A Novel Antioxidant Function for the Tumor-Suppressor Gene p53 in the Retinal Ganglion Cell

Abstract

purpose. Recent evidence has suggested that the tumor-suppressor gene p53 has a role in regulating antioxidant response in cancer cells. This study was conducted to determine whether p53 regulates redox enzymes in a neuronal context in RGCs and whether this regulation contributes to an increased survival signal.

methods. The expression of p53, and its putative responsive antioxidant enzymes sestrin 2, catalase, Cu/ZnSOD, and MnSOD were evaluated in the developing rat retina by immunohistochemistry and Western blot. Small interfering (si)RNA to p53 was used in an RGC cell line, RGC-5, and downstream effects on antioxidants observed by Western blot. Transcription factor–analysis software was used to identify p53 binding sites on the catalase promoter, and chromatin immunoprecipitation (ChIP) assays on whole retina to demonstrate in vivo binding. The effect of p53 deficiency on basal reactive oxygen species levels (ROS) within the RGC and on susceptibility to oxidative-signaling–induced apoptosis was measured by flow cytometry.

results. Developmental expression patterns of p53 and catalase mirrored each other. p53 knockdown resulted in a significant decrease in catalase. p53-binding sites were identified on the rat catalase promoter and confirmed in vivo. p53 knockdown resulted in a corresponding increase in basal cellular ROS levels and increased susceptibility to oxidative-signaling–induced cell death.

conclusions. The results suggest a novel regulating influence of p53 on catalase in the retina—more specifically in the RGC—and an influence of p53 on the susceptibility of the cell to oxidative-signaling–induced apoptosis, which could implicate p53 as a potential neuroprotectant for the RGC.

The tumor-suppressor gene p53, which encodes the transcription factor of the same name, was initially identified in 1979, ^{1 2} and years of intense scrutiny have revealed that it has a plethora of functions regulating an ever-expanding number of target genes. ³ Most of the interest with regard to p53 centers on its role in preventing cancer, by recognizing genomic damage and responding by either effecting cell cycle arrest and establishing DNA repair or by causing apoptosis of the cell. Recent developments have suggested that a possible mechanism by which p53 prevents DNA damage and genomic mutations is by regulating redox-related genes and their gene products. ^{4 5 6} In the context of neuronal tissue, p53 has also been implicated in effecting neuronal death in neurodegenerative conditions, such as Alzheimer’s and Parkinson’s disease, ^{7 8 9} and in retinal ganglion cell (RGC) death in glaucoma. ^{10 11 12 13}  

Reactive oxygen species (ROS), such as hydrogen peroxide (H₂O₂), or superoxide anion (O₂ ⁻), among others, are partially reduced metabolites of molecular oxygen and are present in all aerobic cells. ¹⁴ Endogenous ROS are produced intracellularly as byproducts of normal aerobic metabolism, but can also be derived from exogenous sources, either directly from the extracellular milieu or from environmental sources, such as chemicals or UV radiation. To protect against potentially damaging effects of ROS, the cell possesses several essential redox-regulating enzymes, such as catalase, superoxide dismutase, and glutathione peroxidase. ROS normally exist in a physiological balance with these biochemical antioxidants, and oxidative stress is thought to occur when this critical balance is disrupted. Oxidative stress has been postulated as a mechanism involved in the precipitation of apoptosis of the RGC in glaucoma, the final common pathway of this potentially sight-threatening disease. ^{15 16}  

The retina is an organ that is highly susceptible to oxidative stress, not only by virtue of its high blood supply and oxygen-rich environment, but also because of its constant exposure to UV radiation in the atmosphere. ¹⁷ We investigated whether p53 has a dual role in a neuronal context, by exploring a putative antioxidant function in the retina and in particular the RGC. The result may implicate p53 as a neuroprotective mediator, in addition to its known function as a precipitator of apoptosis. Such a finding may also have implications for our understanding of molecular mechanisms promoting neuronal survival of the RGC in a physiological context. 

