Effect of VEGF-A on Expression of Profibrotic Growth Factor and Extracellular Matrix Genes in the Retina

Abstract

purpose. Vascular endothelial growth factor-A (VEGF) causes increased vascular permeability and leukocyte adhesion in preclinical diabetic retinopathy (PCDR). Another hallmark of PCDR is thickening of the capillary basement membrane (BM). Recently, VEGF has been shown to induce expression of profibrotic genes such as transforming growth factor (TGF)-β1 and connective tissue growth factor (CTGF or CCN2) in cultured endothelial cells. Moreover, neutralization of VEGF prevented BM thickening in diabetic mice in vivo. The authors hypothesize that VEGF directly contributes to BM thickening in the diabetic retina by inducing expression of profibrotic growth factors and extracellular matrix (ECM) components.

methods. Transcription and protein levels of ECM-related genes were evaluated in the rat retina after intravitreal VEGF injection by real-time quantitative PCR, Western blot analysis, and immunohistochemistry. In addition, expression profiles of the same genes in response to VEGF stimulation were investigated in bovine retinal vascular cells in vitro.

results. Intravitreal VEGF injection induced retinal transcription of CYR61 (CCN1), CTGF, TGF-β1, tissue inhibitor of metalloproteases (TIMP)-1 and fibronectin, and protein expression of CYR61, CTGF, TGF-β1 and fibronectin. In bovine retinal endothelial cells and pericytes stimulated by VEGF in vitro, gene expression profiles were similar to those in the intact retina in vivo.

conclusions. VEGF induces profibrotic growth factors and extracellular matrix genes in the retina in vivo, as well as in cultured retinal vascular cells in vitro. The current findings have relevance for understanding the pathogenesis of preclinical DR, where early upregulation of VEGF may cause BM thickening by induction of ECM-related genes.

Diabetic retinopathy (DR) is a major complication of diabetes and a leading cause of blindness. ^{1 2} Despite recent progress in understanding the pathogenesis of DR, further research is warranted, as the disease is still neither preventable nor curable. 

DR is preceded by an asymptomatic preclinical phase (PCDR) in which a microangiopathy develops characterized by diffusely increased vascular permeability and capillary basement membrane (BM) thickening. ^{3 4 5} In the later stages of PCDR, endothelial cell and pericyte deprivation leads to vascular cell death and the development of acellular capillaries. Experimental prevention of BM thickening has been shown to ameliorate these retinal vascular changes in an in vivo model of diabetes in galactose-fed rats. ^{6 7} In this model, downregulation of fibronectin synthesis partly prevented retinal BM thickening and also reduced pericyte and endothelial cell loss. ⁶ In another study, combined downregulation of mRNA levels of the extracellular matrix (ECM) components fibronectin, collagen type IV, and laminin not only prevented the increase in their protein levels but also reduced vascular leakage in the retinas of rats with streptozotocin (STZ)-induced diabetes. ⁷ These findings suggest that BM thickening is not just an epiphenomenon of the diabetic state, but may be instrumental in the progression to sight-threatening DR. Modulation of BM thickening may therefore have a preventive effect on the development of DR. 

BM thickening results from increased synthesis and/or decreased breakdown of collagen type IV, fibronectin, laminin, and other ECM compounds. ^{8 9 10} TGF-β and CTGF (connective tissue growth factor, CCN2) are both potent inducers of ECM synthesis. CTGF, which is an important downstream mediator of the profibrotic effects of TGF-β, ^{11 12 13} is a member of the CCN (for CTGF, CYR61, and NOV) gene family, which encode for cysteine-rich secreted proteins with roles in cell growth and differentiation. ¹⁴ The classification of CCN proteins in one family is based on a shared modular organization, and their binding to ECM–associated molecules, whereas their expression and function is different and context-dependent for individual tissues and cells. ¹⁵ To date, little is known about the role of this protein family in the (patho)physiology of the retina. 

In proliferative DR, we have shown that CTGF is associated with fibrosis. ¹⁶ Under diabetic conditions, TGF-β and CTGF increase production of collagen, fibronectin, and tissue inhibitors of metalloproteases (TIMPs). ^{17 18 19 20 21 22 23 24 25} A causal role of TGF-β in inducing capillary BM thickening has been demonstrated in brain capillaries in the mouse and in diabetes-induced BM thickening of glomerular capillaries in the kidney. ^{26 27 28} Recently, we have found evidence of a causal role of CTGF in BM thickening in the diabetic retina. ^{29 30 31 32} Immunohistochemical analysis of human retinas revealed CTGF staining of mainly microvascular pericytes in patients with DR, whereas control subjects demonstrated a predominant microglial staining pattern. ²⁹ Moreover, we found that CTGF ^+/− mice (lacking one functional allele for CTGF) are protected from diabetes-induced BM thickening of retinal and kidney glomerular capillaries. ^{30 31} We also found increased CYR61 and CTGF mRNA expression in the retina of rats with STZ-induced diabetes, which coincided with increased collagen type IV, laminin, and TIMP-1 mRNA expression. ³² This diabetes-induced expression was attenuated by the advanced glycation end products (AGEs) inhibitor aminoguanidine. Infusion of mice with AGEs induced retinal CYR61 and CTGF mRNA expression. ³² Taken together, these results suggest that CYR61 and CTGF act as downstream effectors of AGEs, possibly leading to BM thickening, as observed in the diabetic retina. 

