Abstract
purpose. To determine the effect of bimatoprost on intraocular pressure in the prostaglandin FP receptor knockout mouse.
methods. The IOP response to a single 1.2-μg (4 μL) dose of bimatoprost was measured in the treated and untreated fellow eyes of homozygote (FP+/+, n = 9) and heterozygote (FP±, n = 10) FP-knockout mice, as well as in wild-type C57BL/6 mice (FP+/+, n = 20). Serial IOP measurements were also performed after topical bimatoprost in a separate generation of homozygous FP-knockout mice and wild-type littermate control animals (n = 4 per group). Aqueous humor protein concentrations were measured to establish the state of the blood–aqueous barrier. Tissue, aqueous humor and vitreous concentrations of bimatoprost, latanoprost, and their C-1 free acids were determined by liquid chromatography and tandem mass spectrometry.
results. A significant reduction in IOP was observed in the bimatoprost-treated eye of wild-type mice at 2 hours, with a mean difference and 95% confidence interval (CI) of the difference in means of −1.33 mm Hg (−0.81 to −1.84). Bimatoprost did not lead to a significant reduction in IOP in either the heterozygous knockout −0.36 mm Hg (−0.82 to +0.09) or homozygous FP-knockout mice 0.25 mm Hg (−0.38 to +0.89). The lack of an IOP response in the FP-knockout mice was not a consequence of blood–aqueous barrier breakdown, as there was no significant difference in aqueous humor protein concentration between treated and fellow eyes. Tissue and aqueous humor concentrations of bimatoprost, latanoprost, and their C-1 free acids indicate that latanoprost, but not bimatoprost, is hydrolyzed in the mouse eye after topical administration.
conclusions. An intact FP receptor gene is critical to the IOP response to bimatoprost in the mouse eye.
Topically administered prostaglandin (PG) F
2α and its analogues lower IOP in humans and nonhuman primates
1 2 by increasing the uveoscleral outflow of aqueous humor.
3 Bimatoprost, the C-1 ethyl amide of 17-phenyl-prostaglandin F
2α, a structural analogue, is also a potent ocular hypotensive.
4 Although the molecular mechanisms responsible for IOP lowering are not known, it has been suggested that bimatoprost fundamentally differs from latanoprost, by lowering IOP through mechanisms that are independent of FP receptor signaling.
5 However, there is considerable controversy regarding the role of FP receptor signaling, because bimatoprost has been shown to bind and activate the FP receptor in cultured human trabecular meshwork and human ciliary muscle cells.
6
Measurement of aqueous humor dynamics in the mouse eye has been detailed recently.
7 The FP knockout mouse, generated by homologous translocation with a target vector that replaces the second exon of the FP gene with the β-galactosidase and neomycin-resistance gene, was produced to demonstrate the critical role of the interaction of PGF
2α with FP receptors in the initiation of parturition in pregnant mice.
8 We recently demonstrated that a single application of latanoprost had no effect on IOP in the FP homozygous knockout mice and a diminished effect in the heterozygous knockout mice, compared with C57 BL/6 background control mice.
9 This indicates that the FP receptor is necessary for the acute IOP response to latanoprost. The FP-knockout mouse also provides the opportunity to determine whether bimatoprost lowers IOP in the absence of the FP receptor.
To facilitate administration of eye drops, mice were restrained in a conical plastic sleeve (Decapicone; Braintree Scientific Inc., Braintree, MA). Four microliters bimatoprost 0.03% (Allergan, Irvine, CA) was applied topically to the right eye. Dose–response curve and time course were performed in C57BL/6 mice to determine the optimum dose of drug and the time of maximum IOP lowering.
DNA was extracted from 8-mm tail biopsy specimens of anesthetized adult mice using a kit (69504; Qiagen, Valencia, CA) according to the manufacturer’s guidelines. The oligonucleotide primers used to detect homologous translocation were 5F (GCCCATCCTTGGACACCGAGA), 6R (AGAGTCGGCAAGCTGTGACTT) and NeoII (TGATATTGCTGAAGAGCTTGG). Amplification was performed over 35 cycles of 94°C for 30 seconds, 65°C for 30 seconds, and 75°C for 10 minutes. PCR products were analyzed by electrophoresis in 1% agarose gels. The PCR product sizes were 700 bp for the FP receptor gene and 450 bp, corresponding to the LacZ/neo(r) cassette. DNA from the heterozygote Fp−/− mice therefore produces two bands (700 and 450 bp) and DNA from a homozygous FP+/+-knockout mouse producing a single band (450 bp).