In brief, we examined the differential expression of p53 and redox-regulating enzymes in the developing retina by Western blot and immunohistochemistry, to establish a putative expressional link between the proteins. Using the RGC line RGC-5 and small interfering (si)RNA, we observed the downstream effect of p53 knockdown on redox enzyme expression. By means of genomic analysis, we sought to demonstrate p53-binding sites on the promoters of relevant antioxidants and to show in vivo binding of p53 to these promoters in the retina by chromatin immunoprecipitation (ChIP) assay. Finally, by flow cytometry, we observed the effect of p53 knockdown in the RGC-5 on basal ROS levels and susceptibility to oxidative-signaling–induced death. 

Materials and Methods

Animal Treatment

All experiments were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Sprague-Dawley (wild-type) rats were obtained from Harlan (Bicester, UK). 

Immunohistochemistry

Enucleated eyes from the rats were fixed in 10% neutral-buffered formalin for a minimum of 4 hours, followed by cryoprotection in 25% sucrose overnight at 4°C. After antigen retrieval in 10 mM sodium citrate buffer and quenching of endogenous peroxidase activity in 0.3% hydrogen peroxidase, frozen sections (7 μm) were incubated with primary antibody overnight at 4°C. The primary antibodies used were p53 (cat. no. 2524; Cell Signaling Technology-New England Biolabs, Hitchin, UK) and catalase (cat no. C0949; Sigma-Aldrich, Poole, UK). Washes in PBS with 0.01% Tween 20 were followed by incubation with secondary antibody, biotinylated anti-mouse IgG (cat. no. BA2000; Vector Laboratories, Peterborough, UK) for 1 hour at room temperature. Antibody detection was achieved with a stain kit and reagent (Vectastain Elite ABC Kit and DAB reagent; Vector Laboratories). Sections were counterstained with hematoxylin (BDH, Poole, UK), to facilitate tissue orientation, and mounted in DPX (BDH). 

Western Blot Analysis

Total protein from either RGC-5 cells or whole retina was obtained by lysing in RIPA buffer (50 mM Tris-HCl [pH 7.4], 1% NP40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, 1 mM sodium orthovanadate, and 1 mM sodium fluoride) containing antipain (1 μg/mL), aprotinin (1 μg/mL), chymostatin (1 μg/mL), leupeptin (0.1 μg/mL), pepstatin (1 μg/mL), and PMSF (0.1 mM). The total amount of protein in each sample was determined by a protein assay (Bio-Rad, Hemel Hempstead, UK) with bovine serum albumin used as the standard. Between 30 and 40 μg of total protein was electrophoresed on polyacrylamide gels followed by transfer to nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany) and incubated overnight at 4°C with the appropriate antibodies. Membrane development was achieved with enhanced chemiluminescence (ECL; GE Healthcare; Buckinghamshire, UK). 

Cell Culture

The RGC-5 cell line is a rat RGC line transformed by adenovirus carrying early region 1A (E1A). The cell line has many similarities to normal RGCs, including Thy-1 and Brn-3c expression and sensitivity to glutamate neurotoxicity or neurotrophin withdrawal. ¹⁸ The RGC-5s were cultured in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich) supplemented with 10% fetal calf serum and 1% penicillin-streptomycin (Sigma-Aldrich). The cells were incubated at 37°C in humidified 5% CO₂. 