VEGF, a potent vascular permeability and angiogenesis factor, is also increased early in PCDR. ^{33 34 35} VEGF induces the expression of TGF-β in glomerular endothelial cells ³⁶ and of CTGF in retinal vascular cells. ^{24 37 38} Moreover, neutralizing VEGF with an antibody partly prevented diabetes-induced BM thickening in the retina of obese type 2 diabetic mice. ³⁹  

Based on these observations, we hypothesize that VEGF can induce expression of genes that contribute to BM thickening in PCDR. To test this hypothesis, we investigated the effects of intravitreally injected VEGF-A ^{40 41 42} on the in vivo expression of TGF-β, CTGF, other CCN family members (CYR61, NOV, and WISP-1, -2, and -3), ^{43 44 45} and ECM-related molecules in the rat retina, as well as the in vitro effects of VEGF on these molecules in cultured bovine retinal vascular endothelial cells and pericytes. 

Materials and Methods

Animals

All animal studies were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Animal handling and experimental procedures for all experiments involving rats were reviewed and approved by the committee on ethical animal care and according to the Guidelines for the Care and Use of Laboratory Animals of The Netherlands Ophthalmologic Research Institute (Amsterdam, The Netherlands). 

Intravitreal injections were performed on 100 adult Wistar rats (Charles River, Maastricht, The Netherlands), weighing approximately 250 g. Rats were anesthetized with fentanyl (0.5 mg/kg, intramuscularly) and midazolam (0.1 mg/kg, subcutaneously), along with local ocular anesthesia of 1 drop of 1% oxybuprocaine hydrochloride per injected eye. Three microliters of a solution of 0.1% BSA in PBS, containing 100 ng of recombinant rat VEGF₁₆₄ (564-RV; R&D Systems, Abingdon, UK) was injected into the vitreous in one eye of each rat, whereas the vehicle alone was injected into the vitreous of the contralateral eye, using a 50-μL syringe (Hamilton, Martinsried, Germany) fitted with a 30-gauge needle. After all air was cleared from the syringe and tubing, forceps were used to push the needle through the sclera of the rat eye at a level of approximately 2 mm posterior to the limbus through the pars plana at an angle that allowed the needle to enter the vitreous without damaging the lens. The rats were killed at 1, 6, 24, 48, and 72 hours after injection (20 rats at each time point) of a lethal dose of pentobarbital (intraperitoneally). On collection, all retinas were inspected for damage from the injection needle. All damaged retinas were excluded from the experiment. A maximum of two retinas per group were damaged. For RNA isolation, the eyes of 10 rats per group were rapidly enucleated, the anterior chambers were removed, and the retinas were carefully dissected, placed into 500 μL RNA extraction reagent (TRIzol; Invitrogen, Carlsbad, CA), and stored at −20°C until further processing. For Western blot analysis and immunohistochemistry, the eyes of eight rats per treatment group and four untreated rats were immediately enucleated, frozen in liquid nitrogen, and stored at −80°C until further processing. 

RNA Isolation and mRNA Quantification

Total RNA was isolated from dissected retinas and bovine retinal cells in TRIzol reagent according to the manufacturer's instructions and dissolved in RNase-free water. The amount of total retinal RNA was approximately 12 μg/retina (spectrophotometric measurements at 260 nm), with no significant differences between the experimental groups. The integrity of the RNA samples was verified by electrophoresis (ExperionTM Automated Electrophoresis System; Bio-Rad, Hercules, CA). All samples had sharp ribosomal RNA bands with no sign of degradation. A 2-μg aliquot of total RNA was treated with DNase I (amplification grade; Invitrogen), reverse transcribed into first-strand cDNA with reverse transcriptase (Superscript II and the oligonucleotide oligo(dT)_12-18; Invitrogen). Details of the primers are given in Tables 1 and 2 . Specificity of the primers was confirmed by a nucleotide-nucleotide BLAST (http://www.ncbi.nlm.nih.gov/blast/index.shtml) search. The presence of a single PCR product was verified by both the presence of a single melting-temperature peak and detection of a single band of the expected size on a 3% agarose gel. 