Cannulation Technique.
Induction-Impact (Rebound) Tonometry.
Aqueous protein concentration was measured to determine whether topical application of bimatoprost led to a significant breakdown in the blood–aqueous barrier, which could result in secondary changes in IOP. Two hours after administration of bimatoprost, (1.2 μg in 4 μL), aqueous humor was aspirated through a microneedle attached to a 10-μL syringe-equipped micropump (Hamilton, Reno, NV; and Micro 4, World Precision Instruments). The Bradford protein assay (Bio-Rad Laboratories, Hercules, CA) was used according to the manufacturer’s guidelines. Aqueous humor samples (3 μL) were diluted in 97 μL phosphate-buffered saline. Eighty microliters of this solution was then mixed with 20 μL assay solution (Bio-Rad) in separate wells of a 96-well microtiter plate. Absorption was measured at 595 nm with a microtiter plate reader (SpectraMax 250). Aqueous protein concentration was determined from linear regression curves derived from bovine serum albumin standards.
To understand the contribution of 17-phenyl trinor PGF2α, the C-1 acid of bimatoprost and a potent FP agonist, to lowering IOP in the mouse, we sought to determine the hydrolysis of bimatoprost in ocular tissues of C57BL/6J mice killed 2 hours after a single dose. A further group of mice treated with latanoprost was included for comparison.
Both eyes of 20 mice were treated topically with 4 μL of 0.03% bimatoprost (1.2 μg) per eye. Another 20 mice were treated with 4 μL of 0.005% latanoprost in the same manner. Untreated mice (n = 32) were used as the negative control. Mice were killed with CO2 gas at 2 hours after treatment and weighed. The eyes were enucleated, and bimatoprost or latanoprost and the corresponding C-1 acid concentrations were determined by liquid chromatography and tandem mass spectrometry (LC-MS/MS).
Eyes were briefly rinsed in Dulbecco’s phosphate-buffered saline. Each eye was dissected into anterior and posterior segments and the lens, vitreous humor, and aqueous humor were removed. Eyes were bisected, and each anterior and posterior segment was cut in half and placed directly into preweighed microcentrifuge tubes cooled on dry ice. Segments were pooled (eight anterior or eight posterior) from four animals. Five pooled samples were obtained for each test material. Tissues from untreated mice were processed in the same manner. The untreated tissues from 16 mice were collected as four pooled samples for each segment (eight anterior or eight posterior) at the time of the bimatoprost study. Another 16 mice were used to provide untreated tissues for the latanoprost study. The tissue weight of each pooled sample was determined. One milliliter acetonitrile-methanol (1:1 vol/vol) was added to each sample and then incubated at 5°C overnight (∼18 hours). The samples were centrifuged at 10,000g for 2 minutes. The supernatant was removed and evaporated to dryness at 37°C with a stream of nitrogen gas. The residues were stored at −20°C until assayed.
In a further set of experiments, eyes were treated with a 4-μL drop of bimatoprost or latanoprost or no treatment (10 eyes of 5 mice per group). After 2 hours, aqueous humor was aspirated as described earlier, and samples for each treatment group were pooled. Levels of bimatoprost, latanoprost, and their C-1 free acids were determined by LC-MS/MS. Masked aqueous humor samples where split and run in a masked fashion to determine levels of bimatoprost-bimatoprost acid and latanoprost-latanoprost acid separately.