p53 siRNA in RGC-5 Cells

Predesigned rat-specific siRNA to p53 (J-080060-05) was obtained from Dharmacon (now ThermoFisher Scientific, Waltham, MA), and a negative control siRNA, (cat. no. 1027281; Qiagen, Crawley, UK) was also used. Briefly, RGC-5 cells were seeded in six-well plates, and the following day, the cells were transfected (cat. no. 301607; RNAiFect reagent; Qiagen) according to the manufacturer’s instructions. The cells were washed twice with PBS, and fresh medium was instilled after 24 hours. A time course for optimal knockdown of p53 at the protein level was determined by Western blot analysis. For Western blot analysis, total protein lysates from each siRNA experiment were electrophoresed on polyacrylamide gels followed by transfer to nitrocellulose membrane (Schleicher and Schuell, Dassel, Germany) and incubated overnight at 4°C with the appropriate antibodies: p53 (cat. no. 2524; Cell Signaling Technology), Cu/Zn SOD (superoxide dismutase 1; cat. no. SOD101; Stressgen, York, UK), MnSOD (superoxide dismutase 2; cat. no. MAB3419 R&D Systems, Minneapolis, MN), sestrin 2 (cat. no. 10795-1-AP; PTG Laboratory, Chicago, IL), catalase (cat. no. C0949; Sigma-Aldrich), and actin (cat. no. 5441; Sigma-Aldrich). 

Identification of the Rat Catalase Promoter Regions

Rat catalase promoter regions were identified by means of a genome browser (http://www.genome.ucsc.edu/ provided in the public domain by the University of California at Santa Cruz). Putative p53 binding sites on each promoter were then located (MatInspector ver. 2.2, incorporating Transfac; Genomatrix, Munich, Germany). Binding sites with core similarity values of below 0.9 were disregarded for subsequent experiments. 

Chromatin Immunoprecipitation Assays

Chromatin immunoprecipitation (ChIP) assays were performed on retinal tissue isolated from Sprague-Dawley rats by use of a immunoprecipitation kit used according to the manufacturer’s instructions (EpiQuik Tissue; EpigenTek, Brooklyn, NY). Briefly, retinal tissue was formaldehyde fixed, and in vivo cross-linked, followed by tissue disaggregation. The cells were then lysed, and the DNA sheared by sonication. Isolated DNA was incubated with the relevant controls: normal IgG in the absence of primary antibody as the negative control and genomic and input chromatin as positive controls. The p53 antibody used for this assay was 1C12 (2524; Cell Signaling Technology). Isolated chromatin sample (1 μL) was then subjected to PCR with promoter specific primers incorporating the p53 sites: P53 catalase forward 5′- GAAGGAACACCCATTCAGAGCC; P53 catalase reverse 5′- TTGTCTAATTGGGTGGCTGTAGA. 

Analysis of Intracellular ROS Generation

Cells were loaded with 10 μM H₂DCFDA (2′,7′-dichlorodihydrofluoroscein diacetate; Invitrogen-Molecular Probes Inc., Leiden, The Netherlands) for 15 minutes at room temperature, before analysis on a flow cytometer (FACScan; BD Biosciences, Oxford, UK). ROS production was measured at FL-1 (530 nm) with excitation at 488 nm. The cytometer system software (CellQuest; BD Biosciences) was used for data analysis, and 10,000 events/sample were acquired. 

Cell Death Measurements: PI Uptake and Annexin V Staining in a Cell Viability Assay

Double staining with fluorescein isothiocyanate (FITC)–conjugated annexin V and propidium iodide (PI; Sigma-Aldrich) was performed for quantification of apoptosis in p53-deficient RGC-5 cells. The cells were harvested, washed once with ice-cold PBS, and resuspended in 100 μL of calcium-binding buffer (10 mM HEPES [pH 7.4], 140 mM NaCl, and 2.5 mM CaCl₂) containing 1:10 annexin V-FITC solution (IQ Products, Groningen, The Netherlands). After a 10-minute incubation in the dark at room temperature, the cells were diluted with 300 μL of binding buffer and PI was added to a final concentration 50 μg/μL immediately before cytometric analysis. The samples were analyzed by flow cytometry and the data recorded (FACScan with CellQuest software; BD Biosciences). A total of 10,000 events/sample were acquired. 

