Identification of the IRXB Gene Cluster as Candidate Genes in Severe Dysgenesis of the Ocular Anterior Segment

Abstract

Purpose.: Anterior segment ocular dysgenesis (ASOD) is a broad heterogeneous group of diseases detectable at the clinical and molecular level. In a patient with bilateral congenital ASOD including aniridia and aphakia, a complex chromosomal rearrangement, inv(2)(p22.3q12.1)t(2;16)(q12.1;q12.2), was characterized at the molecular level, to identify candidate genes implicated in ASOD.

Methods.: After negative sequencing of the PAX6, FOXC1, and PITX2 genes, we used fluorescence in situ hybridization (FISH) and Southern blot analysis to characterize the chromosomal breakpoints. Candidate genes were selected, and in situ tissue expression analysis was performed on human fetuses and embryos.

Results.: Molecular analyses showed that the 16q12.2 breakpoint in this rearrangement occurs in a 625-bp region centromeric to the IRX3 gene, which belongs to the IRXB cluster. In situ hybridization expression studies showed that during early human embryonic development, the IRX3 gene is expressed in the anterior segment of the eye. Of interest, it has been shown previously that a highly conserved noncoding region (HCNCR) is located 300 kb centromeric to the IRX3 gene and induces, in a murine transgenic assay, an expression pattern fitting that of the IRX3 gene.

Conclusions.: The authors propose that the 16q12.2 breakpoint of this complex translocation is causally related to the ocular anterior segment dysgenesis observed in this patient. This translocation is assumed to separate the HCNCR from the IRXB cluster genes, thus deregulating the IRXB cluster and leading to the ASOD observed by a positional effect.

Broad genetic variability underlies disorders of the anterior segment of the eye, collectively termed anterior segment ocular dysgenesis (ASOD). PAX6, a major gene for all stages of eye development, has been found to be mutated in phenotypically variable cases of ASOD. ^1–5 In addition, other transcription factors are crucial for the coordinated development of the cornea, iris, lens, and ciliary bodies, including members of the forkhead (FOX), PITX, and MAF families. 

Several studies have shown that patients with Rieger anomaly, Peters' anomaly or iris hypoplasia, which are dominant disorders, have mutations in FOXC1 and PITX2, ^6–10 whereas mutations in PITX3 can cause anterior segment mesenchymal dysgenesis. ^11–13 FOXE3, with an evolutionarily conserved role in induction of the lens placode, is mutated in patients with aphakia and in patients presenting with ASOD clinical features. ^14–17 MAF has been implicated in congenital cataract. ^18–20 The number of identified genes implicated in anterior segment development is increasing, reflecting wide phenotypic as well as genetic heterogeneity. It is likely that these transcription factors regulate each other's bioavailability in both space and time. 

The Iroquois family genes (IRX) encode homeoproteins, conserved throughout the animal kingdom, that are involved in tissue patterning and regional differentiation. Various knockdown experiments and the endogenous expression patterns in vertebrate embryo models have demonstrated the implication, particularly of IRX3 and IRX5, in ocular morphogenesis. ^21–23 The six mammalian IRX genes are organized in two clusters (IRXA and IRXB) located on different chromosomes. IRXA and IRXB undoubtedly underwent duplication over the course of evolution. ^21,24–27 In humans, IRX1, IRX2, and IRX4 of the IRXA complex are located on 5p15.3, whereas IRX3, IRX5, and IRX6 of the IRXB cluster are localized on 16q12.2. Thus far and despite their involvement in the development of several organ systems, ^21,28–39 none of these IRX genes has been implicated in human disease. 

We describe herein a child with bilateral congenital dysgenesis of the anterior segment of the eye, including aphakia and aniridia, associated with a complex chromosomal abnormality: inv(2)(p22.3q12.1)t(2;16)(q12.1;q12.2). The translocation breakpoint lies near the IRX3 gene. Moreover, we show that IRX3 is expressed in the eye anterior segment during early human embryonic development. We propose that this translocation deregulates by a positional effect the expression of an IRXB cluster gene(s), leading to the anterior segment dysgenesis observed in this patient. 

Material and Methods

Case Report

The propositus was born of nonconsanguineous parents after a normal pregnancy with no history of intrauterine infection or exposure to teratogenic agents, and delivery at term was uncomplicated. At birth, bilateral megalocornea, photophobia, and tearing were noticed. A detailed ophthalmic examination performed with the subject under anesthesia at the age of 3 months showed bilateral corneal opacification with epithelial edema, corneal central thinning, retrodescemetic pigmentation, aniridia, secondary glaucoma, and vascularization of the cornea. IOP was 18 mm Hg in the right eye and 10 mm Hg in the left one. No lens was found. The posterior segment of the eyes were normal. On ultrasound examination (20 MHz), neither the lenses nor the irises were observable. No other malformation was detected. The clinical features in our patient did not seem to fit a particular category. We conclude that these anomalies are compatible with a dysgenesis of the anterior segment of the eye with secondary glaucoma. Only the proband's mother was examined. She had normal vision and no abnormality was found. No ocular abnormalities of the father were reported. 