The dry residue was reconstituted with 200 μL of 100% acetonitrile. The reconstituted samples were injected (80 μL) and analyzed by LC-MS/MS using a mass spectrometer (PE Sciex API 3000; Applied Biosystems, Foster City, CA), with a Shimadzu autosampler and HPLC pumps (Shimadzu Scientific Instruments, Columbia, MD) using an APS-2 column (3 μm, 2 × 150 mm; Keystone Scientific, Bellefonte, PA). The extracts were analyzed for parent compounds and the corresponding C-1 acid metabolites using multiple reaction monitoring (MRM) and deuterated compounds as internal standards. The results were expressed as concentration of analytes in nanograms per gram of tissue and ratio of C-1 acid concentration to parent compound concentration.
Bimatoprost eluted at approximately 2.2 minutes and 17-phenyl trinor PGF
2α eluted at approximately 4.2 minutes in the HPLC system. Blank samples showed no detectable concentrations indicating assay specificity. Standards were used to quantify bimatoprost and 17-phenyl trinor PGF
2α in anterior and posterior ocular tissues and lower limit of quantitation (LOQ) was 2 pg on column injection for both bimatoprost and 17-phenyl trinor PGF
2α. Linear standard curves were achieved from 2 pg to 10 ng on column injection with correlation coefficient values of 0.99 for both bimatoprost and 17-phenyl trinor PGF
2α. The accuracy of the quality control samples in the anterior and posterior ocular tissues for the range of 2.5 pg to 1 ng on column injection ranged from 79% to 108% and 84% to 127% for bimatoprost and 17-phenyl trinor PGF
2α, respectively. The mean bimatoprost concentrations and C-1 acid concentrations did not differ greatly from the anterior to posterior tissues
(Table 2) . The bimatoprost concentration was 15.9 ± 4.1 ng/g in the anterior samples and 10.6 ± 2.9 ng/g in the posterior samples. The C-1 acid concentration of bimatoprost was much lower, with 0.32 ± 0.16 and 0.23 ± 1.01 ng/g in the anterior and posterior samples, respectively. Two of the five posterior samples had amounts below the limit of quantitation.
In comparison, latanoprost eluted at approximately 3.5 minutes, and latanoprost free acid eluted at approximately 3.0 minutes in the HPLC system. Blank samples showed no detectable concentrations, indicating assay specificity. The neat standards were used to quantify latanoprost and latanoprost free acid in anterior and posterior ocular tissues, and the lower limit of quantitation (LOQ) was 2 pg on column injection for both latanoprost and latanoprost free acid. Linear standard curves were achieved from 2 pg to 10 ng on column injection with correlation coefficient values of 0.99 for both latanoprost and latanoprost free acid. The accuracy of the quality control samples in mouse anterior and posterior ocular tissues for the range of 2.5 pg to 1 ng on column injection ranged from 71.6% to 115% and 78.5% to 108% for latanoprost and latanoprost free acid, respectively. The amount of latanoprost did not differ greatly from the anterior to the posterior tissues; however, latanoprost free acid was three times higher in the anterior samples than in the posterior samples. Specifically, the latanoprost concentration was 3.5 ± 1.4 ng/g in the anterior samples and 4.2 ± 2.1 ng/g in the posterior samples. C-1 acid concentration was higher with 20.1 ± 7.9 and 6.6 ± 3.2 ng/g in the anterior and posterior samples, respectively.
The results demonstrate that a single application of bimatoprost does not reduce IOP in FP receptor knockout mice. A significant reduction in IOP was observed, however, in bimatoprost-treated wild-type littermate control mice as well as C57BL/6 mice, which are the founder species for the FP-knockout mice and have normal FP receptor expression. Further, bimatoprost is not efficiently hydrolyzed to 17-phenyl trinor PGF2α in the mouse eye, although trace levels of the free acid were detectable in the ocular tissues of the anterior and posterior segment 2 hours after a single treatment. These data indicate that the early IOP response to a single application of bimatoprost is critically dependent on FP receptor expression in the mouse eye.
Several potential limitations of this study should be considered. First, the data were generated in the mouse, and extrapolation to the human should be made with caution. We have shown that aqueous humor dynamics in the mouse have several similarities to those of the human.
7 In addition, a close correlation has been reported in the relative potencies of several of FP agonists in functional agonist assays of cultured human trabecular meshwork compared with mouse fibroblast lines.
