in monogenic macular dystrophies that occur earlier in life with a clear pattern of inheritance have been considered as good candidates for susceptibility to AMD. 23 24 25 26 To date, 15 macular degeneration genes have been linked or cloned for human macular degeneration (RetNet; http://www.sph.uth.tmc.edu/Retnet/home.htm; provided in the public domain by University of Texas Houston Health Science Center, Houston, TX). However, with the exception of ABCA4, none of these genes has shown a convincing association with AMD. 
Because the monkey macular degeneration model we present here shares phenotypic similarities with the early stages of AMD, the identification of the gene involved in this monkey pedigree may provide critical clues to the understanding of the mechanism of AMD. In this study, monkey orthologues of the human genes responsible for Stargardt macular degeneration 1 (ABCA4), 2 Best macular degeneration (VMD2), 3 7 Doyn honeycomb dystrophy (EFEMP1), 4 Sorsby fundus dystrophy (TIMP3), 5 and Stargardt macular degeneration 3 (ELOVL4) 6 8 were cloned and screened for mutations in the affected monkeys. Subsequently, 13 human macular degeneration loci, including these five genes, were analyzed to test for linkage with the disease in the pedigree. During this process, we evaluated the nature and utility of human microsatellite markers in the cynomolgus monkey for linkage studies. This article also describes the gene structure and evolutionary conservation of the five human macular degeneration genes in the cynomolgus monkey. 
Materials and Methods
Maintenance of Monkeys
The cynomolgus monkeys in the pedigree with macular degeneration were reared at the Tsukuba Primate Center for Medical Science (National Institute of Infectious Diseases; Tokyo, Japan). All monkeys were treated in accordance with the rules for care and management of animals at the Tsukuba Primate Center 27 under the Guiding Principles for Animal Experiments using Non-Human Primates formulated and enforced by the Primate Society of Japan (1986). All experimental procedures were approved by the Animal Welfare and Animal Care Committee of the National Institute of Infectious Diseases of Japan. These animal protocols fulfill the guidelines in the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
Clinical Studies
Fundus photographs, fluorescein angiography (FA), and indocyanine green angiography (IA) were performed with a fundus camera (TRC50; Topcon, Tokyo, Japan) in animals under anesthesia. Electroretinography (ERG) was recorded in four affected and six normal monkeys with a white/color LED stimulator and contact lens electrode (LS-W; Mayo, Aichi, Japan). After 20 minutes of dark adaptation, rod ERG, combined ERG, and oscillatory responses were recorded, and single-flash cone response and 30-Hz flicker ERG were recorded after 10 minutes of light adaptation. The stimulus and recording conditions conformed to the standards for clinical electroretinography recommended by the International Society for Clinical Electrophysiology of Vision. 28  
Genomic DNA and RNA Isolation
Peripheral blood was collected from 19 affected and 11 unaffected monkeys from the pedigree (Fig. 1 , asterisks, pound signs) and an additional six unrelated normal monkeys, and genomic DNA was extracted (QIAamp DNA Blood Maxi Kit; Qiagen, Valencia, CA). A normal monkey outside the pedigree was killed for bilateral eye enucleation, and enucleated eyes were immersed and stored in RNA-stabilization solution (RNAlater; Ambion, Austin, TX) at −80°C until RNA isolation. After thawing on ice, the eyeballs were dissected to separate the neural retina and choroid followed by extraction of total RNA. 
Histologic Studies
An affected 14-year-old male monkey (Fig. 1 , monkey B) was killed for histologic studies. Enucleated eyes were fixed in 10% neutralized formaldehyde solution at 4°C overnight, dehydrated, and embedded in paraffin. Four-micrometer-thick sections were prepared and stained with hematoxylin and eosin (HE) or periodic acid–Schiff (PAS). Serial sections were used for immunohistochemical analysis with anti-complement 5 (C5) antibody. After pretreatment with 0.4 mg/mL proteinase K in phosphate-buffered saline (PBS) for 5 minutes and blocking with 5% skim milk in PBS for 20 minutes at room temperature, the sections were incubated with rabbit anti-human C5 polyclonal antibody (Dako, Glostrup, Denmark) diluted to 1:200 dilution in PBS for 2 hours at room temperature. Alexa 488–conjugated goat anti-rabbit IgG (Molecular Probes, Eugene, OR), diluted to 1:200 in PBS, was used as the secondary antibody. The negative control experiments were performed using normal rabbit immunoglobulin fraction (Dako) instead of anti-C5 antibody. 
Characterization of the Genomic Organization and cDNA Sequence of the Monkey ABCA4, VMD2, EFEMP1, and TIMP3 Genes
Gene-specific primers of the human macular degeneration genes ABCA4, VMD2, EFEMP1, and TIMP3 were designed based on the human genomic DNA sequence to amplify exons of monkey genes (Table 1) . Amplified products were directly sequenced. For all genes except ABCA4, the 5′/3′-rapid amplification of cDNA ends (5′/3′-RACE) was performed using total RNA isolated from the monkey retina. Amplification of partial cDNAs by both 5′- and 3′-RACE was designed to generate overlapping PCR products to obtain a full-length cDNA sequence. Primers were initially designed based on the exonic sequences obtained by genomic sequence (Table 2) . RACE products were subcloned into the pCRII cloning vector (TA Cloning Kit Dual Promoter; Invitrogen, Carlsbad, CA) and sequenced directly. The obtained nucleotide sequence data have been submitted to GenBank, and assigned accession numbers: TIMP3: AY207381–207385, AH012631; EFEMP1: AY312407–312415, AH012997; VMD2: AY357925–357936, AH013172; ELOVL4: AF461182–461187, AH012403; ABCA4; AY793687 (http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). 
Mutation Analysis
Coding regions and adjacent intronic sequences of the monkey ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes were analyzed for sequence variants by single-strand conformation polymorphism (SSCP) or denaturing (D)HPLC (for the ABCA4 gene) analysis in parallel with direct sequencing. Genomic DNA from six affected and five unaffected monkeys from the pedigree (Fig. 1 , pound signs) and six unrelated normal subjects were used for mutation analysis. Primers located in the intronic regions were designed to amplify coding sequences of individual genes (Table 3) . Large exons were divided into smaller segments to obtain amplification products suitable for SSCP analysis. The purified amplicons were analyzed by SSCP or DHPLC analysis, as previously described. 29 30 All the samples were also analyzed by bidirectional sequencing with the PCR primers. Exons 2, 7, and 10 of the VMD2 gene were screened for sequence variants only by direct sequencing. 
Linkage Analysis
Linkage analysis was performed on DNA from 19 affected and 7 unaffected members of the pedigree. Individuals used for the analysis are indicated by asterisks in Figure 1 . Human microsatellite markers linked to human macular degeneration loci were analyzed with monkey genomic DNA used as the template. Details of microsatellite markers and their primer sequences were obtained from the genome database. Microsatellite marker analysis was performed by two methods: Markers linked to candidate gene loci and included in a linkage mapping set (ver. 2.5MD10; Applied Biosystems, Inc. [ABI], Foster City, CA) were analyzed on the a DNA sequencer (model 3100; ABI) with fluorescence-labeled primers. Additional microsatellite markers were analyzed by 32P dCTP incorporation into the amplified product. 31 Two-point linkage analysis was performed between the disease locus and microsatellite markers with the MLINK program of the LINKAGE package, as described elsewhere. 32 33 Linkage was assessed under the conditions of autosomal dominant inheritance of the disease trait with a frequency of 0.001 for the disease-causing allele, by using the affecteds-only model, as published earlier. 34 Linkage analysis was performed assuming equal frequencies for marker alleles. Haplotypes were constructed with genotypes of microsatellite markers according to their order on human chromosomes. 
Results
Clinical and Histologic Findings
Fundus photographs and FA of a 14-year-old female affected monkey (Fig. 1 , monkey A) are shown in Figure 2 . Fine, yellowish white dots were observed in the maculae (Figs. 2a 2b 2c 2d) , scattered in the peripheral retina along blood vessels in this monkey (Figs. 2a 2b) . However, in most cases, the locations of the lesions fell within the region centered on the fovea centralis with the same diameter as one optic disc. FA showed hyperfluorescence corresponding to these dots, except foveola (Figs. 2e 2f) . No abnormalities were found in the optic disc, retinal blood vessels, or choroidal vasculatures in any eyes examined. The amplitude and peak latency of both dark- and light-adapted ERG showed no alteration compared with normal control eyes, indicating that global rod or cone degeneration was absent. Histologic studies demonstrated that there were various-sized drusen, weakly stained by PAS (light purple), between the RPE and choriocapillaris in the macular region (Figs. 3a 3b , asterisk). These drusen were strongly reactive with antibodies against complement C5 (Figs. 3c 3d) . This finding was consistent with the property of drusen reported in patients with AMD. 35 Accumulation of lipofuscin in RPE cells was also obvious by PAS (Figs. 3a 3b , deep purple, arrows). 
Mutation Analysis of the ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 Genes
To evaluate the involvement of the ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes in disease, we first determined the genomic sequence and the complete cDNA sequence of the orthologous genes in the monkey. Subsequently, these genes were screened for sequence variants in affected and unaffected monkeys in the pedigree, in addition to unrelated, unaffected animals by SSCP, or by DHPLC for the ABCA4 gene, analysis and direct sequencing. 
ABCA4.
The monkey ABCA4 gene consists of 50 exons, with its translation stop codon in exon 50, similar to the human gene. The complete 6819-bp cDNA encodes a protein of 2273 amino acids. ABCA4 is a member of the superfamily of ATP-binding cassette (ABC) transporters, which are associated with membranes and transport various molecules across extra- and intracellular membranes of all cell types. ABC genes typically encode four domains that include two conserved ATP-binding domains and two domains with multiple transmembrane segments. Comparative sequence analysis revealed that the monkey ABCA4 protein was only 1.8% (41 amino acids) different from the human orthologue, whereas the sequence was identical in the two adenosine triphosphate (ATP)-binding domains. Five of the 41 nonconserved amino acids in the monkey protein (codons 223, 423, 1300, 1817, and 2255) involve polymorphisms in the human. Surprisingly, the Lys223Gln and Arg1300Gln changes reported to be associated with Stargardt disease in humans were observed in the homozygous state in one normal control monkey (Fig. 1 , monkey C). In addition, the mutation analysis revealed heterozygous amino acid changes at five positions—Leu424Val, Arg1017His, Val1114Ile, Ile1615Val, and Pro2238Gln—in both affected and normal monkeys. However, these missense variants did not segregate with the disease phenotype. 