Real-time quantitative PCR (qPCR) was performed on a thermocycler (iCycler iQ; Bio-Rad). Fluorescence was measured after each cycle and displayed graphically. For each primer set, a master mix was prepared, consisting of SYBR green master mix (Supermix; Bio-Rad) at a final concentration of 1× and 2 picomoles of primers completed with RNase-free water. One microliter of cDNA (diluted 1:20) in 19 μL master mix was amplified by the following PCR protocol: 50°C for 2 minutes and 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 45 seconds, followed by 95°C for 1 minute and a melting program (60–95°C). Relative gene expression was calculated with the equation: R = E ^−Ct, where E is the mean efficiency of all samples for the gene being evaluated and Ct is the cycle threshold for the gene as determined during real-time PCR. Normalization was performed with geNorm as described by Vandesompele et al. ⁴⁶  

Statistics

Gene expression levels among groups were calculated by using single ANOVA, with P < 0.05 considered significant. The Bonferroni post hoc test was used to perform pair-wise comparisons of groups. All PCR experiments were performed at least twice. 

Antibodies

The following antibodies were used for Western blot analysis and immunohistochemistry: anti-CTGF (ab6992; Abcam, Cambridge, UK), anti-CYR61 (ab24448; Abcam), anti-TGFβ-1 (AHG0051; Biosource, Nivelles, Belgium), anti-fibronectin (A0245; DAKO, Glostrup, Denmark), anti-TIMP1 (AF580; R&D Systems), and anti-laminin (ab11575; Abcam). Anti-GAPDH antibody (ab9484; Abcam) was used as a protein loading control for Western blots. 

Western Blot Analysis

Frozen eye halves were thawed in ice-cold buffer (10 mM HEPES, 150 mM NaCl, 1× Complete Proteinase Inhibitors; Roche Biochemicals, Almere, The Netherlands). Eight retinal halves from the control and experimental groups were then harvested at each time point and pooled in 500 μL lysis buffer (0.5% Triton X-100, 50 mM HEPES, 150 mM NaCl, 10% glycerol, 1.5 mM MgCl₂, 1 mM EGTA, 1 mM PMSF, and 1× Complete Proteinase Inhibitors) in a 1.5-mL vial (Eppendorf AG, Hamburg, Germany). Samples were homogenized with a pestle (Eppendorf) and vigorous vortexing and frozen overnight. Samples were thawed and vortexed and then centrifuged at 4°C for 15 minutes at 10,000g. Supernatants were collected in new vials and stored at −80°C. The protein concentration of each sample was determined with a Bradford assay kit (Bio-Rad) and adjusted to a protein concentration of 3 μg/μL SDS-PAGE and Western blots were performed as described previously. ⁴⁷ For CYR61, bands of the protein were quantified by densitometry (AlphaEase; AlphaInnotech Corp., San Leandro, CA). 

Immunohistochemistry

Tissue blocks of the other eight frozen halves of rat eyes were cut by using a standard protocol for immunohistochemical staining. Air-dried serial cryostat sections (10 μm thick) were fixed in cold acetone for 10 minutes, postfixed for 2 minutes in Zamboni's fixative (2% paraformaldehyde in a saturated picric acid solution), and stained by an indirect immunoperoxidase procedure. For this purpose, sections were incubated for 20 minutes in PBS containing 0.1% sodium azide and 0.3% H₂O₂ to quench endogenous peroxidase activity. To reduce nonspecific staining, we incubated the sections for 15 minutes in PBS containing 10% normal goat serum and 0.01% saponin (Sigma-Aldrich, St. Louis, MO). Subsequently, serial sections were incubated for 60 minutes at room temperature with the relevant antibody. Poly-horseradish peroxidase goat anti-mouse or goat anti-rabbit immunoglobulins (Powervision; ImmunoLogic, Duiven, The Netherlands) were used as secondary antibodies. Sections were incubated for 30 minutes with the secondary antibodies. Peroxidase activity was visualized by incubating the sections in 3-amino-9-ethyl carbazole (AEC, red) and 0.01% H₂O₂ as substrates for 10 minutes. The reaction was stopped by rinsing the sections in distilled water. Sections were counterstained with hematoxylin. Control incubations were performed in the absence of primary antibodies. 

Bovine Retinal Vascular Cell Culture

Bovine retinal endothelial cells (BRECs) and bovine retinal pericytes (BRPCs) were isolated from freshly enucleated calf eyes obtained from a local abattoir by a differential filtration method. On their collection, the calf eyes were kept on ice, and, just before isolation, they were disinfected with 70% ethanol. 

For the isolation of pericytes, retinas from fresh eyes (<6 hours after enucleation) were used. Working in a sterile hood, the anterior chambers of the calf eyes were removed with surgical scissors. A fine-tipped paintbrush was used to separate the retina from the retinal pigment epithelium, and the retina was cut loose from the optic nerve with a surgical blade or scissors. 