6 13 14 This supports the existence of homology in the amino acid structure of the FP receptors of the two species. Although non-FP mechanisms are not significant in the early response in the mouse, it is possible that alternative FP-independent mechanisms are relevant in the human. Second, the effect of repeated exposure to bimatoprost in the FP-knockout or wild-type mice has not yet been investigated. With these limitations in mind, it is clear that the FP receptor plays a critical role in the early IOP response to bimatoprost in the mouse. The similarities in aqueous humor dynamics in the mouse and human, coupled with homology in the cellular response to FP agonists and the availability of genetically engineered mice support the value of this model for studying the mechanisms of IOP-lowering by prostaglandin analogues.
It has been suggested that bimatoprost reduces IOP by an as yet uncharacterized prostamide receptor.
5 15 16 17 18 19 There are conflicting reports on what concentration of bimatoprost free acid is needed in the aqueous humor to activate FP receptor signaling and to lower IOP. Studies of FP receptor signaling using cultured human trabecular meshwork or human ciliary muscle cells as well as mouse fibroblasts and rat aortic smooth muscle showed that bimatoprost acid has a relatively high affinity for the FP receptor (
K i = 83 nM) and an EC
50 of 2.8 to 3.8 nM in most cells as measured by equilibrium phosphoinositide (PI) turnover assays.
20 Bimatoprost also exhibited functional activity at the FP receptor in human trabecular meshwork cells (EC
50 = 3245 nM).
20 In contrast to latanoprost, bimatoprost is only slowly hydrolyzed to its free acid form by corneal and other ocular tissues.
21 22 Levels of bimatoprost free acid (22 ±7.0 nM, 2 hours after the last dose after 7 days of treatment) have recently been reported in the aqueous humor of patients undergoing cataract surgery.
23 Finally, the selective FP antagonist AL-8810 (11β-fluoro-15-epi-15-indanyl prostaglandin F2α) inhibited the agonist activity of bimatoprost and bimatoprost acid, further suggesting a role for the FP receptor.
24 25 26
Because bimatoprost C-1 free acid levels were largely undetected in aqueous humor and ocular tissues 2 hours after topical application, it is unlikely that bimatoprost C-1 acid, which is known to be a potent FP receptor agonist, plays a major contribution to the acute IOP reduction in the mouse. The levels of bimatoprost in tissue and aqueous were well below the EC50 documented in vitro by a calcium-mobilization assay in the transformed Swiss 3T3 murine cell line (3120 nM for bimatoprost and 49 nM for bimatoprost acid). This raises the possibility that primary ocular tissues may have different binding affinities in vivo. Another possible explanation is that spliced variants of the FP receptor could have different agonist affinities and explain our data. Our finding that no significant IOP lowering occurs in the absence of intact FP receptor gene strongly supports the view that FP signaling, at least in the mouse, is critical for the early IOP response to bimatoprost.
Supported in part by the National Eye Institute EY05990 (RNW).
Submitted for publication June 8, 2005; revised July 21, 2005; accepted October 13, 2005.
Disclosure:
J.G. Crowston, Alcon Inc. and Pfizer, Inc. (R);
J.D. Lindsey, None;
C.A. Morris, None;
L. Wheeler, Allergan USA (E);
F.A. Medeiros, None;
R.N. Weinreb, Allergan USA (C)
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “
advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Corresponding author: Robert N. Weinreb, Hamilton Glaucoma Center, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0946;
weinreb@eyecenter.ucsd.edu.