VMD2.
The monkey VMD2 gene consists of 11 exons, with its translation initiation codon in exon 2, as observed in its human orthologue. The complete cDNA was 2187 bp, encoding 585 amino acids. The VMD2 gene encodes the bestrophin protein, which localizes to the basolateral plasma membrane of the RPE with the postulated function as an oligomeric chloride channel. 36 37 The hydropathy profile predicted that bestrophin contains four stretches of hydrophobic amino acids that function as transmembrane domains. Comparative sequence analysis demonstrated that monkey bestrophin had 19 amino acids different from its human homologue, and the four putative transmembrane domains are highly conserved. To date, 72 disease-associated nucleotide substitutions of the VMD2 gene have been identified in patients with Best disease. 3 7 26 The mutation analysis of the VMD2 gene in the monkey pedigree detected six amino acid sequence variants. A polymorphism (Val/Ile) was detected at codon 275 in the fourth transmembrane domain, which has also been reported in humans. 26 Four polymorphisms (Tyr465His, Thr542Met, Glu557Gln, and Thr566Ala) were detected in exon 10. These changes did not segregate with the disease. In addition, one nonsense mutation at codon 582 (Glu→Stop) in exon 11 was detected in two normal monkeys, whereas none of the examined six affected monkeys showed the change. 
EFEMP1.
The exon–intron gene structure of the monkey EFEMP1 gene was also similar to the human EFEMP1 gene. It was composed of 11 exons with its translation initiation codon in exon 2. The complete cDNA was 2034 bp, encoding 493 amino acids. Although the function of this gene remains unclear, this class of proteins is known to have characteristic sequence of repeated calcium-binding EGF-like domains. 4 The monkey EFEMP1 cDNA was found to have six EGF repeats. Four EGF repeats (numbers 2–5) are encoded by single exons (exons 5–8), one EGF repeat (number 1) is encoded by three exons (exons 2–4), and EGF repeat number 6 is encoded by two exons (exons 9, 10). This finding is in agreement with one of the two transcriptional variants with a distinct 5′ untranslated region (UTR) described in its human homologue. Comparative sequence analysis demonstrated that the monkey EFEMP1 has three amino acids different from that of the human, but the sequence in the entire region of six EGF repeats is completely conserved. In humans, a single mutation (Arg345Trp) that disrupts one of these domains is known to cause Malattia Leventinese. 4 No amino acid–changing polymorphisms were found in all the monkeys tested. Three single nucleotide polymorphisms (SNPs), that did not alter the amino acid sequence, were detected in exons 4, 5, and 10. 
TIMP3.
The monkey TIMP3 gene consisted of five exons, similar to its human orthologue. The complete cDNA was 1887 bp in length, encoding 211 amino acids. TIMP3 is the third member of the tissue inhibitors of metalloproteinase family, a group of zinc-binding endopeptidases involved in the degradation of the extracellular matrix. TIMP3 has 12 cysteines characteristic of the TIMP family, which are proposed to form intramolecular disulfide bonds and tertiary structure for the functional properties of the mature protein. The predicted amino acid sequence of the monkey TIMP3 gene was identical with the human orthologue, including the 12 cysteine residues. Mutations in the TIMP3 gene are known to cause Sorsby’s fundus dystrophy. 5 With a few exceptions, 38 39 most previously described mutations disrupt the disulfide bonds by changing residues into cysteines, leading to misfolding of the protein. 5 40 No coding sequence changes were detected in the TIMP3 gene in monkeys by mutation screening. 
ELOVL4.
We have reported cloning and characterization of the ELOVL4 gene in the cynomolgus monkey. 41 Three mutations leading to truncation of the ELOVL4 protein were reported in humans with Stargardt-like macular dystrophy 23 42 (Karen G, et al. IOVS 2004;45:ARVO E-Abstract 1766). Mutation analysis of monkeys with macular degeneration did not detect any amino acid–altering sequence changes. Silent polymorphisms were observed in exons 1, 3, and 4 of the ELOVL4 gene. 
Linkage Analysis of Candidate Gene Loci
The methodology we used to screen for mutations in the candidate genes could miss disease-associated changes that may be present in the promoter or intronic regions; therefore, linkage analysis was performed to exclude the five genes further. Moreover, the macular degeneration phenotype in the monkey pedigree could be caused by a single gene defect. In these cases, linkage analysis would be a comprehensive approach to confirm or exclude a particular gene locus. Microsatellite markers linked to the five candidate gene loci in addition to eight human macular degeneration loci—ABCA4, VMD2, DHRD (EFEMP1), TIMP3, STGD3 (ELOVL4), Cone rod dystrophy-8 (CORD-8), age-related macular degeneration 1 (ARMD1, gene Hemicentin1), rhodopsin, STGD4, North Carolina macular degeneration (MCDR1), CORD9, late-onset retinal degeneration (CTRP5), and CORD5 loci—were analyzed to test for linkage with the macular degeneration in the monkey pedigree. None of the tested loci gave significant positive lod scores (Table 4) . We also constructed haplotypes using the genotype data of markers at the 13 loci. This analysis further supported the exclusion of these loci from being among those that might harbor the gene associated with macular degeneration in these monkeys. 
Discussion
We report a detailed description of early-onset macular degeneration in cynomolgus monkeys and the exclusion of known genes responsible for macular degeneration in humans as a disease-associated gene in this animal model. Several forms of macular degeneration have been described in humans, including autosomal dominant, autosomal recessive, and X-linked modes of inheritance. The most common form of macular disease in humans is AMD. Major clinical characteristics of AMD are loss of central vision with RPE atrophy or exudation. The presence of subretinal deposits known as drusen is one of the early signs observed in AMD and several other macular degenerations. Recent studies suggest that the process of drusen formation includes inflammatory and immune-mediated events. 35 Immunohistochemical examinations have revealed that drusen contains activated complement factors. These molecules include C5, the cleavage product of C3 (C3b, iC3b, and C3dg), and the terminal complement complex C5b-9. Clinical and histologic studies of the affected monkeys showed the presence of drusen (Figs. 2 3) . Immunologic analysis demonstrated that drusen in monkeys had C5 as a component, suggesting that the nature of monkey drusen was similar to that reported in human AMD. At the same time, the onset of the disease in monkeys is at ∼2 years of age; therefore, the monkey macular degeneration resembles early-onset human macular degeneration with drusen. 
Comparison of the gene maps and chromosome painting data revealed a high degree of synteny and genome conservation between human and Macaque genomes. 43 44 Amplification of cynomolgus monkey DNA with human microsatellite marker primers and sequence analysis revealed that not only the sequences flanking the microsatellite repeat regions but also the polymorphic nature of these repeats is conserved between human and monkey genomes (data not shown). Comparative studies on human and chimpanzee genomes have shown the same average heterozygosity at microsatellite marker loci and conserved genetic distance between markers. 45 Molecular cloning of monkey orthologues of the human ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes further demonstrated the high conservation between the human and macaque genomes not only in the organization of the gene structure, but also at the sequence level. Considering the high conservation between human and macaque genomes, human macular degeneration loci can be considered plausible candidates for identification of the gene associated with macular degeneration in the monkeys. We tested this hypothesis using microsatellite markers linked to human macular degeneration loci and successfully amplified microsatellites in the monkey DNA with human primers. However, we failed to establish linkage with the tested loci, and the subsequent haplotype analysis further confirmed this finding. Therefore, the macular degeneration locus in the monkey pedigree is not likely to be associated with the regions of the monkey genome that are syntenic to human genomic regions comprising the 13 macular disease loci tested. Mutation analysis of candidate genes also supported the exclusion of the ABCA4, VMD2, EFEMP1, TIMP3, and ELOVL4 genes. The analyses detected five- and six-amino-acid substitutions in the ABCA4 and VMD2 genes, respectively. Some silent nucleotide substitutions or intronic sequences changes, such as small insertions/deletions, SNPs, and variations of short tandem repeats were observed in the EFEMP1, TIMP3, and ELOVL4 genes. All these sequence variants did not segregate with the disease phenotype in the extended pedigree. Hence, these changes were interpreted as benign polymorphisms. 
In the ABCA4 sequence of a normal monkey, we found two amino acid replacements (K223Q and R1300Q) that are associated with Stargardt disease in humans. Because of the extensive conservation between the monkey and human gene sequences, one would expect these amino acid changes to have similar disease-associated effects in monkeys. One explanation of this discrepancy could be that K223Q and R1300Q are not causing the disease phenotype in humans, but rather represent markers linked to disease-causing mutations somewhere else in the gene. Alternatively, the disease-causing effect of these amino acid changes on the function of the human ABCA4 protein could be eliminated or compensated for by other differences in the monkey protein. Comparative analysis of the monkey and human genes may provide clues for understanding the molecular pathogenesis caused by ABCA4 variation. In the VMD2 gene sequence of normal monkeys, we found a nonsense mutation at codon 582. The change is located at the fourth residue from the C terminus. Bestrophin was shown to form oligomeric chloride channels in cell membranes. 37 The C-terminal cytosolic tail, encoded by exons 10 and 11, has been reported not to be essential for the protein’s function. Moreover, although 72 nucleotide substitutions have been identified in Best disease to date, 3 7 26 none of them is reported in exons 10 and 11. Hence, the deletion of four amino acids from the C-terminal end of the protein could be considered not to be associated with the disease. 
In summary, we demonstrated that none of the 13 human macular degeneration loci tested were involved in causing the macular degeneration phenotype observed in the monkey pedigree. These results demonstrate the need for additional studies to identify the genetic locus associated with the phenotype in these monkeys and to understand the genetic defect underlying the disease. Identification of the gene responsible for this specific macular degeneration phenotype not only defines a new candidate locus for human macular degeneration, but also provides a primate animal model that can be extensively studied for elucidation of the mechanisms, diagnosis, prophylaxis, and treatment of macular degenerations, including AMD. 
 
