Total RNA and protein were extracted using the TRIzol protocol (Gibco-BRL, Grand Island, NY). Tissue was homogenized in TRIzol, mixed with chloroform, and centrifuged, and the aqueous and the nonaqueous phases were separated. The nonaqueous phase was subjected to dialysis to recover the proteins, whereas the aqueous phase containing the RNA was further purified (RNeasy Micro Kit; Qiagen, Valencia, CA). The amount of RNA isolated was quantitated spectrophotometrically, and the concentration was adjusted for subsequent reverse transcription with random primers (Superscript First-Strand Synthesis System; Invitrogen, Carlsbad, CA).
Real-time PCR was performed using primers designed based on the sequences of mouse Cp and Cp-GPI mRNA (GenBank NM_007752 for Cp and AK086999 and AK043248 for Cp-GPI). Anticipated product sizes were 157 bp and 158 bp for Cp and Cp-GPI, respectively. Primer sequences were TCCCTGGAACATACCAAACC (common forward primer), ATTTATTTCATTCAGCCAGACTTAG (reverse primer for Cp), and CCAGGTCATCCTGTAACTCTGA (reverse primer for Cp-GPI). To accurately quantitate the amount of Cp and Cp-GPI in the various samples and to account for variations that might have been introduced by variable efficiency of reverse transcription, the product of a housekeeping gene was also amplified from the same cDNA samples in separate reactions. The gene rps11 (Mus musculus, similar to 40S ribosomal protein S11; GenBank XM_193290) encoding for a ribosomal protein, was used for this purpose. Primer sequences used for rps11 amplification were CGTGACGAAGATGAAGATGC (forward) and GCACATTGAATCGCACAGTC (reverse). SYBR Green PCR amplification was performed at three cDNA dilutions (1 ng, 10 ng, 100 ng) for each run, with each dilution in triplicate. Reactions were run at least twice for each mouse strain, age group, tissue, and cDNA level (ABI Prism 7900HT Sequence Detection System [SDS]; Applied Biosystems, Foster City, CA), and results were analyzed (SDS 2.1 software; Applied Biosystems). Normalized relative concentrations of Cp mRNA in the various age groups were compared with analysis of variance (ANOVA) and post hoc Fisher LSD testing.