Estrogen’s and Progesterone’s Impact on Gene Expression in the Mouse Lacrimal Gland

Abstract

purpose. The hypothesis tested in the study was that the effect of estrogen and progesterone on the lacrimal gland is mediated through specific receptors and that hormonal effects involve the regulation of gene expression and protein synthesis.

methods. Lacrimal glands were collected from young adult, ovariectomized mice, that were treated with 17β-estradiol, progesterone, 17β-estradiol plus progesterone or vehicle for 2 weeks. Glands were pooled according to treatment, processed for the isolation of RNA, and evaluated for differentially expressed mRNAs by using gene microarrays. Bioarray data were analyzed with sophisticated bioinformatics and statistical programs. The expression of selected genes was verified by using gene chips and quantitative real-time PCR methods.

results. The results demonstrate that 17β-estradiol, progesterone, or both hormones together significantly influences the expression of hundreds of genes in the mouse lacrimal gland. Sex steroid treatment led to numerous alterations in gene activities related to transcriptional control, cell growth and/or maintenance, cell communication, signal transduction, enzyme catalysis, immune expression, and the binding and metabolism of nucleic acids and proteins. A number of the 17β-estradiol, progesterone or 17β-estradiol plus progesterone effects on gene expression were similar, but most were unique to each treatment. Of particular interest was the finding that these hormones seem to contribute little to the known sex-related differences in gene expression of the lacrimal gland.

conclusions. These results support the hypothesis that estrogen’s and progesterone’s action on the lacrimal gland involves the regulation of numerous genes. However, these hormone effects do not appear to represent a major factor underlying the sexual dimorphism of gene expression in lacrimal tissue.

Investigators have proposed that estrogens may play an important role in the anatomy, physiology, and sexual dimorphism of the lacrimal gland. ^{1 2 3 4} . In support of this proposition are reports that ovariectomy or antiestrogen treatment lead to acinar cell disruption and necrosis, cellular vacuolization, DNA degradation, inflammation, glandular tissue loss, and dry eye (Jacobs M, et al. IOVS 1986;27:ARVO Abstract page 25; Azzarolo AM, et al. IOVS 1994;35:ARVO Abstract 2500; Huang ZM, et al. IOVS 1995;36:ARVO Abstract 2979; Coles N, et al. IOVS 1988;29:ARVO Abstract page 48). ^{1 2 4 5 6 7 8} Conversely, estrogen administration reportedly corrects these changes in lacrimal gland structure and function, and promotes lacrimal secretion (Jacobs M, et al. IOVS 1986;27:ARVO Abstract page 25; Azzarolo AM, et al. IOVS 1993;34:ARVO Abstract 3773). ^{1 2 7 9 10 11 12 13}  

However, other researchers have found that neither estrogen insufficiency nor estrogen treatment has any effect on the weight, morphology, total protein content, specific enzyme activity, lymphocyte accumulation, or secretion of the lacrimal gland (Cripps MM, et al. IOVS 1986;27:ARVO Abstract page 25). ^{9 14 15 16 17 18 19 20 21} Yet, other investigators have reported that estrogens have a negative influence on lacrimal tissue and cause glandular regression, suppression of protein production, androgen antagonism, and reduced tear secretion (Azzarolo AM, et al. IOVS 1993;34:ARVO Abstract 3773). ^{5 9 15 22 23 24}  

Some of these conflicting findings regarding estrogens may be explained by differences in experimental design, hormone dosage, or animal model. It is also possible that these disparate results may be due to variations in the relative levels of progesterone, a hormone that may significantly modify estrogen effects. However, an overriding difficulty with clarification is that the nature and extent of estrogen or progestin action on the lacrimal gland is not known. In fact, no consensus exists concerning the cellular targets for, or the cellular processes that may be controlled by, estrogens or progestins in lacrimal tissue. Indeed, it has not yet even been established whether these hormones have functional receptors in the lacrimal gland. 

We hypothesize that estrogen and progesterone action on the lacrimal gland is mediated through specific receptors and that hormonal effects involve the regulation of gene expression and protein synthesis. To begin to test this hypothesis, we examined in the present study whether 17β-estradiol, progesterone, and both hormones in combination influence gene expression in the female mouse lacrimal gland. 

Materials and Methods

Animals and Hormone Treatment

Young adult and age-matched BALB/c mice, that were ovariectomized at 8 weeks of age, were obtained from Taconic Laboratories (Germantown, NY). Animals were housed in constant temperature rooms (70–72°F) with fixed light–dark intervals of 12 hours. Ten days after surgery, ovariectomized mice were treated with subcutaneous pellet implants containing placebo (cholesterol, methylcellulose, lactose), 17β-estradiol (0.5 mg), progesterone (10 mg), or combined 17β-estradiol plus progesterone. These pellets were purchased from Innovative Research of America (Sarasota, FL) and were designed for the continuous release of vehicle or physiological amounts of hormone throughout the 14-day experimental period. When indicated, mice were killed by CO₂ inhalation and exorbital lacrimal glands were removed (n = 7 to 20 mice per condition per experiment), pooled according to group (n = 14 to 40 glands per sample) and processed for molecular biological procedures. All experiments with mice were approved by the Institutional Animal Care and Use Committee of The Schepens Eye Research Institute and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 

Molecular Biological Procedures

To analyze the effects of 17β-estradiol and progesterone on lacrimal gland gene expression, total RNA was extracted from tissues by using TRIzol reagent (Invitrogen Corp., Carlsbad, CA). When indicated, samples were also exposed to RNase-free DNase (Invitrogen), examined spectrophotometrically at 260 nm to determine concentration and evaluated on 6.7% formaldehyde/1.3% agarose (Invitrogen-Gibco, Grand Island, NY) gels to verify RNA integrity. The RNA samples were then processed by using several different methods. 