Five retinas were isolated and pooled in DMEM (Invitrogen) and then homogenized with a glass homogenization tube and a plastic pestle. Homogenized tissue was then transferred to a 50-mL centrifuge tube and centrifuged for 10 minutes at 1600g. Supernatant was removed, and the pellet was resuspended in 10 mL DMEM. A 20-mL syringe (BD Bioscience, San Jose, CA) and a filter holder (Millipore) were then used to filter the suspension through a 60-μm filter (Millipore, Bedford, MA) presoaked in DMEM. The filter was washed with an additional 10 mL of DMEM. The filtrate was discarded, and the tissue remaining on the filter was placed into a clean 50-mL centrifuge tube, which was then centrifuged for 10 minutes at 400g. The supernatant was discarded, and the pellet was resuspended in 6 mL digestion mix for 5 minutes at 37°C. The digestion mix consisted of DMEM, 10% fetal calf serum (FCS), collagenase III (210 U/mL; Sigma-Aldrich), Pronase E (91 U/mL; Difco; BD Bioscience), and DNase I (170 U/mL; Invitrogen). The digestion mix was filtered through a 180-μm filter (Millipore) and centrifuged for 10 minutes at 400g. The pellet was then resuspended in 5 mL DMEM with 10% FCS. This procedure was repeated until 25 retinas were isolated. The cells were pooled and transferred to five 75-cm² collagen-coated culture flasks (type IV collagen; Sigma-Aldrich) and placed in an incubator. On reaching confluence, cell cultures were split at a ratio of 1:3. 

The procedure for isolating the BRECs was the same as described for BRPCs, with a few exceptions. The retinas were incubated for 30 minutes in a digestion mix. The final cell filtrate was then suspended in bovine endothelial cell growth medium (Cell Applications, San Diego, CA) before the cells were plated in five 75-cm² culture flasks coated with collagen and fibronectin (Roche). On reaching confluence, the cell cultures were split at a ratio of 1:3. 

Before the in vitro experiments began, the cells were split and plated in six-well culture plates coated with collagen and fibronectin (BRECs) or collagen alone (BRPCs). Cells in the third passage were used for all experiments. On reaching 70% to 80% confluence, the cells were preincubated for 24 hours in starvation medium (DMEM). At the start of the experiments, the cells received either DMEM containing rhVEGF (25 ng/mL) or DMEM alone as a control. At the appropriate time points, the cultures were harvested by aspirating the medium and adding 0.5 mL extraction reagent (TRIzol; Invitrogen) to each well to dissociate the cells. The harvested cells were then pipetted into 1.5-mL vials (Eppendorf) and stored at −20°C until further processing for RNA isolation. The purity of the cell cultures was checked by immunohistochemistry and PCR, with von Willebrand factor and NG2 used as markers for endothelial cells and pericytes, respectively. Both methods resulted in a purity of at least 95% for both cell types. 

Results

Effects of Exogenous VEGF on mRNA Levels of the CCN Family and TGF-β Genes in the Rat Retina

An early and significant threefold increase in CYR61 (CCN1) mRNA levels was observed at 1 hour after intravitreal injection of VEGF, when compared with the contralateral vehicle-injected eyes (P = 0.04; Fig. 1 ). At 24 hours, CYR61 mRNA levels showed a 2.2-fold increase, but the change was not significant (P = 0.084). 

CTGF (CCN2) mRNA expression showed a 2.3-fold increase (P = 0.004) at 24 hours after injection. For all other time points, mRNA levels of CYR61 and CTGF were similar in VEGF-treated and control eyes. CCN4 mRNA levels remained unaltered throughout the experiment (Fig. 1) , whereas gene expression levels of CCN3, -5, and -6 were below detection levels in all eyes. 

VEGF also induced TGF-β1 mRNA expression with a significant upregulation of 2.4-fold (P < 0.001) at 24 hours after injection. Retinal TGF-β2 mRNA expression was unaffected by VEGF treatment (Fig. 2) . 

Effect of Exogenous VEGF on mRNA Levels of ECM Molecules in the Rat Retina

Fibronectin mRNA was significantly upregulated at 24 (3.6-fold; P < 0.001) and 48 (1.4-fold; P = 0.002) hours after intravitreal VEGF injection (Fig. 3) . Collagen type IV and laminin B1 mRNA expression levels were not significantly affected by VEGF at the time points studied. 

TIMP-1 mRNA levels were significantly increased at 6 hours (1.8-fold; P = 0.04) and at 24 hours (4.8-fold; P = 0.04) after injection. Expression of TIMP-2 was unaffected by intravitreal VEGF injection (Fig. 3) . 