Cell viability was assessed by fluorometric assay, on cells seeded in a 96-well plate, (CellTiter-Blue assay; Promega, Madison, WI) and read on a multiplate reader (FlexStation II; Molecular Devices, Sunnyvale, CA). Excitation and emission wavelengths of 560 and 590 nm, respectively, were used. 

Statistical Analysis

Experiments were repeated at least three times. Data are presented as the mean ± SD. One-way analysis of variance (ANOVA) and the Tukey multiple comparison post hoc test was used when more than two variables were involved. In the case of two sample comparisons, a Student’s t-test assuming unequal variance was used. P < 0.05 was considered statistically significant. 

Results

Establishing a Putative Link between p53 and the Expression of Redox-Regulating Enzymes in the Developing Rat Retina

Since the RGC-5 cell line used in this work is a rat cell line, we chose to examine a putative link in whole rat retina between p53 and redox enzymes by Western blot. We found p53 to be differentially downregulated between postnatal day 5 (P5) and (P60). Redox regulating enzymes examined included catalase, sestrin 2, CuSOD, and MnSOD, and, of these, catalase and sestrin 2 appeared to show a similar pattern of expression during development, which corresponded to p53 (Fig. 1A) . To explore further the patterns of expression throughout the retina, we looked by immunohistochemistry at whether catalase and p53 had similar distribution patterns throughout the retina during development. We found that p53 appeared to be distributed throughout all layers of the retina, but most relevantly was markedly expressed in the cell bodies of the ganglion cell layer (Fig. 1B) . Catalase appeared to follow a similar pattern. Furthermore, both p53 and catalase appeared to be downregulated throughout each layer during development. 

p53 Knockdown in RGC-5 Effects Antioxidant Expression

To establish a concrete connection between p53 and redox enzymes, we transfected RGC-5 cells with siRNA specific to p53 and determined whether there was an ensuing reduction in antioxidant enzymes levels. We achieved downregulation of p53 as monitored by Western blot analysis, with a maximum knockdown at 72 hours of approximately 75% (Figs. 2A 2B) . When we examined redox enzymes at the protein level, we found that there was a corresponding decrease in levels of catalase (70%; Figs. 2A 2B ). Interestingly, we did not observe a corresponding reduction in any other redox enzymes examined, including sestrin 2, Cu/ZnSOD, and MnSOD (Fig. 2A) . 

Identification of the p53 Binding Sites on the Rat Catalase 5′ Regulatory and Promoter Regions

We sought to identify and examine the rat catalase promoters to gain further insight into the possibility that in the retina they may be under a p53-dependent regulatory transcriptional mechanism. Using a rat genome browser (http://www.genome.ucsc.edu/) we were able to identify up to 5 kb upstream of the putative transcriptional start site of the relevant genes. 

Computer analysis of the nucleotide sequences from these fragments using promoter retrieval/analysis software (Promoter-Inspector; Genomatrix) predicted core promoter regions (737 bp in catalase) relative to the transcription start site (TSS; Fig. 3A ). Furthermore, another program (MatInspector ver, 2.2; Genomatrix, incorporating Transfac) was used to search for putative p53 transcription factor–binding sites in these identified regulatory nucleotide sequences. Numerous full and half p53 sites were identified in the promoter (Fig. 3A) . 

Putative p53-Binding Sites on Rat Catalase Promoters Are Occupied In Vivo

If p53 directly regulates the expression of catalase in the rat retina, then it should physically associate with the relevant promoters in vivo. To confirm this, we performed a ChIP assay with a specific primer flanking the putative p53 binding site in the rat catalase promoter (see the Materials and Methods section) using retinal tissue extracted from a Sprague-Dawley rat. Genomic DNA was used as a positive control for the PCR reaction. Normal IgG was included as a negative control and, furthermore, a negative control sample of the ChIP assay performed without the p53 antibody was also included. Input samples were taken from the total chromatin extract before incubation with the p53 antibody. After isolation of chromatin samples and the completion of PCR with promoter-specific primers, an identified p53 binding site was found on rat catalase in vivo (Fig. 3B) . Therefore, we propose that rat catalase is a bona fide in vivo direct target of p53. 