Figure 1.
 
Edited version of the monkey pedigree with macular degeneration: fM, the founder breeding male monkey with typical macular degeneration, is shown with five healthy mates arrayed horizontally. The first-generation offspring are also arrayed horizontally. The breeding members from each branch of the first generation offspring are arrayed vertically with their mates and progeny. Monkeys used for *linkage analysis and #mutation screening are marked.
Figure 1.
 
Edited version of the monkey pedigree with macular degeneration: fM, the founder breeding male monkey with typical macular degeneration, is shown with five healthy mates arrayed horizontally. The first-generation offspring are also arrayed horizontally. The breeding members from each branch of the first generation offspring are arrayed vertically with their mates and progeny. Monkeys used for *linkage analysis and #mutation screening are marked.
Table 1.
 
Primer Sets Used for Cloning of the Monkey Homologues
Table 1.
 
Primer Sets Used for Cloning of the Monkey Homologues
Gene Amplified Forward Primer Position Name Reverse Primer Position Size (kb)
Region Name
VMD2 Exon 1 P1F GACCAGAAACCAGGACTGTTGA Intron P1R GAACTCGCCATATAGCAGCTT Exon 2 2.1
Exon 2 P2F GCTCTGACCAGGGTCTCTGA Intron P3R CCGCACCTTTCCCTGAACTA Intron 4.5
Exon 3 P3F CTAGACCTGGGGACAGTCTCA Intron P3R CCGCACCTTTCCCTGAACTA Intron 0.3
Exon 4–5 P4F CACGGAAGAACAACAGCTGA Exon 3 P5R ACACCAGTGGGATACTAATCCAG Exon 6 2.3
Exon 6 P6F GCCAGGAATGGACCATGAGTA Intron P6R GAGCCACTTAGCCTCTAGGTGA Intron 0.3
Exon 7–8 P7F CCTGGAGCATCCTGATTTCA Intron P8R TGAGGCCTCCCTACAGAACA Intron 2.3
Exon 9 P9F TGGCAGAGCAGCTCATCA Exon 8 P9R AGCTTCCAGGCCTTGTTG Exon 10 3.0
Exon 10 P10F AAGGGAGAAGGCCAGGTGTT Intron P10R TTTCCTGTAGTGCTTGGGTACTA Intron 1.2
Exon 11 P11F TGCCCTCCTACTGCAACATT Intron P11R ATGCAATGGAGTGTGCATTA Intron 1.1
EFEMP1 Exon 1 P1F TTCTAGAACCCTCTGGTCTCTGA Intron P1R CCCTTTCTTAACAGCAAGCTAAC Intron 0.9
Exon 2 P2F GATTGGAAGTTGAGTATGGTGGA Intron P2R CATTCTAGGGATAATGTGGTACCAA Intron 1.3
Exon 3–4 P3F AAGATGGTACTGGGCAACTGTAC Intron P4R ACATCTGTAGAGTAGCTTGACAGCA Intron 1.4
Exon 5 P5F CTACACAGGCTAGAGGAATATGATCA Intron P5R GACACAGGATTTAAGTAACTTGCTCA Intron 1.3
Exon 6–7 P6F CACTGAATGGCATGAACATTG Intron P7R TAGAACAGAATTCCCATGGGTAA Intron 1.6
Exon 8 P8F AATAGGACAAGAAGCCAGATCTCT Intron P8R TTCCTGGTTAAAACTAAATACCTAACA Intron 0.4
Exon 9–10 P9F AACAGATGAACAATAGGTGCTTGA Intron P10R TATCTATCTGGCAGTGTTACCAAGA Intron 0.9
Exon 11 P11F GTATTAGACAAGGGATAAGAGCCAA Intron P11R CAGAGGTTATGCATATATGCTGTGA Intron 1.7
TIMP3 Exon 1 P1F CCCAGCGCTATATCACTCG Intron P1R AGCCACTGTGAGTTTCCTCTG Intron 0.7
Exon 2 P2F CAATGGCTCTAACAGGAGAAGTAG Intron P2R CTTGACCAAGGTCTCATGGTTA Intron 0.8
Exon 3–4 P3F TCCAGTTCCAGCTGCATTG Intron P4R AGTTAGTGTCCAAGGGAAGCT Exon 5 2.6
Exon 5 P5F ATGTACCGAGGCTTCACCAA Exon 3 P5R AGGTGAGCTAAACACTATTCTGGA Intron 3.5
Table 2.
 
Primers for 5′–3′-RACE
Table 2.
 
Primers for 5′–3′-RACE
Gene 5′-RACE Position 3′-RACE Position
VMD2 GTATACACCAGTGGGATA Exon 6 AGAGCAACAGCTGATGTTTGAGAA Exon 3
EFEMP1 GGATGGTACATTCATCTA Exon 7 GATCCTGTGAGACAGCAATGCA Exon 3
TIMP3 ATCATCTGGGAAGAGTTA Exon 5 GATGAAGATGTACCGAGGCTTCA Exon 2–3
Table 3.
 
Primer Sets Used for Mutation Screening
Table 3.
 