The principle method to examine differential gene expression involved the use of CodeLink Uniset Mouse I Bioarrays (∼10,000 genes; GE Healthcare, Piscataway, NJ). Toward this end, glandular RNA samples were further purified with RNAqueous spin columns (Ambion, Austin, TX), and the integrity of these preparations was assessed with a RNA 6000 Nano LabChip with an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). The RNA samples were then processed for CodeLink Bioarray hybridization, as previously described. ²⁵ In brief, cDNA was synthesized from RNA (2 μg) with a CodeLink Expression Assay Reagent Kit (Amersham, Piscataway, NJ) and purified with a QIAquick purification kit (Qiagen, Valencia, CA). After sample drying, cRNA was made with a CodeLink Expression Assay Reagent Kit (Amersham), recovered with an RNeasy kit (Qiagen) and quantified with an UV spectrophotometer. Fragmented, biotin-labeled cRNA was then incubated and agitated (300 rpm shaker) on a CodeLink Bioarray at 37°C for 18 hours. The Bioarray was then washed, exposed to streptavidin-Alexa 647, and scanned by using ScanArray Express software and a ScanArray Express HT scanner (Packard BioScience, Meriden, CT) with the laser set at 635 nm, laser power at 100%, and photomultiplier tube voltage at 60%. Scanned image files were evaluated by utilizing CodeLink image and data analysis software (Amersham), which produced both raw and normalized hybridization signal intensities for each array spot. The spot intensities (∼10,000) on the microarray image were standardized to a median of 1. Normalized data, with signal intensities exceeding 0.75, were analyzed with GeneSifter.Net software (VizX Labs LLC, Seattle, WA, vizxlabs.com). This comprehensive program also generated gene ontology and z-score reports. The ontologies were organized according to the guidelines of the Gene Ontology Consortium (http://www.geneontology.org/GO.doc.html), ²⁶ and included biological processes, molecular functions, and cellular components. Data were evaluated with and without log transformation. Statistical analysis of individual gene expression data was performed with Student’s t-test (two-tailed, unpaired). 

The data from the individual Bioarrays (n = 6) are available for download through the National Center for Biotechnology Information’s Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) via series accession number GSE1582. The data will also be accessible for analyses through GeneSifter (http://genesifter.net/datacenter/). 

Differentially expressed mRNAs were also analyzed by utilizing GEM 1 (>8,000 genes) and GEM 2 (>9,500 genes) gene chips (Incyte Genomics, Inc., St. Louis, MO). The GEM chips and CodeLink arrays have over 4,700 sequences in common. Following additional purification with RNAqueous spin columns, poly(A) mRNA was extracted from lacrimal gland RNA samples (400 μg) by using the MicroPoly(A)Pure mRNA Isolation Kit (Ambion, Inc., Austin, TX). The mRNA concentration was determined with a RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR), according to Incyte’s procedures. After designating mRNA samples (750 ng) for use with either cy3 or cy5 probes, preparations were suspended in TE buffer, placed in siliconized RNase-Free Microfuge Tubes (Ambion) and shipped on dry ice to Incyte for hybridization. Microarray data were sent electronically to the Harvard Center for Genomic Research (Cambridge, MA). Results were downloaded into the Resolver Gene Expression Data Analysis System, version 2.0 (Rosetta Inpharmatics, Kirkland, WA), then normalized and evaluated as previously reported. ²⁵  

Real Time PCR Procedures

Quantitative real-time PCR (qPCR) was used to verify the differential expression of selected genes. Sense and antisense primers were designed by using Primer Express Software, version 1.5a (Applied Biosystems, Inc., Foster City, CA; Table 1 ). The qPCR reactions were carried out according to the manufacturer’s protocol, by using aliquots of lacrimal gland cDNA (0.01–0.3 μL cDNA), optimal primer concentrations, and Applied Biosystems’ SYBR Green PCR Master Mix, MicroAmp Optical 96-Well Reaction Plates, ABI PRISM Optical Adhesive Covers and the GeneAmp 7900 HT Sequence Detection System. Gene expression was determined by employing the Relative Standard Curve Method, as described in User Bulletin #2 ABI Prism 7700 Sequence Detection System (Applied Biosystems; updated version 10/01), and standardizing levels to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Dissociation curves were monitored to confirm the absence of secondary PCR products. 

Results

Estrogen and Progesterone Regulation of Gene Expression in the Lacrimal Gland

To examine the influence of “female” sex steroids on gene expression in the lacrimal gland, tissues were obtained from ovariectomized mice (n = 7 per treatment group) that had been treated for 2 weeks with 17β-estradiol, progesterone, or both hormones in combination. Glands were processed for analysis by using CodeLink Uniset Mouse I Bioarrays and GeneSifter software. 

Examination of non- and log-transformed data from three different experiments demonstrated that 17β-estradiol and progesterone exert a very significant impact on gene activity in the lacrimal gland. As shown in Table 2 , these hormones, whether administered alone or together, significantly altered the expression of hundreds of genes. Those genes that were upregulated (e.g., asialoglycoprotein receptor 1 and NF-κ-B-repressing factor) and downregulated (e.g., lymphocyte antigen 6 complex, locus F, and dopamine receptor 2) to the greatest extent (i.e., in terms of ratios) after hormone treatment are listed in Tables 3 4 and 5 . 

Administration of these various hormones had a considerable influence on biological processes, molecular functions, and cellular components in the lacrimal gland. For example, 17β-estradiol, progesterone, and the combined sex steroid treatment all significantly affected the expression of numerous genes (i.e., ≥34 genes per category) related to nucleic acid and protein metabolism, cell growth and/or maintenance, cell communication, signal transduction, transcriptional regulation, and development. In addition, these treatments all significantly influenced the expression of many genes (i.e., ≥26 genes per category) associated with nucleic acid, protein, adenosine triphosphate (ATP) and metal ion binding, as well as assorted catalytic, hydrolase, receptor, and transferase activities (data not shown). These hormones also affected a diverse array of immune-related genes (Table 6) . 

Of particular interest was the impact of sex steroids on specific gene ontologies. As shown by z-score analyses, the most significant 17β-estradiol actions were directed toward the stimulation of signaling pathways, ion transport, enzyme activities, and membrane aspects, whereas genes suppressed by estrogen were related to cell organization and biogenesis, cytokine activity, receptor binding, mitochondria, and intracellular components (Table 7) . Progesterone administration led to a significant increase in the expression of genes linked to signal transduction and cell communication and a decrease in those associated with cell growth and/or maintenance, metabolism, and ion binding (Table 8) . In contrast to these findings, combined 17β-estradiol and progesterone exposure enhanced the expression of cell death genes and attenuated those related to receptor binding, signal transduction, protein transport, cytokine activity, and development (Table 9) . 