Western Blot Analysis of Proteins of the Rat Retina

Western blot analysis was performed to investigate whether the observed increases in mRNA levels of CYR61, CTGF, and fibronectin corresponded with a subsequent increase in protein levels. A clear increase in CTGF and fibronectin protein was noted at 48 hours after injection in VEGF-injected eyes compared with control eyes (Fig. 4) . Anti-CYR61, which normally detects a band of 39 kDa in Western blots, detected three bands in retinal proteins (Fig. 5) . It is not clear whether one or more bands specifically represent CYR61 protein. However, the 11.4-kDa band showed a time-dependent increase that coincided with the increase at the transcriptional level. Ratios of CYR61 protein expression levels in VEGF-injected eyes and PBS-injected eyes, as determined by densitometry, are given in Figure 5bfor all three bands. 

Immunohistochemistry of the Rat Retina

Immunohistochemistry was performed to investigate the localization and expression levels of proteins at 24 and 48 hours after injection in the VEGF- and vehicle-injected control eyes compared with untreated eyes. Distinct differences were not found between VEGF-injected and vehicle-injected eyes for any of the proteins after 24 hours. However, after 48 hours, differences in staining intensity was detected among the three treatment groups (Figs. 6 7) . This was in line with the PCR and Western blot data. In noninjected eyes, CTGF and CYR61 both showed a nonvascular distribution pattern, mainly in the ganglion cell layer (GCL) and a weak positivity in the inner plexiform layer (IPL; Fig. 6 ). A slight increase in labeling intensity was observed for CTGF and CYR61 throughout all layers of the retina in vehicle-injected eyes. In addition to this slight panretinal increase in staining, VEGF-injected eyes showed a stronger staining intensity for both CTGF and CYR61 in the GCL. TIMP-1 immunostaining was also found in the GCL and the IPL (Fig. 6) . In the VEGF-injected eyes, a staining of small vessels of the inner nuclear layer (INL) was visible. TGF-β1, laminin, and fibronectin staining was observed only in the retinal vasculature. TGF-β1 staining was somewhat enhanced in the PBS-injected eyes and significantly increased in the VEGF-injected eyes when compared to that in the untreated eyes (Fig. 7) . Laminin staining was vessel specific, but differences in intensity or distribution between the three treatment groups were not detected. Fibronectin staining appeared to be vessel specific as well and showed an increased number of labeled vessels in VEGF-injected eyes, especially in the INL (Fig. 7) . Control incubations in the absence of primary antibodies did not result in any staining. 

mRNA Levels in Retinal Vascular Cells In Vitro

Expression levels of CTGF and fibronectin were high in control BRECs and BRPCs, expression levels of collagen type IV and laminin B1 were low and only detectable in pericytes, whereas moderate expression was observed for all other genes in both cell types. Effects of VEGF stimulation on gene expression profiles in BRECs and BRPCs are shown in Figure 8 . In BRECs, mRNA levels of CYR61 and CTGF were significantly increased at 1 hour (3-fold, P = 0.002; and 2-fold, P = 0.02, respectively) and 4 hours (3.5-fold, P = 0.004; and 2.5-fold, P = 0.04, respectively) after VEGF stimulation. In addition, mRNA levels of TGF-β1, TGF-β2, and fibronectin were all significantly upregulated after 4 hours of stimulation with VEGF (1.5-fold, P = 0.001; 2-fold, P = 0.001; and 1.5-fold, P = 0.02). TIMP-1 mRNA levels were significantly increased 24 hours after stimulation (twofold, P = 0.04) whereas TIMP-2 mRNA levels were not affected by VEGF treatment. Expression levels of collagen type IV and laminin B1 were below detection limits in BRECs. 

In BRPCs, CYR61 mRNA levels were significantly increased at 4 hours (2-fold, P = 0.02) and peaked 24 hours after VEGF stimulation (3.5-fold, P = 0.002). In addition, fibronectin, collagen type IV and TIMP-1 mRNA levels were significantly upregulated after 24 hours (twofold, P = 0.03; twofold, P = 0.01; and twofold, P = 0.04, respectively). CTGF, TGF-β1, TGF-β2, TIMP-2 and laminin B1 mRNA levels were not affected in BRPCs by VEGF stimulation. 

Summary of Data

In summary, our study showed that after intravitreal VEGF injection in the rat eye, an early increase in retinal mRNA expression of CYR61 was followed by increased TIMP-1 mRNA levels at 6 hours after injection and increased mRNA levels of CTGF, TGF-β1, fibronectin, and TIMP-1 at 24 hours after injection. Upregulation of CYR61, CTGF, TGF-β1, and fibronectin mRNA by VEGF treatment was followed by an increase in protein expression as was demonstrated by Western blot analysis and/or immunohistochemistry. In addition, BRECs and BRPCs stimulated in vitro by VEGF showed gene expression profiles that were similar to those of the intact retina in vivo. 