Primer Sets Used for Mutation Screening
Gene Exon No. Length (bp) Name Forward Primer Name Reverse Primer Size (bp)
ABCA4 1 66 01F TCTTCGTGTGGTCATTAGC 01R ACCCCACACTTCCAACCTG 152
2 94 02F AAGTCCTACTGCACACATGG 02R CTAGACAAAAGGCCCAGACC 266
3 142 03F TTCCCAAAAAGGCCAACTC 03R CACGCACGTGTGCATTTCAG 301
4 139 04F GCTATTTCCTTATTAATGAGGC 04R GGGAAATGATGCTTGAGAGC 212
5 128 05F CCCTTCAACACCCTGTTCTT 05R TTCTTGCCTTTCTCAGGCTGG 237
6 198 06F GTATTCCCAGGTTCTGTGG 06R TACCCCAGGAATCACCTTG 330
7 88 07F AGCATATAGGAGATCAGACTG 07R GGCATAAGAGGGGTAAATGG 241
8 238 08F GAGCATTGGCCTCACAGCAG 08R CCCCAGGTTTGGTTTCACC 397
9 139 09F AGACATGTGATGTGGATACAC 09R GTGGGAGGTCCAGGGTACAC 271
10 117 10F AACACTAAGTGATAGGGGCAGAA 10R GGCCTGCTTGTTGTATTTTGAT 344
11 198 11F AGCTCACTCGCTCTTTAGGG 11R TTCAAGACCACTTGACTTGC 406
12 206 12F TGGGACAGCAGCCCTTATC 12R CCAAATGTAATTTCCCACTGAC 362
13 177 13F AATGAGTTCCGAGTCACCCTG 13R CCCATTAGCGTGTCATGG 308
14 223 14F TCCATCTGGGCTTTGTTCTC 14R AATCCAGGCACATGAACAGG 407
15 222 15F AGACAGTAACTAACAGGCTCGTG 15R GGACTGCTACAGACCCTTCC 386
16 205 16F CTGTTGCATTGGATAAAAGGC 16R GATGAATGGAGAGGGCTGG 330
17 65 17F CTGCGGTAAGGTAGGATAGGG 17R CACACCGTTTACATAGAGGGC 232
18 90 18F CAGCTCCCGGTGGTAGAGTA 18R CCCTTGCCATGAGATGTTTT 222
19 175 19F TGGGGCCATGTAATTAGGC 19R TGGGAAAGAGTAGACAGCCG 322
20 132 20F GCATGTTGCTAAAGGCCATC 20R TATCTCTGCCTGTGCCCAG 293
21 140 21F GTAAGATCAGCTGCTGGAAG 21R GAAGCTCTCCTGCTCCAAGC 301
22 138 22F CCCTCCACAGTCCCTTAACTC 22R GAGAGTGGGGACCACAGGTA 244
23 194 23F TTTTGCAACTATGTAGCCAGGA 23R AGCCTGTGTGAGTAGCCATG 384
24 85 24F GCATCAGGGAGAGGCTGTC 24R CCCAGCAATATTGGGAGATG 212
25 206 IVS24F GTAAGGACTGGACGGGCCATACTTGG IVS24R TCCAGCTCTCTGAAAAGGCTGGCATA 2 kb
IVS25F AAAGCTGGTGGAGTGCATTGGTCAAG IVS25R CCTGAATCAGAATCCTCCGTGACCTTC 500
26 49 26F TCCCATTATGAAGCAATACC 26R ACCCAGCCCCTTAGACTTTC 228
27 266 IVS26F GGATTCTGATTCAGGACCTCTGTTTGC IVS26R CTGCGGATGGTGTGTTGGAATCTCTT 2 kb
IVS27F TCCCAGAGAGAAGGCTGGACAGACAC IVS27R CCCATATATCCAGGGGTGAAGGGTCA 1 kb
28 125 28F TGCACGCGCACGTGTGAC 28R TGAAGGTCCCAGTGAAGTGGG 291
29 99 29F CAGCAGCTATCCAGTAAAGG 29R AACGCCTGCCATCTTGAAC 263
30 187 30F GTTGGGCACAATTTCTTATGC 30R ACTCAGGAGATACCAGGGAC 347
31 95 IVS30F GAGAAGCTCACCATGCTGCCAGAGT IVS30R GAGATGTTCCTGTCCGTCAGGTCTTG 2 kb
IVS31F CGCAGCACGGAAATTCTACAAGACCT IVS31R CCTCTGTTCATTGACCCAGAATTTGCT 700
32 33 32F ACGGCACTGCTGTACTTGTG 32R TCAACATGGCTGTGAGGTGT 182
33 106 IVS32F GAGCAAATTCTGGGTCAATGAACAGAGG IVS32R CGCTTAAAAACCCAACAAGTGCTTCC 1.2 kb
IVS33F AGGTATGGAGGAATTTCCATTGGAGGA IVS33R CTTTAGAGGCCTCTCTAGTGATAGG 300
34 75 34F AAACCGTCTTGTTTGTTTGTTT 34R AGGAGGGAGGGAATTCAATG 208
35 170 IVS34F GGCCCTATCACTAGAGAGGCCTCTAAAG IVS34R GGTTGGCTAATGACGGTGATTCCATAC 550
IVS35F CATGCCCTGGTCAGCTTTCTCAATGT IVS35R GAGAAAATCACGCAGATGGCAACCAC 2 kb
36 178 36F TGTAAGGCCTTCCCAAAGC 36R TGGTCCTTCAGAGCACACAC 346
37 116 37F CATTTTGCAGAGCTGGCAGC 37R CTTCTGTCAGGAGATGATCC 260
38 158 38F GGAGTGCATTATATCCAGACG 38R CCTGGCTCTGCTTGACCAAC 302
39 125 39F TGCTGTCCTGTGAGAGCATC 39R CTTCCAGCCCAACAAGGTC 344
40 130 IVS39F CTGCTCATTGTCTTCCCCCACTTCTG IVS39R CAGCAGGGTCAGGAGGAAGTACACCA 700
IVS40F GTGAGGAGCACTCTGCAAATCCGTTC IVS40R AGATGAGGAAAAGGGGTCAGGATTGG 3.5 kb
41 121 41F GAAGAGAGGTCCCATGGAAAGG 41R GCTTGCATAAGCATATCAATTG 299
42 63 42F CTCCTAAACCATCCTTTGCTC 42R AGGCAGGCACAAGAGCTG 214
43 107 43F GGTCTCTAGGGCCAGGCTA 43R CACATCTTTCAGGGCCTCAG 271
44 142 44F GAAGCTTCTCCAGCCCTAGC 44R TGCACTCTCATGAAACAGGC 277
45 135 IVS44F ACATCTTTACCTTTATGCCCGGCTTCG IVS44R AATGAGTGCGATGGCTGTGGAGAGTT 4 kb
IVS45F TTAAGAGCCTGGGCCTGACTGTCTACG IVS45R GAATCTCTTGCCTGTGGGATGTGAGG 1 kb
46 104 48F GAAGCAGTAATCAGAAGGGC 46R GCCTCACATTCTTCCATGCTG 257
47 93 47F TCACATCCCACAGGCAAGAG 47R TTCCAAGTGTCAATGGAGAAC 258
48 250 48F ATTACCTTAGGCCCAACCAC 48R ACACTGGGTGTTCTGGACC 365
49 87 49F GGTGTAGGGTGGTGTTTTCC 49R ACTGCCTCAAGCTGTGGACT 187
VMD2 2* 152 P2F GCTCTGACCAGGGTCTCTGA P3R CCGCACCTTTCCCTGAACTA 4.5 kb
3 95 P3F CTAGACCTGGGGACAGTCTCA P3R CCGCACCTTTCCCTGAACTA 325
4 234 MP4aF TGGGAGACAGAACCCTTGGA MP4aF GTCCTTGCCTTCCACGAA 302
MP4bF TGGTGGAACCAGTACGAGAA MP4bF TCCACCCATCTTCCATTGTT 286
5 155 MP5F AAAGGAGTGCTGAGGTTCCTATA MP5R CTTGTTTCCTGTGAACCACAA 330
6 78 P6F GCCAGGAATGGACCATGAGTA P6R GAGCCACTTAGCCTCTAGGTGA 292
7* 153 P7F CCTGGAGCATCCTGATTTCA P8R TGAGGCCTCCCTACAGAACA 2.3 kb
8 81 MP8F GCATCATGTGGTGTGGAAAT P8R TGAGGCCTCCCTACAGAACA 270
9 152 MP9F CAAGTCATCAGGCACGTACAA MP9R CTAGGCAGACCCCTGCTACTA 286
10* 639 P10F AAGGGAGAAGGCCAGGTGTT P10R TTTCCTGTAGTGCTTGGGTACTA 1.2 kb
11 19 P11F TGCCCTCCTACTGCAACATT MP11R AAGTAGTCCTGGACTGCTGATTT 270
EFEMP1 2 81 MP2F CCGCAGCAGATACTAAATATCAG MP2R CCGCTGAACCGTACTTATTTC 173
3 49 MP3F CTTAGGGAATGGACACACCAA MP3R ACAGAAGGCCAAAGATCACAT 155
4 387 MP4aF CCCTCTTAGAAGATTCCTGACTTA MP4aR ACACTCCACTGGTTGCCAT 249
MP4bF ATGAACAGCCTCAGCAGGA MP4bR GCAAAAGCTTTCGATGGTTA 316
5 123 MP5F GGAGGCAATATCAACATCTTCA MP5R TGCTTGAGGTTGAAACAGTTAAG 248
6 120 MP6F GCAAACAGCAATGCTAATTCA MP6R GAAATACTGCAACATGGCATG 250
7 120 MP7F CAGCTAGGGAATTATTTATCAGCA MP7R CAGGGATTGGACTTTATTCCA 279
8 120 MP8F ATATCCAAAGTAGTGGTGCACAA P8R TTCCTGGTTAAAACTAAATACCTAACA 235
9 124 MP9F TGCAAACAGAATCTGCCAGTA MP9R TTTGGCTTGGTAAGACCAGAA 265
10 196 MP10F CTTACCAAGCCAAACTGCTAACTA MP10R AACAAACTCCCATCTTTCTCAATAG 289
11 162 MP11F AAAGCATAGAAACTCCAATGCA MP11R AGGTAACAATATTCTTTGGCTGACT 281
ELOVL4 1 100 MP1F CCGCGGTTAGAGGTGTTC MP1R GAGACCAGGGGTCGGTGAC 281
2 188 MP2aF TTGAGACATCTTGATTCCTAGAAAG MP2aR AAGTTAAGCAAAACCATCCCA 252
MP2bF CTGGGTCCAAAGTGGATGAA MP2bR AGCTAACAGTTATGTCTGGGTACAA 213
3 81 MP3F GCAATTGGAATGCATGACA MP3R TTTCACAGATTGGGGCCTATA 304
4 172 MP4aF AAATGATTCCATGCCTTGTACA MP4aR AACGCAAGCAGTATATTCCTGA 330
MP4b TGGTGTTTATAACACGCTTTCC MP4bR CTCATTGCTTTCCACTGAACA 271
5 128 MP5F ATCTCGGTGGCTTACTGCTTA MP5R AATAAGTCGGCTGGAGTCAACT 356
6 276 MP6aF TTGGGCCTGTGATAGCTATG MP6aR TTAGGCTCTTTGTATGTCCGAA 247
MP6bF CTCTAATTGCCTACGCAATCAG MP6bR GGGAGTTTTTCCTCACTGTCA 242
TIMP3 1 121 MP1F AACTTTGGAGAGGCGAGCA MP1R CCTAAGCAGCGCTGCAGTC 233
2 83 MP2F TGAGATGCTGTTCCTGATGTG MP2R GGCTGGTGCTTAGACACACA 266
3 112 MP3F AGCAGTGGGATTATGGATCATAC MP3R ACATTTGGTGAGTCAGCTACTCA 267
4 122 MP4F TGGGCTAAGTGGGAACATAGTA MP4R GTTTCTAGGGCTGCAAGTCA 274
5 198 MP5F TACCATGGCAGATTCCATCA MP5R AGTTAGTGTCCGAGGGAAGCT 306
Figure 2.
 
Fundus photographs and fluorescein angiogram (FA) of a 14-year-old female cynomolgus monkey (Fig. 1 , monkey A) with macular degeneration, showing the right (a, c, e) and left (b, d, f) posterior poles. Fine grayish white or yellowish white dots were visible in the macula (ad). The dots were observed in the peripheral retina along blood vessels in this monkey (a, b). These dots showed hyperfluorescence in FA except in the foveola (e, f). High-magnification of the macular region (c, d, e).
Figure 2.
 
Fundus photographs and fluorescein angiogram (FA) of a 14-year-old female cynomolgus monkey (Fig. 1 , monkey A) with macular degeneration, showing the right (a, c, e) and left (b, d, f) posterior poles. Fine grayish white or yellowish white dots were visible in the macula (ad). The dots were observed in the peripheral retina along blood vessels in this monkey (a, b). These dots showed hyperfluorescence in FA except in the foveola (e, f). High-magnification of the macular region (c, d, e).
Figure 3.
 
Drusen in the affected monkey retina. An affected 14-year-old male monkey (Fig. 1 , monkey B). There were various-sized drusen, which were weakly stained by PAS ( Image not available ), between the RPE and choriocapillaris (CC) (a, b). These drusen were strongly reactive with antibodies against complement C5 (green channel). Lipofuscin autofluorescence is shown (red) in the RPE (c, d). Accumulation of lipofuscin in RPE cells was also obvious by PAS (a, b, arrows).
Figure 3.
 
Drusen in the affected monkey retina. An affected 14-year-old male monkey (Fig. 1 , monkey B). There were various-sized drusen, which were weakly stained by PAS ( Image not available ), between the RPE and choriocapillaris (CC) (a, b). These drusen were strongly reactive with antibodies against complement C5 (green channel). Lipofuscin autofluorescence is shown (red) in the RPE (c, d). Accumulation of lipofuscin in RPE cells was also obvious by PAS (a, b, arrows).
Table 4.
 