In these studies the different hormone treatments had analogous or opposite effects on the expression of a number of genes (Table 10) . There were two genes that were significantly (P < 0.05) upregulated by 17β-estradiol or progesterone, as well as 17β-estradiol plus progesterone. These genes encode serine/threonine kinase 22B and discoidin domain receptor family, member 2, both of which are involved in phosphate metabolism. Conversely, there were 14 genes that were significantly (P < 0.05) downregulated by all three forms of hormone treatment. These genes (and their ontologies) included cell division cycle 45 homologue (S phase of mitotic cycle), chordin (neurogenesis), lysosomal acid lipase 1 (lipid metabolism), nidogen 1 (cell-matrix adhesion), parathyroid hormone receptor 1 (signal transduction), forkhead box P3 (Foxp3; regulation of transcription), high-mobility group box 2-like 1 (nucleic acid binding), and calpain 9 (protein metabolism). 

To confirm in part the CodeLink Bioarray data, additional lacrimal gland mRNA samples (n = 20 mice per group per experiment) were processed for the GEM 1 and 2 gene chip analyses. This approach identified 38 genes on GEM chips that were either up- or downregulated by hormone treatment, and that met our analytical criteria (i.e., GEM signal intensity ≥500; expression ratio ≥1.8 or ≤ −1.8). However, only two of these genes were common to both the GEM and CodeLink platforms (i.e., pancreatic lipase–related protein 1 and asialoglycoprotein receptor 1). Therefore, to verify further the CodeLink results, selected genes were analyzed by qPCR. As shown in Table 11 , this method confirmed the effect of hormones on a number of different genes. 

Role of 17β-Estradiol and Progesterone in the Sex-Related Differences in Gene Expression of the Lacrimal Gland

We have recently found that significant, sex-related differences exist in the expression of more than 500 genes in the mouse lacrimal gland. ²⁵ To evaluate whether female sex steroids may contribute to these differences, we determined whether genes expressed to a greater extent in female lacrimal tissues, compared with those of males, are also upregulated by treatment with 17β-estradiol, progesterone or both hormones together. Moreover, we assessed whether genes expressed to a lower degree in female lacrimal glands, relative to those of males, are downregulated by female sex steroid administration. The ages of the BALB/c mice (n = 5 to 7 mice/sex/experiment) used in the analysis of sex-related differences (n = 3 experiments) in the lacrimal gland were similar to those in the present studies. ²⁵ Furthermore, all gene expression data were generated from CodeLink Bioarrays and analyzed with GeneSifter software. 

As demonstrated in Table 12 , 17β-estradiol, progesterone, and combined hormone exposure seemed to account for a minority of the sex-related differences in gene expression of the lacrimal gland. Evaluation of nontransformed data indicated that estrogen, with or without progesterone, appeared to contribute to between 6.6% and 26.8% of the gene activity differences between male and female lacrimal tissues (Table 12) . In contrast, progesterone alone had relatively little influence (i.e., <4%) on these sex differences. Examples of genes affected similarly by sex and sex steroid administration are shown in Table 13 . 

Discussion

This investigation demonstrates that the administration of 17β-estradiol, progesterone, or both hormones significantly influenced the expression of hundreds of genes in the mouse lacrimal gland. Sex steroid treatment led to numerous alterations in gene activities related to transcriptional control, cell growth and/or maintenance, cell communication, signal transduction, enzyme catalysis, and the binding and metabolism of nucleic acids and proteins. A number of the 17β-estradiol, progesterone, or 17β-estradiol plus progesterone effects on gene expression were similar, but most were unique to each treatment. These results support our hypothesis that the effect of estrogen and progesterone on the lacrimal gland involves the regulation of gene expression. 

Some of the most significant effects of 17β-estradiol were directed toward the control of genes linked to signaling pathways, transport, enzymatic activities, and cellular organization. For example, 17β-estradiol enhanced the mRNA levels of (1) mitogen-activated protein kinase kinase kinase 4, which activates the CSBP2, P38, and JNK MAPK pathways ²⁸ ; (2) serine (or cysteine) proteinase inhibitor, clade A, member 6, which is another name for corticosteroid-binding globulin or transcortin and is the major transport protein for glucocorticoids and progestins ²⁸ ; (3) aldo-keto reductase family 1, member C18, which is also called 20-α- hydroxysteroid dehydrogenase, and catalyzes the conversion of progesterone into the inactive 20-α-dihydroprogesterone ²⁹ ; and (4) pancreatic lipase–related protein 1, which belongs to an enzymatic superfamily of lipases, esterases, and thioesterases. ³⁰ In contrast, 17β-estradiol decreased the content of numerous mRNAs, such as that of dynamin binding protein, which plays a role in membrane trafficking, ²⁸ and of metaxin 1, which is involved in the transport of proteins into mitochondria. ²⁸  

Progesterone administration induced a significant increase in the expression of genes involved in signal transduction and cell communication and a significant decrease in those associated with metabolism and cell growth and/or maintenance. As examples, progesterone enhanced the activity of genes encoding mitogen-activated protein kinase kinase kinase 4, as well as for (1) tachykinin receptor 2, which binds substance K (neurokinin A) and activates a phosphatidylinositol-calcium second messenger system ²⁸ ; (2) solute carrier family 2 (facilitated glucose transporter), member 9, which helps to maintain glucose homeostasis ²⁸ ; and (3) tumor necrosis factor receptor superfamily, member 19, a protein capable of inducing apoptosis by a caspase-independent mechanism (online). Conversely, progesterone downregulated the expression of genes encoding such proteins as (1) 3-hydroxy-3-methylglutaryl-coenzyme A reductase, which is the rate-limiting enzyme for cholesterol synthesis ²⁸ ; (2) dopamine receptor 2, a G protein-coupled receptor that inhibits adenylyl cyclase ²⁸ ; (3) solute carrier family 16 (monocarboxylic acid transporters), member 2, which catalyzes the rapid transport of many monocarboxylates across the plasma membrane ²⁸ ; (4) cyclin K, which may regulate transcription through the phosphorylation of RNA polymerase II ²⁸ ; and (5) RAS p21 protein activator 3, a GTPase-activating protein involved in the control of cell proliferation and differentiation. ²⁸  