Table 1. Mean Difference in IOP between Bimatoprost-Treated and Untreated Fellow Eyes
Table 1. Mean Difference in IOP between Bimatoprost-Treated and Untreated Fellow Eyes
| Genotype | n | Mean Difference in IOP (mm Hg) | 95% CI for Difference in Means |
| C57BL/6 | 20 | −1.33 | −1.84 to −0.81 |
| Heterozygote FP+/− | 10 | −0.36 | −0.82 to +0.09 |
| Homozygote | 8 | +0.25 | −0.38 to +0.89 |
Table 2. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost, and Latanoprost C-1 Acid Levels in Ocular Tissues
Table 2. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost, and Latanoprost C-1 Acid Levels in Ocular Tissues
| Bimatoprost (ng/g) | Bimatoprost C-1 Acid (ng/g) | Ratio Parent/C-1 | Latanoprost (ng/g) | Latanoprost C-1 Acid (ng/g) | Ratio Parent/C-1 |
| Anterior segment | 15.9 ± 4.1 | 0.32 ± 0.2 | 49.7 | 3.5 ± 1.4 | 20.1 ± 7.9 | 0.176 |
| (39.8 nM) | (0.8 nM) | | (8.8 nM) | (50.3 nM) | |
| Posterior segment | 10.6 ± 2.9 | 0.23 ± 1.0 | 46.1 | 4.2 ± 2.1 | 6.6 ± 3.2 | 0.641 |
| (26.5 nM) | (0.6 nM) | | (10.5 nM) | (16.5 nM) | |
Table 3. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost and Latanoprost C-1 Acid Levels in Aqueous Humor
Table 3. Bimatoprost, Bimatoprost C-1 Acid, Latanoprost and Latanoprost C-1 Acid Levels in Aqueous Humor
| Bimatoprost | Bimatoprost C-1 acid | Latanoprost | Latanoprost C-1 Acid |
| Concentration | 1.6 (4 nM) | <1 | <5 | 98 (245 nM) |
| LOQ | 0.25 | 1 | 5 | 5 |
The authors thank Jinsong Ni and June Chen (Allergan USA) for their assistance in measuring tissue prostaglandin concentrations.
GiuffreG. The effects of prostaglandin F2 alpha in the human eye. Graefes Arch Clin Exp Ophthalmol. 1985;222:139–141.
[CrossRef] [PubMed]CamrasCB, BitoLZ. Reduction of intraocular pressure in normal and glaucomatous primate (Aotus trivirgatus) eyes by topically applied prostaglandin F2 alpha. Curr Eye Res. 1981;1:205–209.
[CrossRef] [PubMed]TorisCB, CamrasCB, YablonskiME. Effects of PhXA41, a new prostaglandin F2 alpha analog, on aqueous humor dynamics in human eyes. Ophthalmology. 1993;100:1297–1304.
[CrossRef] [PubMed]BrubakerRF. Mechanism of action of bimatoprost (Lumigan). Surv Ophthalmol. 2001;45(suppl 4)S347–S351.
[CrossRef] [PubMed]WoodwardDF, KraussAH, ChenJ, et al. Pharmacological characterization of a novel antiglaucoma agent, bimatoprost (AGN 192024). J Pharmacol Exp Ther. 2003;305:772–785.
[CrossRef] [PubMed]SharifNA, KellyCR, CriderJY. Human trabecular meshwork cell responses induced by bimatoprost, travoprost, unoprostone, and other FP prostaglandin receptor agonist analogues. Invest Ophthalmol Vis Sci. 2003;44:715–721.
[CrossRef] [PubMed]AiharaM, LindseyJD, WeinrebRN. Aqueous humor dynamics in mice. Invest Ophthalmol Vis Sci. 2003;44:5168–5173.
[CrossRef] [PubMed]SugimotoY, YamasakiA, SegiE, et al. Failure of parturition in mice lacking the prostaglandin F receptor. Science. 1997;277:681–683.
[CrossRef] [PubMed]CrowstonJG, LindseyJD, AiharaM, WeinrebRN. Effect of latanoprost on intraocular pressure in mice lacking the prostaglandin FP receptor. Invest Ophthalmol Vis Sci. 2004;45:3555–3559.
[CrossRef] [PubMed]AiharaM, LindseyJD, WeinrebRN. Reduction of intraocular pressure in mouse eyes treated with latanoprost. Invest Ophthalmol Vis Sci. 2002;43:146–150.
[PubMed]AiharaM, LindseyJD, WeinrebRN. Twenty-four-hour pattern of mouse intraocular pressure. Exp Eye Res. 2003;77:681–686.