Two-Point Lod Scores between the Monkey Macular Degeneration Locus and Markers at the Human Macular Degeneration Loci
Table 4.
 
Two-Point Lod Scores between the Monkey Macular Degeneration Locus and Markers at the Human Macular Degeneration Loci
Markers Distance from the Gene (CM) Order on the Chromosome (M) Lod Scores at θ Exclusion (Z = −2)
0 0.001 0.005 0.01 0.05 0.1 0.2 0.3 0.4
CORD8 154.28
D1S431 10.5 165 −ε −2.116 −1.422 −1.128 −0.483 −0.248 −0.071 −0.01 0.006 0.001
D1S2635 0 154.28 −ε −11.078 −7.598 −6.112 −2.773 −1.469 −0.392 0.019 0.119 0.075
D1S2715 −6.9 147.01 −ε −7.7 −4.925 −3.747 −1.162 −0.232 0.388 0.464 0.299 0.03
D1S498 −10.6 144.94 −ε −1.124 −0.439 −0.154 0.416 0.564 0.567 0.433 0.227 0.0001
ABCA4 94.1
D1S188 −2.3 91.7 −ε −6.139 −4.058 −3.175 −1.24 −0.541 −0.05 0.074 0.066 0.01
D1S2849 −1.2 92.9 −ε −1.766 −1.075 −0.784 −0.166 0.032 0.133 0.119 0.067
D1S2868 0.1 94 −ε −14.824 −10.623 −8.809 −4.599 −2.846 −1.264 −0.522 −0.146 0.1
STGD3 80.5
D6S1662 −2.67 77.83 −ε −1.232 −0.544 −0.257 0.324 0.476 0.472 0.34 0.17 0.0
D6S1048 0.28 80.78 −ε −0.063 0.614 0.889 1.38 1.416 1.172 0.79 0.362 0.0
D6S1596 7.1 87.6 −ε −8.746 −5.965 −4.78 −2.138 −1.127 −0.319 −0.025 0.049 0.05
D6S1609 12.08 92.58 −ε −7.326 −5.235 −4.34 −2.302 −1.475 −0.724 −0.349 0.131 0.05
DHRD 56.1
D2S2230 3.9 60 −ε −11.691 −8.209 −6.719 −3.349 −2.006 −0.842 −0.325 −0.084 0.1
D2S378 1.1 57.2 −ε −9.268 −6.482 −5.29 −2.593 −1.517 −0.588 −0.186 −0.019 0.05
ARMD1 192.2
D1S384 −2.11 190.09 −ε −5.565 −3.486 −2.606 −0.696 −0.032 0.375 0.389 0.236 0.01
D1S413 2.1 194.1 −ε −11.068 −7.59 −6.106 −2.784 −1.501 −0.46 −0.067 0.047 0.05
D1S2622 3.7 195.9 −ε −1.961 −1.271 −0.982 −0.375 −0.185 −0.084 −0.066 −0.047 0.0
VMD2 61.5
D11S1993 −2.3 59.2 −ε −1.615 −0.925 −0.636 −0.032 0.151 0.224 0.181 0.1 0.0
D11S4174 1.4 62.9 −ε −7.132 −5.026 −4.112 −1.979 −1.102 −0.368 −0.087 0.003 0.01
D11S4076 7.3 66.8 −ε −5.617 −3.537 −2.656 −0.736 −0.061 0.364 0.385 0.231 0.01
Rhodopsin 130.6
D3S3515 −4.01 126.59 −ε −2.756 −1.379 −0.803 0.383 0.717 0.775 0.584 0.302 0.001
D3S3720 −2.8 127.8 −ε −2.626 −1.247 −0.67 0.531 0.879 0.945 0.729 0.389 0.001
D3S1269 0.3 130.9 −ε −11.566 −8.081 −6.588 −3.2 −1.846 −0.7 −0.238 −0.062 0.05
Timp3 31.5
D22S1162 7.05 38.55 −ε −3.587 −2.203 −1.619 −0.365 0.055 0.291 0.276 0.159 0.005
D22S280 0 31.5 −ε −4.051 −2.664 −2.075 −0.785 −0.321 −0.002 0.065 0.044 0.01
D22S273 −1 30.5 −ε −1.878 −1.187 −0.896 −0.278 −0.078 0.026 0.025 0.004 0.0
CTRP5 118.7
D11S4127 −1.6 117.1 −ε −0.771 −0.088 0.192 0.73 0.827 0.719 0.495 0.244 0.0
D11S924 0.2 118.9 −ε −1.424 −0.736 −0.449 0.137 0.298 0.322 0.232 0.113 0.0
D11S4129 4.48 121.58 −ε −9.057 −6.275 −5.089 −2.435 −1.41 −0.566 −0.214 −0.054 0.05
STGD4 26.1
D4S403 0 26.1 −ε −16.798 −11.919 −9.83 −5.081 −3.159 −1.445 −0.633 −0.206 0.1
D4S391 1.2 27.3 −ε −3.615 −2.231 −1.647 −0.392 0.026 0.255 0.234 0.13 0.005
CORD5 (Interval) 64.5
D17S938 0 64.5 −ε −16.296 −11.422 −9.339 −4.638 −2.776 −1.176 −0.466 −0.125 0.1
D17S796 0 64.5 −ε −3.594 −2.209 −1.624 −0.358 0.075 0.324 0.305 0.176 0.0
MCDR1 (Interval) 98.1
D6S434 4.3 102.4 −ε −4.496 −3.103 −2.507 −1.163 −0.632 −0.183 −0.005 0.043 0.0
CORD9 (Interval) 47.6
D8S1820 0 47.6 −ε −11.981 −8.501 −7.014 −3.65 −2.277 −1.002 −0.385 −0.092 0.1
MichaelidesM, HuntDM, MooreAT. The genetics of inherited macular dystrophies. J Med Genet. 2003;9:641–650.
AllikmetsR, SinghN, SunH, et al. A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nat Genet. 1997;3:236–246.
PetrukhinK, KoistiMJ, BakallB, et al. Identification of the gene responsible for Best macular dystrophy. Nat Genet. 1998;3:241–247.
StoneEM, LoteryAJ, MunierFL, et al. A single EFEMP1 mutation associated with both Malattia Leventinese and Doyne honeycomb retinal dystrophy. Nat Genet. 1999;2:199–202.
WeberBH, VogtG, PruettRC, StohrH, FelborU. Mutations in the tissue inhibitor of metalloproteinases-3 (TIMP3) in patients with Sorsby’s fundus dystrophy. Nat Genet. 1994;4:352–356.
ZhangK, KniazevaM, HanM, et al. A 5-bp deletion in ELOVL4 is associated with two related forms of autosomal dominant macular dystrophy. Nat Genet. 2001;1:89–93.
MarquardtA, StohrH, PassmoreLA, et al. Mutations in a novel gene, VMD2, encoding a protein of unknown properties cause juvenile-onset vitelliform macular dystrophy (Best’s disease). Hum Mol Genet. 1998;9:1517–1525.
BernsteinPS, TammurJ, SinghN, et al. Diverse macular dystrophy phenotype caused by a novel complex mutation in the ELOVL4 gene. Invest Ophthalmol Vis Sci. 2001;13:3331–3336.
DithmarS, CurcioCA, LeNA, BrownS, GrossniklausHE. Ultrastructural changes in Bruch’s membrane of apolipoprotein E-deficient mice. Invest Ophthalmol Vis Sci. 2000;8:2035–2042.
MataNL, TzekovRT, LiuX, et al. Delayed dark-adaptation and lipofuscin accumulation in abcr+/− mice: implications for involvement of ABCR in age-related macular degeneration. Invest Ophthalmol Vis Sci. 2001;8:1685–1690.
RakoczyPE, ZhangD, RobertsonT, et al. Progressive age-related changes similar to age-related macular degeneration in a transgenic mouse model. Am J Pathol. 2002;4:1515–1524.
StaffordTJ. Maculopathy in an elderly sub-human primate. Mod Probl Ophthalmol. 1974;0:214–219.
El-MoftyA, GourasP, EisnerG, BalazsEA. Macular degeneration in rhesus monkey (Macaca mulatta). Exp Eye Res. 1978;4:499–502.
HopeGM, DawsonWW, EngelHM, et al. A primate model for age related macular drusen. Br J Ophthalmol. 1992;1:11–16.
NicolasMG, FujikiK, MurayamaK, et al. Studies on the mechanism of early onset macular degeneration in cynomolgus monkeys. II. Suppression of metallothionein synthesis in the retina in oxidative stress. Exp Eye Res. 1996;4:399–408.
NicolasMG, FujikiK, MurayamaK, et al. Studies on the mechanism of early onset macular degeneration in cynomolgus (Macaca fascicularis) monkeys. I. Abnormal concentrations of two proteins in the retina. Exp Eye Res. 1996;3:211–219.
SuzukiMT, TeraoK, YoshikawaY. Familial early onset macular degeneration in cynomolgus monkeys (Macaca fascicularis). Primates. 2003;3:291–294.
KlaverCC, WolfsRC, AssinkJJ, et al. Genetic risk of age-related maculopathy: population-based familial aggregation study. Arch Ophthalmol. 1998;12:1646–1651.
SeddonJM, AjaniUA, MitchellBD. Familial aggregation of age-related maculopathy. Am J Ophthalmol. 1997;2:199–206.
MeyersSM, GreeneT, GutmanFA. A twin study of age-related macular degeneration. Am J Ophthalmol. 1995;6:757–766.
TuoJ, BojanowskiCM, ChanCC. Genetic factors of age-related macular degeneration. Prog Retin Eye Res. 2004;2:229–249.
AbecasisGR, YasharBM, ZhaoY, et al. Age-related macular degeneration: a high-resolution genome scan for susceptibility loci in a population enriched for late-stage disease. Am J Hum Genet. 2004;3:482–494.
AyyagariR, ZhangK, HutchinsonA, et al. Evaluation of the ELOVL4 gene in patients with age-related macular degeneration. Ophthalmic Genet. 2001;4:233–239.
AllikmetsR. Further evidence for an association of ABCR alleles with age-related macular degeneration: the International ABCR Screening Consortium. Am J Hum Genet. 2000;2:487–491.
FelborU, DoepnerD, SchneiderU, ZrennerE, WeberBH. Evaluation of the gene encoding the tissue inhibitor of metalloproteinases-3 in various maculopathies. Invest Ophthalmol Vis Sci. 1997;6:1054–1059.
LoteryAJ, MunierFL, FishmanGA, et al. Allelic variation in the VMD2 gene in best disease and age-related macular degeneration. Invest Ophthalmol Vis Sci. 2000;6:1291–1296.
HonjoS. The Japanese Tsukuba Primate Center for Medical Science (TPC): an outline. J Med Primatol. 1985;2:75–89.
MarmorMF, ZrennerE. Standard for clinical electroretinography (1999 update): International Society for Clinical Electrophysiology of Vision. Doc Ophthalmol. 1998;2:143–156.
Dockhorn-DworniczakB, DworniczakB, BrommelkampL, et al. Non-isotopic detection of single strand conformation polymorphism (PCR-SSCP): a rapid and sensitive technique in diagnosis of phenylketonuria. Nucleic Acids Res. 1991;9:2500.
LiuW, SmithDI, RechtzigelKJ, ThibodeauSN, JamesCD. Denaturing high performance liquid chromatography (DHPLC) used in the detection of germline and somatic mutations. Nucleic Acids Res. 1998;6:1396–1400.
GriesingerIB, SievingPA, AyyagariR. Autosomal dominant macular atrophy at 6q14 excludes CORD7 and MCDR1/PBCRA loci. Invest Ophthalmol Vis Sci. 2000;1:248–255.
TerwilligerJD, OttJ. Handbook of Human Genetic Linkage. 1994;The Johns Hopkins University Press Baltimore, MD.
OttoJ. Analysis of Human Genetic Linkage. 1999;The Johns Hopkins University Press Baltimore, MD.
KhaniSC, KaroukisAJ, YoungJE, et al. Late-onset autosomal dominant macular dystrophy with choroidal neovascularization and nonexudative maculopathy associated with mutation in the RDS gene. Invest Ophthalmol Vis Sci. 2003;8:3570–3577.
MullinsRF, RussellSR, AndersonDH, HagemanGS. Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. FASEB J. 2000;7:835–846.
MarmorsteinAD, MarmorsteinLY, RaybornM, et al. Bestrophin, the product of the Best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium. Proc Natl Acad Sci USA. 2000;23:12758–12763.
SunH, TsunenariT, YauKW, NathansJ. The vitelliform macular dystrophy protein defines a new family of chloride channels. Proc Natl Acad Sci USA. 2002;6:4008–4013.
TabataY, IsashikiY, KamimuraK, NakaoK, OhbaN. A novel splice site mutation in the tissue inhibitor of the metalloproteinases-3 gene in Sorsby’s fundus dystrophy with unusual clinical features. Hum Genet. 1998;2:179–182.
LangtonKP, McKieN, CurtisA, et al. A novel tissue inhibitor of metalloproteinases-3 mutation reveals a common molecular phenotype in Sorsby’s fundus dystrophy. J Biol Chem. 2000;35:27027–27031.
FelborU, StohrH, AmannT, SchonherrU, WeberBH. A novel Ser156Cys mutation in the tissue inhibitor of metalloproteinases-3 (TIMP3) in Sorsby’s fundus dystrophy with unusual clinical features. Hum Mol Genet. 1995;12:2415–2416.
UmedaS, AyyagariR, SuzukiMT, et al. Molecular cloning of ELOVL4 gene from cynomolgus monkey (Macaca fascicularis). Exp Anim. 2003;2:129–135.
EdwardsAO, DonosoLA, RitterR, III. A novel gene for autosomal dominant Stargardt-like macular dystrophy with homology to the SUR4 protein family. Invest Ophthalmol Vis Sci. 2001;11:2652–2663.
WienbergJ, StanyonR. Comparative painting of mammalian chromosomes. Curr Opin Genet Dev. 1997;6:784–791.
O’BrienSJ, Menotti-RaymondM, MurphyWJ, et al. The promise of comparative genomics in mammals. Science. 1999;5439:458–462,479–481.
Crouau-RoyB, ServiceS, SlatkinM, FreimerN. A fine-scale comparison of the human and chimpanzee genomes: linkage, linkage disequilibrium and sequence analysis. Hum Mol Genet. 1996;8:1131–1137.
Figure 1.
 