Combined 17β-estradiol and progesterone exposure elicited many changes in gene expression that were analogous to those of each hormone individually, as well as novel to the combination alone. These sex steroids together altered the activity of numerous cell death, signal transduction, receptor, endocrine, enzymatic, and growth factor genes. Those increased included genes for vascular endothelial growth factor A, discoidin domain receptor 2 (a tyrosine kinase receptor for fibrillar collagen that mediates fibroblast migration and proliferation), ²⁸ and the adenosine A2b receptor. Those decreased included genes for insulin-like growth factor I, fibroblast growth factor-10 (may be active in wound healing), ²⁸ parathyroid hormone receptor, calpain 9 (a calcium-regulated non-lysosomal thiol-protease), ²⁸ and nidogen 1 (participates in the assembly of basement membranes). ³¹  

Of particular interest was the influence of 17β-estradiol, with or without progesterone, on the expression of many immune-related genes. Thus, for example, hormone treatment downregulated the expression of genes linked to histocompatibility 2, O region alpha locus (i.e., MHC class II, a chain), ²⁸ CDw131 antigen (a high-affinity receptor for IL-3, IL-5 and granulocyte-macrophage colony-stimulating factor), ²⁸ IL-3 (stimulates development of stem cells, granulocytes, macrophages, mast cells, and eosinophils), ²⁸ IL-2 receptor β chain (receptor for IL-2), ²⁸ IL-12 α and β chains (growth factors for activated T and NK cells), ²⁸ small inducible cytokine A28 (chemotactic for resting CD4, CD8 T-cells and eosinophils), ²⁸ cell surface glycoprotein CD200 (OX2) receptor (involved in regulation of macrophage function), ³² and toll-like receptor 9 (participates in the innate immune response to microbial agents). ²⁸ Estrogen also enhanced the mRNA levels of suppressor of cytokine signaling 3, which inhibits the signaling of specific proinflammatory cytokines. ^{33 34 35 36} It is possible that some of these hormonal effects could contribute to an anti-inflammatory action of 17β-estradiol in the lacrimal gland. Indeed, such an immunologic role for estrogen in lacrimal tissue has been proposed by several investigators. ³⁷  

However, other effects of 17β-estradiol, again with or without progesterone, do not appear to be consistent with such a proposition. For instance, hormone administration upregulated the expression of lacrimal gland genes related to transcription factor 7 (involved in T cell differentiation), ²⁸ T-cell surface antigen CD2 (promotes T-cell adhesion to other cell types) ²⁸ and small inducible cytokine B15 (chemotactic for neutrophils). ²⁸ Sex steroid treatment also reduced the gene expression for (1) leukocyte immunoglobulin-like receptor (subfamily B member 4), a receptor for class I MHC antigens, which is involved in the downregulation of the immune response and the development of tolerance, ²⁸ and (2) Foxp3, which acts as a rheostat of the immune response. ³⁸ A reduction in Foxp3 function, in turn, may attenuate the activity of regulatory CD4⁺ CD25⁺ T cells and promote both lymphoproliferation ³⁸ and autoimmune disease. ³⁹ Of interest, estrogen has opposite effects on Foxp3 expression elsewhere in the body. ^{40 41}  

Another observation is that 17β-estradiol exposure significantly increased the mRNA levels of asialoglycoprotein receptor 1. This receptor has been linked to the development of exocrine gland inflammation and keratoconjunctivitis sicca. ^{42 43 44} Collectively, these latter findings suggest that estrogen may promote inflammation and autoimmune disease in the lacrimal gland. If so, such an action may explain why 17β-estradiol administration to a female mouse model of Sjögren’s syndrome caused a significant increase in the area of lymphoid infiltrates in lacrimal tissue. ²² Moreover, a proinflammatory effect would be consistent with estrogen’s known ability to enhance the polyclonal B cell activation, autoantibody formation, and tissue abnormalities encountered in this autoimmune disorder. ^{22 45 46}  

The mechanism by which 17β-estradiol and progesterone act on the lacrimal gland may involve classic receptors. Estrogen and progesterone receptor mRNA have been identified in lacrimal glands of rats, rabbits, and humans, ^{47 48} and putative estrogen-binding sites have been detected in a pooled cytosol preparation from rabbit lacrimal glands. ²⁴ However, there is no evidence indicating that estrogen or progesterone receptor mRNAs are translated into saturable, high-affinity, specific, and functional proteins. ^{20 49} It should be noted that low-affinity receptors for estrogens appear to exist in rat lacrimal tissue, but these sites may actually represent a low-affinity association of estrogens to androgen receptors. ⁴⁹ A further possibility is that estrogen and progesterone may act on the lacrimal gland indirectly through the control of other hormones (e.g., from the pituitary), or through nonclassic pathways (e.g., signaling through membrane receptors). ⁵⁰  

Our study indicated that 17β-estradiol and progesterone, whether alone or together, seem to contribute little to the known sex-related differences in gene expression of the lacrimal gland. ²⁵ Estrogen (15%) and progesterone (2%) influenced only a small percentage of those lacrimal tissue genes that have been reported to vary significantly between males and females. ²⁵ In contrast, androgens are involved in more than 70% of these variations ⁵¹ and may therefore represent the major factor underlying the sexual dimorphism of the lacrimal gland. 

In summary, our findings demonstrate that 17β-estradiol and progesterone exert a considerable impact on gene expression of the lacrimal gland. Our ongoing research is designed to determine the functional significance of these sex steroid actions. 

 Supported by National Eye Institute Grants EY05612, K16, and EY12523, Allergan, Advanced Medical Optics, Bausch & Lomb, the German Research Society (Deutsche Forschungsgemeinschaft) Grants SCHI 562/1-1 and 1-2, and the Japanese Eye Bank Association.

 Submitted for publication July 29, 2005; revised September 13 and October 1, 2005; accepted November 28, 2005.