Discussion

Our study demonstrates the ability of VEGF to induce mRNA expression levels of genes related to ECM remodeling in the rat retina. The specificity of this response was demonstrated by the fact that induction of ECM-related genes was selective, that the expression profile was similar to changes in proteins levels, and that the VEGF-induced expression profiles in cultured retinal vascular cells were similar as well. Although we cannot determine the contribution of nonvascular cells to the observed gene expression patterns in the intact retina, the similarity of the responses observed in vitro in retinal vascular cells and in vivo in retinas suggests that the retinal vasculature is an important contributor to these expression profiles. 

Our immunohistochemical and Western blot results for CYR61 expression demonstrate that the treatment itself has an effect on the induction of CYR61 and possibly on other molecules (CTGF and TGF-β1) as well. However, induction of these molecules in the presence of VEGF was significantly higher, and we demonstrated similar expression patterns in vitro in cultured retinal vascular cells, indicating the effects of VEGF. This is supported by our recent observations that CTGF and CYR61 expression levels are upregulated by the diabetic milieu in a streptozotocin model of experimental diabetes in rats, which coincided with increased expression of ECM-related molecules. ³¹  

Previous studies on VEGF and VEGF receptor expression in the retina have indicated an important role for VEGF in the pathogenesis of diabetic retinopathy. ^{39 48 49} The rationale behind the present study was based on the observation that VEGF is increased early in the diabetic retina and coincides with BM thickening in the retinal vasculature. VEGF is considered to cause increased vascular permeability and leukocyte adhesion in PCDR ⁴⁸ and may act as a vascular cell survival factor. ⁴⁹ However, in our study, VEGF induced ECM remodeling in the diabetic retina as well. This is particularly interesting in the light of a recent report showing that neutralizing VEGF in PCDR in obese type 2 diabetic mice partly prevented diabetes-induced BM thickening. ³⁹ This study demonstrated that VEGF expression in PCDR contributes to diabetes-induced BM thickening by an unknown mechanism. Our results suggest that this occurs via upregulation of the expression of a selected set of genes which, with the exception of CYR61, have all been implicated in diabetes-induced BM thickening. 

TGF-β has been said to be causally involved in diabetes-induced BM thickening in the kidney glomerulus, ^{26 27 28} and it has been shown to be an important upstream regulator of CTGF. ^{11 12 13} In the present study, VEGF induced TGF-β1 mRNA expression, whereas no such induction of TGF-β was observed in a previous study on rats with streptozotocin-induced diabetes. ³² Because of these seemingly conflicting data and the complex regulation of its bioavailability, ⁵⁰ the role of TGF-β in retinal BM thickening remains controversial. 

Recently, we found that mice lacking one functional allele for CTGF are protected from diabetes-induced BM thickening of glomerular capillaries ³⁰ and retinal capillaries, ³¹ indicating that CTGF is an important causal factor in this process. Fibronectin and collagen type IV are vascular BM components that can be induced by CTGF. ^{25 51 52} Their expression is increased in diabetes and contributes to diabetes-induced BM thickening. ^{6 9 53 54} In our in vitro study, collagen type IV levels were low and expressed only in pericytes, whereas fibronectin mRNA was found in high levels in endothelial cells and pericytes. This may explain why we observed increased fibronectin expression but not increased collagen type IV expression in intact retinas. 

Finally, we found marked upregulation of TIMP-1. TIMP-1 is the natural inhibitor of MMP-9, which is one of the MMPs involved in the breakdown of the vascular BM necessary to allow angiogenesis. ^{55 56} TIMP-1 plasma levels are increased in diabetic patients and are associated with increased vascular stiffness by causing vascular matrix fibrosis. ⁵⁵  

Taken together, our results support the concept that VEGF, of which the expression is increased early in PCDR, ^{34 35} contributes to diabetes-induced BM thickening by upregulation of these ECM-related genes. 

In rat retina, CTGF immunostaining was mainly found in the ganglion cell layer and the inner plexiform layer, when using a polyclonal anti-CTGF antibody. Similar staining has been found in rat retina with another polyclonal anti-CTGF antibody. ⁵⁵ In contrast, we have observed a vascular-associated staining of CTGF in human retina with a monoclonal antibody. ²⁹ Differences in staining patterns may be attributed to differences in specificity of these antibodies and/or species-dependent differences in localization patterns (rat versus human). However, CTGF mRNA was found in the ganglion cell layer in rat retina ⁵⁵ with the use of in situ hybridization, whereas we detected high CTGF mRNA expression levels in cultured bovine retinal vascular cells that were induced by VEGF. 

Our results in cultured retinal vascular cells support our findings in vivo. However, a contribution of neural tissue to the expression profiles found in the intact retina cannot be excluded. Of note, induction of CTGF expression in pericytes at 24 hours was preceded by increased CTGF mRNA levels at 1 to 4 hours in endothelial cells. These findings are in line with the study by Kondo et al. ⁵⁶ that showed that VEGF induces increased stability of CTGF mRNA in endothelial cells rather than increased CTGF mRNA transcription. The delayed expression in pericytes may be due to de novo synthesis rather than mRNA stabilization, but this notion demands further study. 