Result of p53 Deficiency in the RGC-5 Cell

ROS levels were examined by flow cytometry using the fluorescent probe H₂DCFDA (see the Materials and Methods section). Counts of fluorescence levels were compared between cells treated with negative control siRNA compared with siRNA specific to p53. Note the shift to the right in p53-deficient cells (Fig. 4A) . Results of four individual experiments are presented in Figure 4B , showing mean fluorescence intensity of the cells, with significant results (*P < 0.05 by Student’s t-test). 

Susceptibility of p53-Deficient Cells to Oxidative-Signaling–Induced Cell Death

Susceptibility to oxidative-signaling–induced death was measured by a viability assay (see the Materials and Methods section) and by flow cytometry using annexin V and propidium iodide. P53-deficient cells and negative control siRNA-transfected cells were treated with 600 micromoles H₂O₂ for 24 hours. Comparison in susceptibility to death was first measured by a viability assay (Fig. 5A) . p53-deficient cells showed approximately 15% less viability after hydrogen peroxide treatment. By flow cytometry, we demonstrated an increased susceptibility of p53-deficient cells to H₂O₂-induced cell death. Figure 5Brepresents the difference in response. The bottom right quadrant shows early apoptotic cells, whereas the top right represents late apoptotic and necrotic cells. A graph of the sum of the top and bottom right quadrants of four individual samples is shown in Figure 5C . Results were statistically significant (P < 0.05 by Student’s t-test). 

Discussion

In this study, we demonstrated a link between the tumor-suppressor gene p53 and the redox-regulating enzyme catalase in the retina and in particular the RGC. Furthermore, this link appears to be functional in an in vitro model of the RGC, in that removal of this “guardian of the genome” appears to make the cell more vulnerable to oxidative-signaling–induced death. Other studies have suggested that catalase expression has a critical role in protecting the RGC from excess reactive oxygen species, ¹⁹ and so our results may demonstrate the importance of p53 as a potential neuroprotectant for the RGC. 

Recent work by Sablina et al. ⁴ deduced that under normal or low cellular stress, low concentrations of p53 induce the expression of antioxidant genes, whereas in severe cellular stress, high concentrations of p53 promote the expression of genes that contribute to ROS formation and p53-mediated apoptosis. Thus, under normal low stress conditions, p53 appears to have an antioxidant role that protects cells from oxidative DNA damage, and although this effect may depend on the concentration of p53, other cellular factors are likely to participate in the final fate of a cell. It is probable that other factors dictate the relative proapoptotic and antiapoptotic functions of p53, such as the cellular p53 concentration, p53 subcellular localization or phosphorylation status. ⁶ Sablina et al. ⁴ worked in the context of cancer cell biology, and in a similar manner more recently, Ding et al. ⁵ backed up their postulations by demonstrating a regulating effect of p53 on redox regulating enzymes, and on susceptibility of cervical cancer cell lines to oxidative-stress–induced damage. 

Previous links have been established in various systems between p53 and antioxidant enzymes. The GPX1 gene, which encodes glutathione peroxidase-1, and the aldehyde dehydrogenase (ALDH4) gene, which encodes another antioxidant enzyme, have both been characterized as direct p53 target genes. ^{20 21} Furthermore, inactivation of ALDH4 enhances p53-dependent apoptosis, and its forced expression results in a reduction in intracellular ROS. ²¹ The SOD2 gene, which encodes the mitochondrial MnSOD enzyme, has been found to be either up- or downregulated by p53, depending on the context. ^{22 23 24} p53 has also been shown to be involved in the regulation of the mammalian sestrin homologues sestrin 1 and 2, encoded by the genes SESN1 and SESN2, respectively, which are involved in regeneration of overoxidized peroxiredoxins. ²⁵  