 Disclosure: T. Suzuki, None; F. Schirra, None; S.M. Richards, None; N.S. Treister, None; M.J. Lombardi, None; P. Rowley, None; R.V. Jensen, None; D.A. Sullivan, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes

Accession No.	mRNA	Orientation	Nucleotide Sequence (5′ → 3′)
BC022106	Asialoglycoprotein receptor 1	Sense	CACATCCCAAAATTCCCAACTC
		Antisense	CCTGGTCCTCAGTGCTCACA
NM_054042	CD248 antigen, endosialin	Sense	AGATTTGGCTTCATTTGGTGAACT
		Antisense	ACGGGAACACTGTCGAAAGCT
M32599	Glyceraldehyde-3-phosphate dehydrogenase	Sense	CATGGCCTTCCGTGTTCCTA
		Antisense	CTGGTCCTCAGTGTAGCCCAA
NM_010917	Nidogen 1	Sense	TGAGCTTCTATGATCGTACGGACAT
		Antisense	GTCCAAGTCAGCCAGGAAAGG
AF061274	Pancreatic lipase–related protein 1	Sense	CCCAGGTGGCTCAGATGATT
		Antisense	AAGACCTGGAGTCCGACTTCCT
NM_011978	Solute carrier family 27 (fatty acid transporter), member 2	Sense	AGAAAAGTTGCAAGGTATGAGCTGAT
		Antisense	TAATGGTGTGAGCTGTGTGATTTG

 The accession number represents the sequence identity of the gene fragment used on the GEM or CodeLink array. This sequence, which appears in the nucleotide database of the National Center for Biotechnology Information, served as the basis for primer design. The primers were used to determine mRNA levels with real-time PCR by the relative standard curve method.

Table 2.

 

Influence of 17β-Estradiol and/or Progesterone on Gene Expression in the Lacrimal Gland

Treatment	Genes ↑	Genes ↓	Total
17β-Estradiol
No transformation	176	211	387
Log transformation	175	188	363
Total	203	233	436
Progesterone
No transformation	102	138	240
Log transformation	93	137	230
Total	114	158	272
17β-Estradiol+Progesterone
No transformation	136	210	346
Log transformation	144	198	342
Total	160	232	392

 Data were analyzed with and without log transformation. The number of common and nonoverlapping genes between analytical categories was determined, and then the total numbers were calculated. The expression of listed genes was significantly (P < 0.05) up (↑)- or down (↓)-regulated by hormone treatment.

Table 3.

 

17β-Estradiol Effect on Gene Expression Ratios in the Mouse Lacrimal Gland

Accession No.	Gene	Ratio	P	Ontology
Estradiol>Placebo
NM_018781	Early growth response 3	5.50	0.0137	Transcription
NM_011105	Polycystin	4.23	0.0014	Signal transduction
NM_008456	Kallikrein 5	4.05	0.0206	Protein catabolism
NM_018874	Pancreatic lipase–related protein 1	3.40	0.0036	Metabolism
AB059565	Aldo-keto reductase family 1, member C18	3.27	0.0000	Catalytic activity
NM_054080	Aldo-keto reductase family 1, member C20	3.08	0.0140	Steroid metabolism
NM_009714	Asialoglycoprotein receptor 1	3.04	0.0108	Vesicle-mediated transport
NM_010349	Glutamate receptor, ionotropic, kainate 2 (β2)	2.78	0.0055	Transmission of nerve impulse
NM_007618	Serine (or cysteine) proteinase inhibitor, clade A, member 6	2.76	0.0315	Transport
Placebo>Estradiol
NM_031255	Radial spokehead-like 1	15.59	0.0034	Cell homeostasis
NM_008530	Lymphocyte antigen 6 complex, locus F	11.42	0.0248	Response to biotic stimulus
NM_020515	Olfactory receptor 140	9.85	0.0272	Signal transduction
NM_011978	Solute carrier family 27 (fatty acid transporter), member 2	9.13	0.0045	Carboxylic acid metabolism
AK010367	Dynamin-binding protein	7.43	0.0150	Binding
NM_013604	Metaxin 1	7.33	0.0129	Transport
NM_007975	Coagulation factor II (thrombin) receptor-like 3	6.26	0.0008	Signal transduction
NM_019782	Leprecan 1	6.19	0.0061	Cell growth and/or maintenance
NM_009469	Unc-51 like kinase 1 (C. elegans)	4.56	0.0253	Small GTPase mediated signal transduction

 Relative ratios were calculated by comparing the degree of gene expression in lacrimal glands from placebo- and 17β-estradiol (E2)-treated ovariectomized mice. Genes listed had a signal intensity of >0.75 in at least one group, a comparative between-gland P < 0.05, and a known identity.

Table 4.

 

Progesterone Influence on Gene Expression Ratios in the Mouse Lacrimal Gland

Accession No.	Gene	Ratio	P	Ontology
Progesterone>Placebo
BE305606	Solute carrier family 2 (facilitated glucose transporter), member 9	3.19	0.0392	Carbohydrate transport
AK020455	NF-kappa-B–repressing factor*	2.73	0.0270	Transcription
NM_007427	Agouti-related protein	2.40	0.0273	Signal transduction
NM_009436	Serine/threonine kinase 22B	2.29	0.0403	Metabolism
NM_013869	Tumor necrosis factor receptor superfamily, member 19	2.27	0.0251	Signal transducer activity
NM_009184	PTK6 protein tyrosine kinase 6	2.19	0.0044	Protein metabolism
NM_011706	Transient receptor potential cation channel, subfamily V, member 2	2.19	0.0407	Transcription
AF197159	Cubilin (intrinsic factor-cobalamin receptor)	2.13	0.0408	tRNA aminoacylation
NM_007825	Cytochrome P450, family 7, subfamily b, polypeptide 1	2.06	0.0413	Sterol metabolism
Placebo>Progesterone
NM_009197	Solute carrier family 16, member 2 (monocarboxylic acid transporter)	3.19	0.0118	Transport
NM_010077	Dopamine receptor 2	2.89	0.0110	Signal transduction
NM_026853	Ankyrin repeat and SOCS box-containing protein 11	2.29	0.0385	Transcription
AF060517	Cyclin K	2.24	0.0433	Transcription
NM_009765	Breast cancer 2	2.16	0.0281	Response to stress
NM_010111	Ephrin B2	2.13	0.0483	Morphogenesis
M62766	3-hydroxy-3-methylglutaryl-coenzyme A reductase	2.08	0.0121	Sterol metabolism
NM_021559	Zinc finger protein 191	2.07	0.0070	Transcription
NM_009025	RAS p21 protein activator 3	2.01	0.0261	Signal transduction
AB060274	Endothelial cell growth factor 1	1.99	0.0096	Morphogenesis

 Relative ratios were determined by comparing the degree of gene expression in lacrimal glands from placebo- and progesterone-treated ovariectomized mice. Genes listed had a signal intensity of >0.75 in at least one group, a comparative between-gland P < 0.05 and a known identity.