Edited version of the monkey pedigree with macular degeneration: fM, the founder breeding male monkey with typical macular degeneration, is shown with five healthy mates arrayed horizontally. The first-generation offspring are also arrayed horizontally. The breeding members from each branch of the first generation offspring are arrayed vertically with their mates and progeny. Monkeys used for *linkage analysis and #mutation screening are marked.
Figure 1.
 
Edited version of the monkey pedigree with macular degeneration: fM, the founder breeding male monkey with typical macular degeneration, is shown with five healthy mates arrayed horizontally. The first-generation offspring are also arrayed horizontally. The breeding members from each branch of the first generation offspring are arrayed vertically with their mates and progeny. Monkeys used for *linkage analysis and #mutation screening are marked.
Figure 2.
 
Fundus photographs and fluorescein angiogram (FA) of a 14-year-old female cynomolgus monkey (Fig. 1 , monkey A) with macular degeneration, showing the right (a, c, e) and left (b, d, f) posterior poles. Fine grayish white or yellowish white dots were visible in the macula (ad). The dots were observed in the peripheral retina along blood vessels in this monkey (a, b). These dots showed hyperfluorescence in FA except in the foveola (e, f). High-magnification of the macular region (c, d, e).
Figure 2.
 
Fundus photographs and fluorescein angiogram (FA) of a 14-year-old female cynomolgus monkey (Fig. 1 , monkey A) with macular degeneration, showing the right (a, c, e) and left (b, d, f) posterior poles. Fine grayish white or yellowish white dots were visible in the macula (ad). The dots were observed in the peripheral retina along blood vessels in this monkey (a, b). These dots showed hyperfluorescence in FA except in the foveola (e, f). High-magnification of the macular region (c, d, e).
Figure 3.
 
Drusen in the affected monkey retina. An affected 14-year-old male monkey (Fig. 1 , monkey B). There were various-sized drusen, which were weakly stained by PAS ( Image not available ), between the RPE and choriocapillaris (CC) (a, b). These drusen were strongly reactive with antibodies against complement C5 (green channel). Lipofuscin autofluorescence is shown (red) in the RPE (c, d). Accumulation of lipofuscin in RPE cells was also obvious by PAS (a, b, arrows).
Figure 3.
 
Drusen in the affected monkey retina. An affected 14-year-old male monkey (Fig. 1 , monkey B). There were various-sized drusen, which were weakly stained by PAS ( Image not available ), between the RPE and choriocapillaris (CC) (a, b). These drusen were strongly reactive with antibodies against complement C5 (green channel). Lipofuscin autofluorescence is shown (red) in the RPE (c, d). Accumulation of lipofuscin in RPE cells was also obvious by PAS (a, b, arrows).
Table 1.
 
Primer Sets Used for Cloning of the Monkey Homologues
Table 1.
 
Primer Sets Used for Cloning of the Monkey Homologues
Gene Amplified Forward Primer Position Name Reverse Primer Position Size (kb)
Region Name
VMD2 Exon 1 P1F GACCAGAAACCAGGACTGTTGA Intron P1R GAACTCGCCATATAGCAGCTT Exon 2 2.1
Exon 2 P2F GCTCTGACCAGGGTCTCTGA Intron P3R CCGCACCTTTCCCTGAACTA Intron 4.5
Exon 3 P3F CTAGACCTGGGGACAGTCTCA Intron P3R CCGCACCTTTCCCTGAACTA Intron 0.3
Exon 4–5 P4F CACGGAAGAACAACAGCTGA Exon 3 P5R ACACCAGTGGGATACTAATCCAG Exon 6 2.3
Exon 6 P6F GCCAGGAATGGACCATGAGTA Intron P6R GAGCCACTTAGCCTCTAGGTGA Intron 0.3
Exon 7–8 P7F CCTGGAGCATCCTGATTTCA Intron P8R TGAGGCCTCCCTACAGAACA Intron 2.3
Exon 9 P9F TGGCAGAGCAGCTCATCA Exon 8 P9R AGCTTCCAGGCCTTGTTG Exon 10 3.0
Exon 10 P10F AAGGGAGAAGGCCAGGTGTT Intron P10R TTTCCTGTAGTGCTTGGGTACTA Intron 1.2
Exon 11 P11F TGCCCTCCTACTGCAACATT Intron P11R ATGCAATGGAGTGTGCATTA Intron 1.1
EFEMP1 Exon 1 P1F TTCTAGAACCCTCTGGTCTCTGA Intron P1R CCCTTTCTTAACAGCAAGCTAAC Intron 0.9
Exon 2 P2F GATTGGAAGTTGAGTATGGTGGA Intron P2R CATTCTAGGGATAATGTGGTACCAA Intron 1.3
Exon 3–4 P3F AAGATGGTACTGGGCAACTGTAC Intron P4R ACATCTGTAGAGTAGCTTGACAGCA Intron 1.4
Exon 5 P5F CTACACAGGCTAGAGGAATATGATCA Intron P5R GACACAGGATTTAAGTAACTTGCTCA Intron 1.3
Exon 6–7 P6F CACTGAATGGCATGAACATTG Intron P7R TAGAACAGAATTCCCATGGGTAA Intron 1.6
Exon 8 P8F AATAGGACAAGAAGCCAGATCTCT Intron P8R TTCCTGGTTAAAACTAAATACCTAACA Intron 0.4
Exon 9–10 P9F AACAGATGAACAATAGGTGCTTGA Intron P10R TATCTATCTGGCAGTGTTACCAAGA Intron 0.9
Exon 11 P11F GTATTAGACAAGGGATAAGAGCCAA Intron P11R CAGAGGTTATGCATATATGCTGTGA Intron 1.7
TIMP3 Exon 1 P1F CCCAGCGCTATATCACTCG Intron P1R AGCCACTGTGAGTTTCCTCTG Intron 0.7
Exon 2 P2F CAATGGCTCTAACAGGAGAAGTAG Intron P2R CTTGACCAAGGTCTCATGGTTA Intron 0.8
Exon 3–4 P3F TCCAGTTCCAGCTGCATTG Intron P4R AGTTAGTGTCCAAGGGAAGCT Exon 5 2.6
Exon 5 P5F ATGTACCGAGGCTTCACCAA Exon 3 P5R AGGTGAGCTAAACACTATTCTGGA Intron 3.5
Table 2.
 