A new observation is the effect of VEGF on expression of CYR61 (cysteine-rich, 61; CCN1) in vivo. CYR61 is a member of the CCN family (CCN1-6: consisting of CYR61, CTGF, NOV, WISP-1, WISP-2, and WISP-3). ^{43 44 45} It has been shown to promote angiogenesis in vitro and in vivo. ^{57 58} In our study, its early upregulation by VEGF in the retina in vivo is in line with a previous in vitro study demonstrating the rapid induction (<0.5 hour) of CYR61 in human umbilical endothelial cells by VEGF. ⁵⁹ Whether the observed increase in CYR61 mRNA levels is due to increased stabilization of mRNA or enhanced transcription remains to be investigated. Although we find induction by VEGF of CYR61 expression in retinal endothelial cells and pericytes, vice versa CYR61 was also demonstrated to induce VEGF expression in skin fibroblasts ⁶⁰ and to mediate the mechanical stress-induced upregulation of VEGF in vascular smooth muscle cells of the bladder. ⁶¹ CYR61 acts as an angiogenic factor, ^{57 62} probably by regulating proangiogenic integrins ⁶³ and/or by induction of VEGF. The role of CYR61 in the diabetic retina in PCDR, where angiogenesis is absent, is a matter for further study. 

In conclusion, our study demonstrates the upregulation of the expression of genes involved in ECM remodeling in the rat retina and in cultured bovine vascular retinal cells in response to VEGF. Our results suggest that early expression of VEGF in PCDR may contribute directly to BM thickening and further development of diabetic retinopathy. 

²  Contributed equally to the work and therefore should be considered equivalent authors.

 Supported by Grant 2001.042 from the Diabetes Fonds Nederland. The funding organization had no participation in the design or conduct of this study, collection of data, management, analysis, interpretation, preparation, review, or approval of this manuscript.

 Submitted for publication July 13, 2006; revised October 31, 2006, and April 18, 2007; accepted July 4, 2007.

 Disclosure: E.J. Kuiper, None; J.M. Hughes, None; R.J. Van Geest, None; I.M.C. Vogels, None; R. Goldschmeding, None; C.J.F. Van Noorden, None; R.O. Schlingemann, None; I. Klaassen, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Primers for Rat Genes Studied with Real-Time Quantitative RT-PCR

Gene	GenBank	Forward Primer	Reverse Primer	bp	Tm
Cyr61	NM_031327	GTGCCGCCTGGTGAAAGAGA	GCTGCATTTCTTGCCCTTTTTTAG	91	80
Ctgf	NM_022266	ATGATGCGAGCCAACTGCCTG	CGGATGCACTTTTTGCCCTTCTTAATG	194	84
Nov	NM_030868	TGGTTCCAGAGGGAGACAAC	AGGTCCACTTTTCGCAACAC	210	86
Wisp1	NM_031716	CCGACCACACATCAAGGCAGG	GGTCGGTAGGTGCGTGTGCTG	105	84
Wisp2	NM_031590	GCCCGAGGTACGCAATAGG	GCAGTTGGGTTGGAAGGACT	101	84
Wisp3	XM_574785	TCTCGTGCAAGCAACCAAGTG	CTGGGGATCTTCACTGCCTGT	165	83
Tgfb1	NM_021578	ACCGACCCTTCCTGCTCCTCAT	GATCCACTTCCAACCCAGGTCCT	173	85
Tgfb2	NM_031131	GCAGGATAATTGCTGCCTTC	GGCTGAGGACTTTGGTGTGT	158	80
Timp1	NM_053819	ATCGCGGGCCGTTTAAGGA	CAAGGGATGGCTGAACAGGGA	158	83
Timp2	NM_021989	ATCTCCTCCCCGGATGAGTG	GGCAAAGAACTTGGCCTGG	82	81
Fn1	NM_019143	CAGCCTACGGATGACTCATGC	CAGATAACCGCTCCCATTCCT	75	78
Col4a3	XM_343607	CCCTTGAGCCCTACGTTAGCA	CCTCAGAGCCTGCACTTGTAAACA	159	82
Lamb1	XM_216679	GCGTAAAGCTGCCCAGAACTCTG	TCCTCCTGGCATCTGCTGACTC	176	79

Table 2.