*  Also called RIKEN cDNA 9430034D17.

Table 5.

 

Impact of 17β-Estradiol and Progesterone on Gene Expression Ratios in the Mouse Lacrimal Gland

Accession No.	Gene	Ratio	P	Ontology
Estradiol+Progesterone>Placebo
NM_009331	Transcription factor 7, T-cell–specific	8.23	0.0009	Transcription
NM_025371	Aminoacylase 1	7.03	0.0009	Amino acid metabolism
NM_033037	Cysteine dioxygenase 1, cytosolic	5.31	0.0001	Amino acid metabolism
AK002693	Monoacylglycerol O-acyltransferase 1	4.31	0.0088	Catalytic activity
NM_011046	Furin (paired basic amino acid–cleaving enzyme)	3.18	0.0135	Protein catabolism
NM_054080	Aldo-keto reductase family 1, member C20	3.09	0.0073	Steroid metabolism
NM_018874	Pancreatic lipase–related protein 1	3.00	0.0105	Metabolism
NM_008109	Growth differentiation factor 5	2.76	0.0311	Development
NM_007427	Agouti-related protein	2.61	0.0150	Signal transduction
NM_009714	Asialoglycoprotein receptor 1	2.59	0.0286	Vesicle-mediated transport
NM_011105	Polycystin	2.56	0.0257	Signal transduction
AB059565	Aldo-keto reductase family 1, member C18	2.53	0.0289	Catalytic activity
Placebo>Estradiol+progesterone
NM_031255	Radial spokehead-like 1	18.38	0.0027	Cell homeostasis
NM_008530	Lymphocyte antigen 6 complex, locus F	14.81	0.0147	Response to biotic stimulus
NM_020515	Olfactory receptor 140	8.60	0.0327	Signal transduction
NM_013604	Metaxin 1	7.65	0.0093	Transport
AK010367	Dynamin binding protein	7.54	0.0050	Binding
NM_009469	Unc-51-like kinase 1 (C. elegans)	7.53	0.0010	Small GTPase mediated signal transduction
NM_020277	Transient receptor potential cation channel, subfamily M, member 5	7.28	0.0313	Cation transport
NM_007975	Coagulation factor II (thrombin) receptor-like 3	7.14	0.0005	Signal transduction
NM_019782	Leprecan 1	6.08	0.0016	Cell growth and/or maintenance
NM_025973	Progastricsin (pepsinogen C)	5.64	0.0123	Protein catabolism
NM_018763	Carbohydrate sulfotransferase 2	5.64	0.0038	Amino sugar metabolism

 Relative ratios were calculated by comparing the degree of gene expression in lacrimal glands from placebo- and 17β-estradiol plus progesterone-treated ovariectomized mice. Genes listed had a signal intensity of >0.75 in at least one group, a comparative between-gland P < 0.05 and a known identity.

Table 6.

 

Sex Steroid Regulation of Various Immune-Related Genes in the Lacrimal Gland

Upregulation	Downregulation
17β-Estradiol	17β-Estradiol
CD 81 antigen	B-cell receptor-associated protein 29
CD14 antigen	C1q and tumor necrosis factor related protein 1
CD151 antigen	CD86 antigen
CD163 antigen	Chemokine (C-C motif) ligand 12
CD5 antigen	Chemokine (C-C motif) ligand 28
Chemokine (C-X-C motif) ligand 15	Chemokine (C-C motif) receptor 6
Complement component 4–binding protein	Colony-stimulating factor 2 receptor, beta 1, Low-affinity (granulocyte-macrophage)
Fc receptor, IgG, low affinity IIb
Histocompatibility 2, complement component factor B	Duffy blood group
LPS-induced TN factor	Forkhead box P3
Myxovirus (influenza virus) resistance 1	Histocompatibility 2, O region alpha locus
Suppressor of cytokine signaling 2	Interferon regulatory factor 5
Suppressor of cytokine signaling 3	Interleukin 12a
Tumor necrosis factor (ligand) superfamily, member 13b	Interleukin 2 receptor, beta chain
	Interleukin 3
	Lymphocyte antigen 6 complex, locus F
	Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
	Toll-like receptor 9
	Tumor necrosis factor (ligand) superfamily, member 9
Progesterone	Progesterone
CD2 antigen	CD28 antigen
Chemokine (C-C) receptor 2	CD3 antigen, zeta polypeptide
Chemokine (C-X-C motif) receptor 6	Chemokine (C-C motif) receptor 6
Cytokine receptor-like factor 1	Forkhead box P3
Immunoglobulin (CD79A) binding protein 1b	Interleukin 12b
Integrin alpha 4	Leukocyte immunoglobulin-like receptor, subfamily B, member 4
Lymphocyte antigen 6 complex, locus I
TNF receptor-associated factor 6
Tumor necrosis factor receptor superfamily, member 8
17β-Estradiol+Progesterone	17β-Estradiol+Progesterone
Adipsin	Chemokine (C-C motif) ligand 28
CD2 antigen	Chemokine (C-C motif) receptor 1
Chemokine (C-X-C motif) ligand 15	Colony-stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage)
Complement component 1, q subcomponent, gamma polypeptide
	Forkhead box P3
Eosinophil-associated, ribonuclease A family, member 1	Histocompat ibility 2, M region locus 3
Interferon-induced transmembrane protein 7	Histocompatibility 2, O region alpha locus
LPS-induced TN factor	Interferon regulatory factor 5
Transcription factor 7, T-cell specific	Interleukin 12a
	Interleukin 12b
	Interleukin 24
	Interleukin 3
	Lymphocyte antigen 6 complex, locus F
	Lymphocyte antigen 78
	Neutrophil cytosolic factor 4
	Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
	Toll-like receptor 9

 The selected genes were significantly (P < 0.05) up- or downregulated by sex steroid treatment.

Table 7.