Primers for 5′–3′-RACE
Table 2.
 
Primers for 5′–3′-RACE
Gene 5′-RACE Position 3′-RACE Position
VMD2 GTATACACCAGTGGGATA Exon 6 AGAGCAACAGCTGATGTTTGAGAA Exon 3
EFEMP1 GGATGGTACATTCATCTA Exon 7 GATCCTGTGAGACAGCAATGCA Exon 3
TIMP3 ATCATCTGGGAAGAGTTA Exon 5 GATGAAGATGTACCGAGGCTTCA Exon 2–3
Table 3.
 
Primer Sets Used for Mutation Screening
Table 3.
 
Primer Sets Used for Mutation Screening
Gene Exon No. Length (bp) Name Forward Primer Name Reverse Primer Size (bp)
ABCA4 1 66 01F TCTTCGTGTGGTCATTAGC 01R ACCCCACACTTCCAACCTG 152
2 94 02F AAGTCCTACTGCACACATGG 02R CTAGACAAAAGGCCCAGACC 266
3 142 03F TTCCCAAAAAGGCCAACTC 03R CACGCACGTGTGCATTTCAG 301
4 139 04F GCTATTTCCTTATTAATGAGGC 04R GGGAAATGATGCTTGAGAGC 212
5 128 05F CCCTTCAACACCCTGTTCTT 05R TTCTTGCCTTTCTCAGGCTGG 237
6 198 06F GTATTCCCAGGTTCTGTGG 06R TACCCCAGGAATCACCTTG 330
7 88 07F AGCATATAGGAGATCAGACTG 07R GGCATAAGAGGGGTAAATGG 241
8 238 08F GAGCATTGGCCTCACAGCAG 08R CCCCAGGTTTGGTTTCACC 397
9 139 09F AGACATGTGATGTGGATACAC 09R GTGGGAGGTCCAGGGTACAC 271
10 117 10F AACACTAAGTGATAGGGGCAGAA 10R GGCCTGCTTGTTGTATTTTGAT 344
11 198 11F AGCTCACTCGCTCTTTAGGG 11R TTCAAGACCACTTGACTTGC 406
12 206 12F TGGGACAGCAGCCCTTATC 12R CCAAATGTAATTTCCCACTGAC 362
13 177 13F AATGAGTTCCGAGTCACCCTG 13R CCCATTAGCGTGTCATGG 308
14 223 14F TCCATCTGGGCTTTGTTCTC 14R AATCCAGGCACATGAACAGG 407
15 222 15F AGACAGTAACTAACAGGCTCGTG 15R GGACTGCTACAGACCCTTCC 386
16 205 16F CTGTTGCATTGGATAAAAGGC 16R GATGAATGGAGAGGGCTGG 330
17 65 17F CTGCGGTAAGGTAGGATAGGG 17R CACACCGTTTACATAGAGGGC 232
18 90 18F CAGCTCCCGGTGGTAGAGTA 18R CCCTTGCCATGAGATGTTTT 222
19 175 19F TGGGGCCATGTAATTAGGC 19R TGGGAAAGAGTAGACAGCCG 322
20 132 20F GCATGTTGCTAAAGGCCATC 20R TATCTCTGCCTGTGCCCAG 293
21 140 21F GTAAGATCAGCTGCTGGAAG 21R GAAGCTCTCCTGCTCCAAGC 301
22 138 22F CCCTCCACAGTCCCTTAACTC 22R GAGAGTGGGGACCACAGGTA 244
23 194 23F TTTTGCAACTATGTAGCCAGGA 23R AGCCTGTGTGAGTAGCCATG 384
24 85 24F GCATCAGGGAGAGGCTGTC 24R CCCAGCAATATTGGGAGATG 212
25 206 IVS24F GTAAGGACTGGACGGGCCATACTTGG IVS24R TCCAGCTCTCTGAAAAGGCTGGCATA 2 kb
IVS25F AAAGCTGGTGGAGTGCATTGGTCAAG IVS25R CCTGAATCAGAATCCTCCGTGACCTTC 500
26 49 26F TCCCATTATGAAGCAATACC 26R ACCCAGCCCCTTAGACTTTC 228
27 266 IVS26F GGATTCTGATTCAGGACCTCTGTTTGC IVS26R CTGCGGATGGTGTGTTGGAATCTCTT 2 kb
IVS27F TCCCAGAGAGAAGGCTGGACAGACAC IVS27R CCCATATATCCAGGGGTGAAGGGTCA 1 kb
28 125 28F TGCACGCGCACGTGTGAC 28R TGAAGGTCCCAGTGAAGTGGG 291
29 99 29F CAGCAGCTATCCAGTAAAGG 29R AACGCCTGCCATCTTGAAC 263
30 187 30F GTTGGGCACAATTTCTTATGC 30R ACTCAGGAGATACCAGGGAC 347
31 95 IVS30F GAGAAGCTCACCATGCTGCCAGAGT IVS30R GAGATGTTCCTGTCCGTCAGGTCTTG 2 kb
IVS31F CGCAGCACGGAAATTCTACAAGACCT IVS31R CCTCTGTTCATTGACCCAGAATTTGCT 700
32 33 32F ACGGCACTGCTGTACTTGTG 32R TCAACATGGCTGTGAGGTGT 182
33 106 IVS32F GAGCAAATTCTGGGTCAATGAACAGAGG IVS32R CGCTTAAAAACCCAACAAGTGCTTCC 1.2 kb
IVS33F AGGTATGGAGGAATTTCCATTGGAGGA IVS33R CTTTAGAGGCCTCTCTAGTGATAGG 300
34 75 34F AAACCGTCTTGTTTGTTTGTTT 34R AGGAGGGAGGGAATTCAATG 208
35 170 IVS34F GGCCCTATCACTAGAGAGGCCTCTAAAG IVS34R GGTTGGCTAATGACGGTGATTCCATAC 550
IVS35F CATGCCCTGGTCAGCTTTCTCAATGT IVS35R GAGAAAATCACGCAGATGGCAACCAC 2 kb
36 178 36F TGTAAGGCCTTCCCAAAGC 36R TGGTCCTTCAGAGCACACAC 346
37 116 37F CATTTTGCAGAGCTGGCAGC 37R CTTCTGTCAGGAGATGATCC 260
38 158 38F GGAGTGCATTATATCCAGACG 38R CCTGGCTCTGCTTGACCAAC 302
39 125 39F TGCTGTCCTGTGAGAGCATC 39R CTTCCAGCCCAACAAGGTC 344
40 130 IVS39F CTGCTCATTGTCTTCCCCCACTTCTG IVS39R CAGCAGGGTCAGGAGGAAGTACACCA 700
IVS40F GTGAGGAGCACTCTGCAAATCCGTTC IVS40R AGATGAGGAAAAGGGGTCAGGATTGG 3.5 kb
41 121 41F GAAGAGAGGTCCCATGGAAAGG 41R GCTTGCATAAGCATATCAATTG 299
42 63 42F CTCCTAAACCATCCTTTGCTC 42R AGGCAGGCACAAGAGCTG 214
43 107 43F GGTCTCTAGGGCCAGGCTA 43R CACATCTTTCAGGGCCTCAG 271
44 142 44F GAAGCTTCTCCAGCCCTAGC 44R TGCACTCTCATGAAACAGGC 277
45 135 IVS44F ACATCTTTACCTTTATGCCCGGCTTCG IVS44R AATGAGTGCGATGGCTGTGGAGAGTT 4 kb
IVS45F TTAAGAGCCTGGGCCTGACTGTCTACG IVS45R GAATCTCTTGCCTGTGGGATGTGAGG 1 kb
46 104 48F GAAGCAGTAATCAGAAGGGC 46R GCCTCACATTCTTCCATGCTG 257
47 93 47F TCACATCCCACAGGCAAGAG 47R TTCCAAGTGTCAATGGAGAAC 258
48 250 48F ATTACCTTAGGCCCAACCAC 48R ACACTGGGTGTTCTGGACC 365
49 87 49F GGTGTAGGGTGGTGTTTTCC 49R ACTGCCTCAAGCTGTGGACT 187
VMD2 2* 152 P2F GCTCTGACCAGGGTCTCTGA P3R CCGCACCTTTCCCTGAACTA 4.5 kb
3 95 P3F CTAGACCTGGGGACAGTCTCA P3R CCGCACCTTTCCCTGAACTA 325
4 234 MP4aF TGGGAGACAGAACCCTTGGA MP4aF GTCCTTGCCTTCCACGAA 302
MP4bF TGGTGGAACCAGTACGAGAA MP4bF TCCACCCATCTTCCATTGTT 286
5 155 MP5F AAAGGAGTGCTGAGGTTCCTATA MP5R CTTGTTTCCTGTGAACCACAA 330
6 78 P6F GCCAGGAATGGACCATGAGTA P6R GAGCCACTTAGCCTCTAGGTGA 292
7* 153 P7F CCTGGAGCATCCTGATTTCA P8R TGAGGCCTCCCTACAGAACA 2.3 kb
8 81 MP8F GCATCATGTGGTGTGGAAAT P8R TGAGGCCTCCCTACAGAACA 270
9 152 MP9F CAAGTCATCAGGCACGTACAA MP9R CTAGGCAGACCCCTGCTACTA 286
10* 639 P10F AAGGGAGAAGGCCAGGTGTT P10R TTTCCTGTAGTGCTTGGGTACTA 1.2 kb
11 19 P11F TGCCCTCCTACTGCAACATT MP11R AAGTAGTCCTGGACTGCTGATTT 270
EFEMP1 2 81 MP2F CCGCAGCAGATACTAAATATCAG MP2R CCGCTGAACCGTACTTATTTC 173
3 49 MP3F CTTAGGGAATGGACACACCAA MP3R ACAGAAGGCCAAAGATCACAT 155
4 387 MP4aF CCCTCTTAGAAGATTCCTGACTTA MP4aR ACACTCCACTGGTTGCCAT 249
MP4bF ATGAACAGCCTCAGCAGGA MP4bR GCAAAAGCTTTCGATGGTTA 316
5 123 MP5F GGAGGCAATATCAACATCTTCA MP5R TGCTTGAGGTTGAAACAGTTAAG 248
6 120 MP6F GCAAACAGCAATGCTAATTCA MP6R GAAATACTGCAACATGGCATG 250
7 120 MP7F CAGCTAGGGAATTATTTATCAGCA MP7R CAGGGATTGGACTTTATTCCA 279
8 120 MP8F ATATCCAAAGTAGTGGTGCACAA P8R TTCCTGGTTAAAACTAAATACCTAACA 235
9 124 MP9F TGCAAACAGAATCTGCCAGTA MP9R TTTGGCTTGGTAAGACCAGAA 265
10 196 MP10F CTTACCAAGCCAAACTGCTAACTA MP10R AACAAACTCCCATCTTTCTCAATAG 289
11 162 MP11F AAAGCATAGAAACTCCAATGCA MP11R AGGTAACAATATTCTTTGGCTGACT 281
ELOVL4 1 100 MP1F CCGCGGTTAGAGGTGTTC MP1R GAGACCAGGGGTCGGTGAC 281
2 188 MP2aF TTGAGACATCTTGATTCCTAGAAAG MP2aR AAGTTAAGCAAAACCATCCCA 252
MP2bF CTGGGTCCAAAGTGGATGAA MP2bR AGCTAACAGTTATGTCTGGGTACAA 213
3 81 MP3F GCAATTGGAATGCATGACA MP3R TTTCACAGATTGGGGCCTATA 304
4 172 MP4aF AAATGATTCCATGCCTTGTACA MP4aR AACGCAAGCAGTATATTCCTGA 330
MP4b TGGTGTTTATAACACGCTTTCC MP4bR CTCATTGCTTTCCACTGAACA 271
5 128 MP5F ATCTCGGTGGCTTACTGCTTA MP5R AATAAGTCGGCTGGAGTCAACT 356
6 276 MP6aF TTGGGCCTGTGATAGCTATG MP6aR TTAGGCTCTTTGTATGTCCGAA 247
MP6bF CTCTAATTGCCTACGCAATCAG MP6bR GGGAGTTTTTCCTCACTGTCA 242
TIMP3 1 121 MP1F AACTTTGGAGAGGCGAGCA MP1R CCTAAGCAGCGCTGCAGTC 233
2 83 MP2F TGAGATGCTGTTCCTGATGTG MP2R GGCTGGTGCTTAGACACACA 266
3 112 MP3F AGCAGTGGGATTATGGATCATAC MP3R ACATTTGGTGAGTCAGCTACTCA 267
4 122 MP4F TGGGCTAAGTGGGAACATAGTA MP4R GTTTCTAGGGCTGCAAGTCA 274
5 198 MP5F TACCATGGCAGATTCCATCA MP5R AGTTAGTGTCCGAGGGAAGCT 306
Table 4.
 