[CrossRef] [PubMed]DaniasJ, KontiolaAI, FilippopoulosT, MittagT. Method for the noninvasive measurement of intraocular pressure in mice. Invest Ophthalmol Vis Sci. 2003;44:1138–1141.
[CrossRef] [PubMed]GriffinBW, WilliamsGW, CriderJY, SharifNA. FP prostaglandin receptors mediating inositol phosphates generation and calcium mobilization in Swiss 3T3 cells: a pharmacological study. J Pharmacol Exp Ther. 1997;281:845–854.
[PubMed]KellyCR, WilliamsGW, SharifNA. Real-time intracellular Ca2+ mobilization by travoprost acid, bimatoprost, unoprostone, and other analogs via endogenous mouse, rat, and cloned human FP prostaglandin receptors. J Pharmacol Exp Ther. 2003;304:238–245.
[CrossRef] [PubMed]WoodwardDF, KraussAH, ChenJ, et al. The pharmacology of bimatoprost (Lumigan). Surv Ophthalmol. 2001;45(suppl 4)S337–S345.
[CrossRef] [PubMed]LiangY, LiC, GuzmanVM, et al. Comparison of prostaglandin F2alpha, bimatoprost (prostamide), and butaprost (EP2 agonist) on Cyr61 and connective tissue growth factor gene expression. J Biol Chem. 2003;278:27267–27277.
[CrossRef] [PubMed]SpadaCS, KraussAH, WoodwardDF, et al. Bimatoprost and prostaglandin F(2 alpha) selectively stimulate intracellular calcium signaling in different cat iris sphincter cells. Exp Eye Res. 2005;80:135–145.
[CrossRef] [PubMed]ChenJ, SeniorJ, MarshallK, et al. Studies using isolated uterine and other preparations show bimatoprost and prostanoid FP agonists have different activity profiles. Br J Pharmacol. 2005;144:493–501.
[CrossRef] [PubMed]MatiasI, ChenJ, De PetrocellisL, et al. Prostaglandin ethanolamides (prostamides): in vitro pharmacology and metabolism. J Pharmacol Exp Ther. 2004;309:745–757.
[CrossRef] [PubMed]SharifNA, KellyCR, CriderJY, WilliamsGW, XuSX. Ocular hypotensive FP prostaglandin (PG) analogs: PG receptor subtype binding affinities and selectivities, and agonist potencies at FP and other PG receptors in cultured cells. J Ocul Pharmacol Ther. 2003;19:501–515.
[CrossRef] [PubMed]MaxeyKM, JohnsonJL, LaBrecqueJ. The hydrolysis of bimatoprost in corneal tissue generates a potent prostanoid FP receptor agonist. Surv Ophthalmol. 2002;47(suppl 1)S34–S40.
[CrossRef] [PubMed]DaviesSS, JuWK, NeufeldAH, AbranD, ChemtobS, RobertsLJ, II. Hydrolysis of bimatoprost (Lumigan) to its free acid by ocular tissue in vitro. J Ocul Pharmacol Ther. 2003;19:45–54.
[CrossRef] [PubMed]CamrasCB, TorisCB, SjoquistB, et al. Detection of the free acid of bimatoprost in aqueous humor samples from human eyes treated with bimatoprost before cataract surgery. Ophthalmology. 2004;111:2193–2198.
[CrossRef] [PubMed]SharifNA, KellyCR, CriderJY. Agonist activity of bimatoprost, travoprost, latanoprost, unoprostone isopropyl ester and other prostaglandin analogs at the cloned human ciliary body FP prostaglandin receptor. J Ocul Pharmacol Ther. 2002;18:313–324.
[CrossRef] [PubMed]SharifNA, KellyCR, WilliamsGW. Bimatoprost (Lumigan(R)) is an agonist at the cloned human ocular FP prostaglandin receptor: real-time FLIPR-based intracellular Ca(2+) mobilization studies. Prostaglandins Leukot Essent Fatty Acids. 2003;68:27–33.
[CrossRef] [PubMed]SharifNA, WilliamsGW, KellyCR. Bimatoprost and its free acid are prostaglandin FP receptor agonists. Eur J Pharmacol. 2001;432:211–213.
[CrossRef] [PubMed]