 

Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol-Treated Mice

Ontology	Gene List	Estradiol Genes ↑	Placebo Genes ↑	Array Genes	Estradiol z-score	Placebo z-score
Biological Process
Enzyme-linked receptor protein signaling pathway	9	6	3	120	2.47	0.37
Pattern specification	8	5	3	102	2.2	0.66
Ion transport	18	13	5	384	2.13	−1.04
Cell organization and biogenesis	10	3	7	471	−2.11	−0.87
Embryonic development (sensu Animalia)	7	3	4	60	1.74	2.56
Molecular Function
Chymotrypsin activity	7	5	2	70	3.21	0.46
Protein-tyrosine kinase activity	14	11	3	235	3.16	−0.87
Alpha-type channel activity	12	10	2	206	3.13	−1.13
Trypsin activity	7	5	2	74	3.06	0.38
Ion channel activity	11	9	2	182	3.03	−0.94
Channel/pore class transporter activity	12	10	2	215	2.98	−1.19
Serine-type endopeptidase activity	8	6	2	103	2.92	−0.1
Cation channel activity	8	7	1	132	2.87	−1.07
Serine-type peptidase activity	8	6	2	109	2.76	−0.18
Transporter activity	37	24	13	787	2.47	−0.88
Transmembrane receptor activity	26	15	11	444	2.33	0.61
Protein kinase activity	18	12	6	343	2.2	−0.43
Receptor activity	43	24	19	832	2.18	0.45
Kinase activity	29	16	13	508	2.12	0.79
Phosphotransferase activity, alcohol group as acceptor	21	13	8	392	2.09	−0.05
ATP binding	33	21	12	727	2.03	−0.85
Cytokine activity	10	3	7	149	0.09	2.27
Receptor binding	18	6	12	327	−0.1	2.07
Cellular Component
Integral to membrane	103	59	44	2185	3.85	−0.54
Extracellular	99	44	55	1761	2.57	3.24
Extracellular space	96	41	55	1691	2.24	3.58
Membrane	119	61	58	2794	2	−0.37
Mitochondrion	13	3	10	509	−2.13	−0.31
Intracellular	142	57	85	3971	−2.6	−0.09
Cytoplasm	70	26	44	2206	−2.64	−0.62
Extracellular region	19	5	14	260	0.16	3.66
Cell	221	104	117	5869	−0.33	−2.13

 Specific ontologies, with the highest and lowest z-scores, were selected after the analysis of nontransformed data. A z-score is a statistical rating of the relative expression of gene ontologies and indicates how much each ontology is over (positive)- or under (negative)-represented in a given gene list. Stated in another way, the z-score is a standardized difference using the expected value and standard deviation of the number of genes meeting the criterion of a gene ontology term under a hypergeometric distribution. ²⁷ Positive z-scores represent gene ontology terms with a greater number of genes meeting the criterion than is expected by chance, whereas negative z-scores indicate gene ontology terms with fewer genes meeting the criterion than expected by chance. A z-score close to zero suggests that the number of genes meeting the criterion approximates the anticipated number. ²⁷ In this table the z-scores >2.0 or < −2.0 are reported for ontologies with seven or more genes. High and low values for the placebo and 17β-estradiol groups in designated ontologies are highlighted in bold print. Gene list, number of genes with significant differences in expression; Estradiol genes ↑, number of genes upregulated in lacrimal glands of 17β-estradiol-treated mice, as compared to those of the placebo group; Placebo genes ↑, number of genes upregulated in lacrimal glands of placebo-treated mice, relative to those of the Estradiol group; array genes, total genes of this ontology represented on the microarray; z-score, specific score for the upregulated genes in the placebo- and hormone-exposed lacrimal glands.

Table 8.

 

Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or Progesterone-Treated Mice

Ontology	Gene List	Progesterone Genes ↑	Placebo Genes ↑	Array Genes	Progesterone z-Score	Placebo z-Score
Biological Process
Signal transduction	39	28	11	1175	5	−1.61
Cell communication	48	31	17	1532	4.32	−1.26
Cell growth and/or maintenance	41	14	27	2131	−2.09	−0.84
Physiological process	135	50	85	5573	−2.41	1.13
Metabolism	109	40	69	3863	−0.02	2.67
Lipid metabolism	14	3	11	304	−0.09	3.24
Response to stress	7	6	1	394	0.98	−2.04
Molecular Function
Signal transducer activity	40	26	14	1273	3.55	−0.97
Phosphoric ester hydrolase activity	8	6	2	170	3.08	−0.24
Receptor activity	28	17	11	832	2.78	−0.17
Metal ion binding	34	12	22	951	0.52	2.62
Zinc ion binding	15	4	11	369	−0.03	2.69
Transition metal ion binding	18	5	13	476	−0.11	2.59
Transferase activity	7	1	6	106	−0.15	3.79
Cellular Component
Extracellular	61	32	29	1761	3.39	0.92
Extracellular space	60	31	29	1691	3.38	1.17
Cytoplasm	40	15	25	2206	−2.25	−1.38
Plasma membrane	16	10	6	902	0.05	−2.06

 Specific ontologies, with the highest and lowest z-scores, were selected after the analysis of nontransformed data. Criteria for inclusion in the table were an ontology containing seven or more genes and having a z-score > 2.0 or < −2.0. High and low values for the placebo and progesterone groups in designated ontologies are highlighted in bold print.

Table 9.

 

Highest and Lowest Expression of Gene Ontologies in the Lacrimal Glands of Placebo- or 17β-Estradiol- and Progesterone-Treated Mice

Ontology	Gene List	Estradiol and Progesterone Genes ↑	Placebo Genes ↑	Array Genes	Estradiol and Progesterone z-Score	Placebo z-Score
Biological Process
Regulation of apoptosis	11	7	4	132	3.85	0.73
Cell death	14	8	6	276	2.16	0.06
Death	14	8	6	280	2.11	0.03
Protein transport	8	0	8	304	−2.13	0.63
Organogenesis	34	10	24	674	0.19	2.74
Morphogenesis	35	10	25	742	−0.14	2.5
Immune response	17	4	13	328	−0.29	2.38
Cell–cell signaling	8	1	7	144	−0.73	2.31
Embryonic development	7	2	5	96	0.57	2.12
DNA replication and chromosome cycle	7	2	5	97	0.56	2.09
Cell differentiation	12	3	9	218	−0.03	2.09
Development	47	14	33	1133	−0.53	2.03
Molecular Function
Hydrolase activity, acting on ester bonds	18	15	3	324	5.01	−1.46
Hydrolase activity	43	25	18	1145	2.4	−1.24
Phosphoric ester hydrolase activity	7	6	1	170	2.36	−1.36
Cytokine activity	12	2	10	149	−0.08	4.06
Receptor binding	23	7	16	327	1.14	3.72
Signal transducer activity	52	16	36	1273	−0.53	2.17
Hormone activity	7	3	4	74	1.93	2.05
Cellular Component
Extracellular matrix (sensu Metazoa)	8	5	3	148	2.08	−0.08
Extracellular region	17	4	13	260	0.2	3.28
Extracellular space	79	29	50	1691	1.3	2.73
Extracellular	80	30	50	1761	1.29	2.4

 Specific ontologies and inclusion criteria are as described in Table 8 .