We evaluated a putative link between p53 and antioxidants in the retina, first by looking at these agents in the whole retina during development. As was expected, p53 was found to have markedly lower levels of expression in the mature, postnatal day (P)60 Sprague-Dawley rat retina when compared with P5. We examined several antioxidants, including catalase and sestrin 2, and found them to follow a pattern similar to that of p53, suggesting a possible link between the two in the retina. This notion was reinforced by a similar pattern of distribution of both p53 and catalase throughout the retina and in particular in cell bodies of the RGC layer, as illustrated by immunohistochemistry (Fig. 1) . Furthermore, genomic analysis of the catalase promoter demonstrated the presence of putative p53-binding sites, and we also showed that the first p53 binding site was occupied in vivo. Previous work has looked at comparative expression of p53 in different tissues of the eye, showing relatively lower expression in the retina than in other tissue subtypes (most notably, cornea). ²⁶ Corneal epithelial cells, the principle cell type in cornea that expresses p53, are rapidly cycling cells with a high rate of turnover, which may explain the presence of p53. However, we have demonstrated in normal mature retinal tissue that p53 is expressed in the RGC, which is a postmitotic neuronal cell that would not normally be expected to express p53. This promotes the hypothesis that p53 could be performing a protective function of regulating redox enzymes in the RGC while in its physiological or unstressed state. 

Using the RGC-5 cell line, a RGC line recently developed that has properties similar to the cell itself, ¹⁸ we demonstrated a downstream effect of p53 knockdown on the expression of the essential cellular antioxidant catalase. We went on to show that this effect appeared to be functional, in that basal levels of ROS in the cell, and susceptibility of the cell to oxidative stress/signaling appeared to be increased. Previous work in cancer cell lines and in a cancer context showed that the regulation of antioxidant expression by p53 was functional, in that rates of cancer development in p53 null mice supplemented with the antioxidant N-acetylcysteine was similar to that in the wild-type mouse, suggesting an antioxidant function of p53. ⁴ Ding et al. ⁵ demonstrated a regulating effect of p53 on antioxidants showing an increased susceptibility of cervical cancer cell lines to oxidative-stress–induced damage, whereas p53 expression was experimentally decreased. In the context of these two studies, our work is interesting, in that it shows a link between p53 and redox enzymes for the first time in neuronal tissue. In addition, we demonstrated a link between p53 and catalase, which has not previously been shown. It is notable that various studies have shown different responsiveness of various redox genes to p53. This could be explained by the different cell or tissue types involved, as well as the fact that some data were obtained in a cancer context, in which the cell, and indeed p53 itself, could reasonably be expected to behave differently. 

We appear to have shown this novel link between p53 and redox enzymes in neuronal tissue, and more specifically in the RGC. We have also demonstrated that the lack of basal p53 expression makes the RGC more vulnerable to intracellular ROS, and to oxidative-signaling–induced death. It appears that the relationship between p53 and ROS is quite complex, in that it has been shown to be a promoter of the accumulation of ROS in the cell, ^{27 28} and indeed there is little doubt that much work is to be done to elucidate further the antioxidant properties of p53. However, our findings could ultimately have implications for our understanding of the molecular mechanisms promoting survival in this essential cell type, and while the methods used in our study did not include a glaucoma model, such an exercise could be critical for exploring whether p53 also has such a role in the pathologic context of glaucoma. 

 Supported by the Science Foundation of Ireland (DMW) and the Irish College of Ophthalmology Annual Research grant 2006/2007, sponsored by Pfizer Pharmaceuticals, Ireland (JCO).

 Submitted for publication March 2, 2008; revised April 15, 2008; accepted July 21, 2008.

 Disclosure: J.C. O'Connor, None; D.M. Wallace, None; C.J. O'Brien, None; T.G. Cotter, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Figure 1.