 

Primer Pairs for Bovine Genes Studied with Real-Time Quantitative RT-PCR

Gene	GenBank	Forward Primer	Reverse Primer	bp	Tm
CYR61	NM_001034340	ATGCCGCCTGGTGAAAGAAA	GCTGCATTTCTTGCCCTTTTTCAG	91	80
CTGF	NM_174030	CGAAGCTGACCTGGAGGAGAA	CTTCATGCTGGTGCAGCCA	106	79
TGFB1	M36271	GTACCACGCCAATTTCTGCC	TGTACAGGGCCAGGACCTTG	83	83
TGFB2	XM_613698	GGATCTTGGGTGGAAATGGATTCA	ACACGCAGCAAGGGGAAGCA	161	81
FN1	K00800	TTGAGTGCTTCATGCCTTTGG	CGCTTGTTTCTCTGGGTTGG	81	78
COL4A3	M63139	TCCTACAGTTTCTGGTTGGCTTCA	CTCCCCAGCTTTCACAGTTGATG	81	75
LAMB1	XM_600154	AACTGGATGGAGCAGAGCCCCTA	CAACAGTGACCAGCCCACCACA	165	86
TIMP1	NM_174471	ACTTCCACAGGTCCCACAACCG	AGGGAAACACTGTGCATTCCTCAC	180	84
TIMP2	NM_174472	GACGAGTGCCTCTGGATGGA	TTGATGCAGGCGAAGAACTTG	84	82

Figure 1.

 

Effect of exogenous intravitreal-injected VEGF on CCN gene expression. The data represent retinal gene expression levels in VEGF-injected eyes relative to expression levels in vehicle-injected eyes. Dashed line: basal levels (set to 1). *Significant change (P < 0.05).

Figure 2.

 

Effect of exogenous intravitreal-injected VEGF on TGF-β1 and -β2 gene expression. The data and significance of change are as described in Figure 1 .

Figure 3.

 

Effect of exogenous intravitreal-injected VEGF on the expression of the ECM-related genes fibronectin (Fn1), collagen type IV (Col4a3), laminin B1 (Lamb1), tissue inhibitor of metalloproteases 1 (Timp1) and 2 (Timp2). The data and significance of change are as described in Figure 1 .

Figure 4.

 

VEGF induced fibronectin and CTGF protein expression in vivo. The effect of VEGF-injection on fibronectin (FN1) and CTGF protein expression in rat retina was determined by Western blot analysis. GAPDH was used as loading control. A clear induction of protein expression was noted 48 hours after VEGF stimulation (V) compared with control eyes (C).

Figure 5.

 

Effect of exogenous intravitreal-injected VEGF on CYR61 protein levels in rat retina. (a) CYR61 protein expression was analyzed after VEGF injection by Western blot analysis. (b) Densitometric analysis was used to quantify the intensity of bands and is presented as the ratio of CYR61 expression in VEGF-stimulated eyes (V) over matched controls (C) at each time point.

Figure 6.

 

Immunohistochemical staining of CTGF, CYR61, and TIMP-1 in the rat retina. Immunohistochemical staining was performed on retina sections of untreated (NO INJ.), PBS-injected (PBS), and VEGF-injected (VEGF) rat eyes, at 48 hours after injection. Representative images are shown. CTGF and CYR61 staining was present in large cell bodies of the ganglion cell layer (GCL) and weak staining in the inner plexiform layer (IPL). In PBS- and VEGF-injected retina, CTGF staining was also present in the nuclear layers (INL and ONL) and the outer plexiform layer (OPL). Intense staining of CTGF was present in the GCL of VEGF-injected eyes. In PBS- and VEGF-injected retina, CYR61 immunostaining was also present in the INL at the border of the IPL. In PBS-injected eyes, staining of ganglion cells was moderately increased, whereas in VEGF-injected eyes staining was strongly increased. Uniform staining of the GCL and IPL was found for TIMP-1. RCL, rod and cones layer; RPE, retinal pigment epithelium.

Figure 7.

 

Immunohistochemical staining of TGF-β, laminin, and fibronectin in the rat retina. Immunohistochemical staining was performed on retinal sections of untreated, PBS-injected, and VEGF-injected rat eyes, at 48 hours after injection. Representative images are shown. Staining of TGF-β was found in microvessels of the INL, IPL, and GCL and was moderate or strong in the PBS- and VEGF-injected eyes. Intense uniform immunostaining of laminin (LAM) was found in retinal microvessels in all treatment groups. Immunostaining of fibronectin (FN1) was sporadic and selectively found in microvessels in the INL in untreated and PBS-injected eyes. In VEGF-injected eyes, vessels in the INL were more intensely and uniformly stained. Abbreviations as defined in Figure 6legend.

Figure 8.

 

Effect of VEGF on mRNA expression in cultured bovine retinal endothelial cells and pericytes. Relative mRNA expression at various time points after stimulation with VEGF in endothelial cells and pericytes is indicated. In endothelial cells, expression of collagen type IV (Col IV) and laminin B1 (LamB1) was below detection limit. Basal control levels have been set to 1. Data are expressed as the mean ± SD.

The authors thank Berrend Muller for technical assistance.