Table 10.

 

Analogous and Opposite Effects of 17β-Estradiol and Progesterone on Gene Expression in the Lacrimal Gland

Treatment 1	Treatment 2	T1 ↑, T2 ↑	T1 ↓, T2 ↓	T1 ↑, T2 ↓	T1 ↓, T2 ↑
17β-Estradiol	Progesterone	14	28	1	0
17β-Estradiol	17β-Estradiol + Progesterone	34	95	0	0
Progesterone	17β-Estradiol + Progesterone	14	40	1	0

 Data were analyzed with and without log transformation. The total number of genes in each category was then determined. Gene expression was significantly (P < 0.05) up (↑)- or down (↓)-regulated by sex steroid treatment.

Table 11.

 

Verification of Selected CodeLink Bioarray and GEM Chip Results

Gene	CodeLink Ratio	GEM Ratio	qPCR Ratio
17β-Estradiol>Placebo
Pancreatic lipase related protein 1	3.4	4.7	11.3
Asialoglycoprotein receptor 1	3.0	2.1	3.4
Placebo>17β-Estradiol
Solute carrier family 27 (fatty acid transporter), member 2	9.1	2.6	8.8
Nidogen 1	2.3	2.2	1.4
Progesterone>Placebo
CD248 antigen, endosialin	2.0	—	4.9
Placebo>Progesterone
Nidogen 1	1.6	1.6	1.5
17β-Estradiol+Progesterone>Placebo
Pancreatic lipase related protein 1	3.0	5.2	12.6
Asialoglycoprotein receptor 1	2.6	1.6	4.6
Placebo>17β-Estradiol+Progesterone
solute carrier family 27 (fatty acid transporter), member 2	4.8	2.2	3.2
Nidogen 1	2.1	1.4	1.5

 The expression of selected genes that were shown to be up- or downregulated in lacrimal glands of placebo- or sex steroid–treated mice by using CodeLink Bioarrays or GEM chips, were re-evaluated with qPCR procedures. —, Gene sequence not present on the GEM chips.

Table 12.

 

Comparative Influence of Sex and Sex Steroid Treatment on Gene Expression in the Mouse Lacrimal Gland

Comparison 1	Comparison 2	Common Genes					Total Common Genes as % of Total F>M Genes	Total Common Genes as % of Total M>F Genes
				No Transformation	Log Transformation	Total
F>M	E2 > Plac	13	19	22	6.6
M>F	Plac > E2	38	63	72		26.8
F>M	Prog > Plac	2	2	3	0.9
M>F	Plac > Prog	7	8	10		3.7
F>M	E2+Prog > Plac	31	33	38	11.3
M>F	Plac > E2+Prog	34	57	64		23.8

 Data originated from the present (i.e. sex steroid effects) and a previous study (i.e. sex-related differences). ²⁵ The total number of F>M genes was 335, whereas the quantity of M>F genes was 269. ²⁵ F, female; M, male; E2, 17β-estradiol; Plac, placebo; Prog, progesterone.

Table 13.

 

Similarities between the Effects of Sex and Sex Steroid Administration on the Expression of Specific Genes in the Mouse Lacrimal Gland

Female>Male	Male>Female
17β-Estradiol>Placebo	Placebo>E2
Asialoglycoprotein receptor 1	Lymphocyte antigen 6 complex, locus F
Pancreatic lipase–related protein 1	Radial spokehead-like 1
Polycystin	Maestro
High-mobility group nucleosomal binding domain 3	Olfactory receptor 140
Furin (paired basic amino acid cleaving enzyme)	Midkine
Growth differentiation factor 5	Solute carrier family 27 (fatty acid transported), member 2
Aldo-keto reductase family 1, member C18	Stromal antigen 3
Thioether S-methyltransferase	Progastricsin (pepsinogen C)
LPS-induced TN factor	Unc-51 like kinase 1 (C. elegans)
Ribosomal protein S6 kinase polypeptide 6	Placental growth factor
Progesterone>Placebo	Placebo>Progesterone
Solute carrier family 39 (metal ion transporter), member 8	Maestro
RAD23a homolog (S. cerevisiae)	UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
Acid phosphatase 5, tartrate resistant	Cell division cycle 45 homolog (S. cerevisiae)-like
	Forkhead box P3
	BTB and CNC homology 1
	Chordin
	Heparanase
17β-Estradiol + Progesterone > Placebo	Placebo > 17β-Estradiol + Progesterone
Asialoglycoprotein receptor 1	Lymphocyte antigen 6 complex, locus F
Pancreatic lipase–related protein 1	Radial spokehead-like 1
Aminoacylase 1	Maestro
Cysteine dioxygenase 1, cytosolic	Olfactory receptor 140
Polycystin	Solute carrier family 27 (fatty acid transporter), member 2
Transcription factor 7, T-cell specific	Interleukin 3
High-mobility group nucleosomal binding domain 3	Transient receptor potential cation channel, subfamily M, member 5
Hypoxanthine guanine phosphoribosyl transferase	Coagulation factor II (thrombin) receptor-like 3
Cytosolic acyl-CoA thioesterase 1	Leprecan 1
Butyryl coenzyme A synthetase 1	Stromal antigen 3

 Examples of genes with known function that were significantly (P < 0.05) influenced by sex, as well as by sex steroid treatment. Designated genes showed the highest sex-related differences in expression (i.e. Male>Female, Female>Male) and corresponded to genes up- or downregulated by estrogen and/or progesterone administration.

The authors thank Christian B. Wade (Seattle, WA) for assistance with the GeneSifter software and the Harvard Center for Genomic Research for help with processing GEM 1 and 2.