 

Differential expression of some antioxidant enzymes in rat retina correlated with p53. Differential developmental expression patterns in the rat retina of p53 and various antioxidant enzymes were analyzed by Western blot (A) and immunohistochemistry (B) in rat retinal sections. Catalase (Bb, Be) and sestrin 2 (Bc, Bf) mirrored p53 (Ba, Bd) levels at P5 and P60. The pattern of distribution of p53 and catalase throughout the retina was similar in both. Of particular note, p53 and catalase surprisingly appeared to be expressed in the ganglion cell layer (GCL) at P60 (Bd, Be), suggesting a possible functional role in this cell type in the mature retina.

Figure 2.

 

Effect of p53 knockdown on antioxidant expression in the RGC-5 cell line. RGC-5 cells were treated with specific siRNA to knockdown the expression of p53. Downstream effects on antioxidant enzymes were assessed. (A) Representative Western blot analysis of the effect of p53 knockdown, with a corresponding decrease in catalase. The representative band of the doublet for Sestrin 2 is the lower band. (B) Comparison of band density of three independent experiments by densitometry. Differences were statistically significant. *P < 0.05 by ANOVA.

Figure 3.

 

Rat catalase promoters contain p53 binding sites. Identified p53 binding sites on rat catalase are occupied in vivo. The rat catalase promoter region was identified by means of a genome browser and putative p53 binding sites were located (MatInspector, ver. 2.2; Genomatrix, Munich, Germany). As can be seen in (A), the promoter contains putative p53 binding sites. Core promoter regions were mapped as were transcriptional start sites (TSS) and intron–exon boundaries. (B) Rat retinal tissue was formaldehyde fixed and immunoprecipitated with an antibody specific to p53 and isolated DNA was analyzed by using primers flanking regions incorporating identified p53 binding sites in the rat catalase promoter. +ve, genomic DNA used as a positive control for PCR reaction; (−ve) normal IgG included as a negative control; −1°ab negative control sample of the ChIP assays performed without the p53 antibody; +1°ab, ChIP assay performed in the presence of an antibody specific to p53 and promoter-specific-primers incorporating the p53 putative binding sites; Input, sample taken from the total chromatin extract before incubation with the p53 antibody. All chromatin samples were subjected to PCR using the promoter-specific primers incorporating the p53 putative binding sites on the relevant promoters. We found the first identified p53 binding site to be occupied in vivo.

Figure 4.

 

p53 knockdown increased basal levels of reactive oxygen species in RGC-5 cells. Basal levels of reactive oxygen species were measured in p53-deficient cells compared with negative control by flow cytometry using the fluorescent probe H₂DCFDA. (A) A shift to the right can be seen in fluorescence intensity signal for p53-deficient cells. (B) Mean fluorescence intensity levels of cells from six independent experiments. Results are statistically significant (P < 0.05 Student’s t-test).

Figure 5.

 

p53 knockdown increased the susceptibility of RGC-5 cells to oxidative stress-induced death. Effect of p53 deficiency on susceptibility to H₂O₂-induced cell death. P53-deficient cells were compared to the negative control by a cell viability assay and by flow cytometry, using annexin V and propidium iodide as markers. (A) Mean viability of p53-deficient cells from eight different samples were 15% lower than the negative control (P < 0.05 Student’s t-test). (B, C) p53-deficient cells were more susceptible to death. (B) Note the increase in proportion of cells in the bottom right (early apoptotic) and top right (late apoptotic and necrotic) quadrants. (C) Similar statistically significant results were obtained in six individual experiments (P < 0.05 Student’s t-test).

 

The authors thank Neeraj Agarwal (North Texas Health Science Center, Fort Worth, TX) for the kind gift of RGC-5 cells, Declan McKernan for assistance with animal work, and members of the laboratory for useful discussions along the way.