Two-Point Lod Scores between the Monkey Macular Degeneration Locus and Markers at the Human Macular Degeneration Loci
Table 4.
 
Two-Point Lod Scores between the Monkey Macular Degeneration Locus and Markers at the Human Macular Degeneration Loci
Markers Distance from the Gene (CM) Order on the Chromosome (M) Lod Scores at θ Exclusion (Z = −2)
0 0.001 0.005 0.01 0.05 0.1 0.2 0.3 0.4
CORD8 154.28
D1S431 10.5 165 −ε −2.116 −1.422 −1.128 −0.483 −0.248 −0.071 −0.01 0.006 0.001
D1S2635 0 154.28 −ε −11.078 −7.598 −6.112 −2.773 −1.469 −0.392 0.019 0.119 0.075
D1S2715 −6.9 147.01 −ε −7.7 −4.925 −3.747 −1.162 −0.232 0.388 0.464 0.299 0.03
D1S498 −10.6 144.94 −ε −1.124 −0.439 −0.154 0.416 0.564 0.567 0.433 0.227 0.0001
ABCA4 94.1
D1S188 −2.3 91.7 −ε −6.139 −4.058 −3.175 −1.24 −0.541 −0.05 0.074 0.066 0.01
D1S2849 −1.2 92.9 −ε −1.766 −1.075 −0.784 −0.166 0.032 0.133 0.119 0.067
D1S2868 0.1 94 −ε −14.824 −10.623 −8.809 −4.599 −2.846 −1.264 −0.522 −0.146 0.1
STGD3 80.5
D6S1662 −2.67 77.83 −ε −1.232 −0.544 −0.257 0.324 0.476 0.472 0.34 0.17 0.0
D6S1048 0.28 80.78 −ε −0.063 0.614 0.889 1.38 1.416 1.172 0.79 0.362 0.0
D6S1596 7.1 87.6 −ε −8.746 −5.965 −4.78 −2.138 −1.127 −0.319 −0.025 0.049 0.05
D6S1609 12.08 92.58 −ε −7.326 −5.235 −4.34 −2.302 −1.475 −0.724 −0.349 0.131 0.05
DHRD 56.1
D2S2230 3.9 60 −ε −11.691 −8.209 −6.719 −3.349 −2.006 −0.842 −0.325 −0.084 0.1
D2S378 1.1 57.2 −ε −9.268 −6.482 −5.29 −2.593 −1.517 −0.588 −0.186 −0.019 0.05
ARMD1 192.2
D1S384 −2.11 190.09 −ε −5.565 −3.486 −2.606 −0.696 −0.032 0.375 0.389 0.236 0.01
D1S413 2.1 194.1 −ε −11.068 −7.59 −6.106 −2.784 −1.501 −0.46 −0.067 0.047 0.05
D1S2622 3.7 195.9 −ε −1.961 −1.271 −0.982 −0.375 −0.185 −0.084 −0.066 −0.047 0.0
VMD2 61.5
D11S1993 −2.3 59.2 −ε −1.615 −0.925 −0.636 −0.032 0.151 0.224 0.181 0.1 0.0
D11S4174 1.4 62.9 −ε −7.132 −5.026 −4.112 −1.979 −1.102 −0.368 −0.087 0.003 0.01
D11S4076 7.3 66.8 −ε −5.617 −3.537 −2.656 −0.736 −0.061 0.364 0.385 0.231 0.01
Rhodopsin 130.6
D3S3515 −4.01 126.59 −ε −2.756 −1.379 −0.803 0.383 0.717 0.775 0.584 0.302 0.001
D3S3720 −2.8 127.8 −ε −2.626 −1.247 −0.67 0.531 0.879 0.945 0.729 0.389 0.001
D3S1269 0.3 130.9 −ε −11.566 −8.081 −6.588 −3.2 −1.846 −0.7 −0.238 −0.062 0.05
Timp3 31.5
D22S1162 7.05 38.55 −ε −3.587 −2.203 −1.619 −0.365 0.055 0.291 0.276 0.159 0.005
D22S280 0 31.5 −ε −4.051 −2.664 −2.075 −0.785 −0.321 −0.002 0.065 0.044 0.01
D22S273 −1 30.5 −ε −1.878 −1.187 −0.896 −0.278 −0.078 0.026 0.025 0.004 0.0
CTRP5 118.7
D11S4127 −1.6 117.1 −ε −0.771 −0.088 0.192 0.73 0.827 0.719 0.495 0.244 0.0
D11S924 0.2 118.9 −ε −1.424 −0.736 −0.449 0.137 0.298 0.322 0.232 0.113 0.0
D11S4129 4.48 121.58 −ε −9.057 −6.275 −5.089 −2.435 −1.41 −0.566 −0.214 −0.054 0.05
STGD4 26.1
D4S403 0 26.1 −ε −16.798 −11.919 −9.83 −5.081 −3.159 −1.445 −0.633 −0.206 0.1
D4S391 1.2 27.3 −ε −3.615 −2.231 −1.647 −0.392 0.026 0.255 0.234 0.13 0.005
CORD5 (Interval) 64.5
D17S938 0 64.5 −ε −16.296 −11.422 −9.339 −4.638 −2.776 −1.176 −0.466 −0.125 0.1
D17S796 0 64.5 −ε −3.594 −2.209 −1.624 −0.358 0.075 0.324 0.305 0.176 0.0
MCDR1 (Interval) 98.1
D6S434 4.3 102.4 −ε −4.496 −3.103 −2.507 −1.163 −0.632 −0.183 −0.005 0.043 0.0
CORD9 (Interval) 47.6
D8S1820 0 47.6 −ε −11.981 −8.501 −7.014 −3.65 −2.277 −1.002 −0.385 −0.092 0.1
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×