All analyses performed in this study were made after the parents' informed consent was obtained. The protocol of the study was in compliance with the guidelines in the Declaration of Helsinki. 

Classic and Molecular Cytogenetic Techniques

Metaphase chromosome spreads of the patient and his parents were prepared from peripheral blood lymphocytes and analyzed by using classic banding techniques. An EBV-transformed lymphoblast cell line of the patient was established for chromosome, DNA, and RNA preparations. 

BAC and PAC clones were selected from the UCSC Human Genome Browser (http://genome.ucsc.edu/ provided in the public domain by UCSC Genome Bioinformatics, University of California at Santa Cruz). They were obtained from the French national sequencing center. BAC DNAs were extracted by using a classic phenol-chloroform method and labeled using standard nick translation incorporating FITC, cyanine (Cy)3.5, Cy3, biotin-16-dUTP, and digoxigenin-11-dUTP (Roche Diagnostics, Mannheim, Germany). Biotin- and digoxigenin-labeled probes were subsequently revealed with streptavidin or an anti-digoxigenin antibody coupled to Cy5 and Cy5.5. Fluorescence in situ hybridization was performed as described previously. ⁴⁰  

To look for a deletion at the translocation breakpoints, we used BAC array slides (PerkinElmer, Courtaboeuf, France), which offer a resolution of 0.65 Mb, in CGH array experiments. Hybridization was performed as described previously. ⁴¹  

Southern Blot Analysis

For molecular cloning, Southern blot analysis was performed us usual, with the use of different probes located around the IRX3 locus. In particular, probe H, which allowed us to localize the rearrangement, was built by PCR with the following primer set: forward (5′ TTG TGA GGC GTG AGC TGT T 3′) and reverse (5′ TCT TTT TCC TCT CGC AGT CA 3′). Probe H hybridizes to nucleotides 79118-79880 of clone RP11-1146I14 (GenBank accession number AQ776753; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) localized at 16q12.2. 

Expression Analysis

Cytoplasmic RNAs of lymphoblast cell lines from the patient and 15 control individuals were isolated (RNeasy Mini Kit; Qiagen, Courtaboeuf, France) and reverse transcribed (Superscript II reverse transcriptase; Invitrogen, Cergy Pontoise, France) and random primers from 200 ng of each RNA. Real-time quantitative RT-PCR analyses of IRX3 and IRX5 transcripts were performed with predesigned and optimized gene expression assays (TaqMan; Applied Biosystems, Inc. [ABI], Foster City, CA) on a real-time PCR system (model 7500; ABI) according to the manufacturer's instructions. Relative quantification was performed by the ^ΔΔCT method, with the Abelson transcript used as an endogenous control. 

Sequencing

Direct sequencing of the coding regions of genes PITX2a, PITX2b, PAX6, and FOXC1 in both forward and reverse directions was performed. 

In Situ Tissue Expression Pattern

IRX3 expression was examined in situ in human embryos and fetuses with normal karyotypes between 29 days' and 14.5 weeks' development, obtained from terminated pregnancies in concordance with French legislation (Acts 94-654 and 08-400) and with oversight by the Necker hospital ethics committee. Primers were selected for PCR amplification of a fragment of IRX3 cDNA. A T7 promoter sequence extension (TAATACGACTCACTATAGGGAGA) was added to the 5′ end of each primer (forward [F]: agcgatggctggggctcactcg; reverse [R]: TGGCCGCGCCGTCTAAGTTCTC), and RNA was synthesized in vitro with F and T7R for antisense and T7F and R for sense probes, using ³⁵S- or digoxigenin-labeled UTP. Tissue fixation and sectioning and in situ hybridization were performed according to standard protocols. ⁴²  

Results

Classic banding techniques of the patient's chromosomes showed an apparently balanced rearrangement between chromosomes 2 and 16 (Figs. 1A, 1B). Parental karyotypes were normal. Thus, the chromosomal rearrangement occurred de novo. FISH experiments, with the WCP2 and WCP16 centromeric probes of chromosomes 2 and 16 and the 16p/16q and 2p/2q subtelomeric probes, showed two normal chromosomes 2 and 16 and two derivatives of chromosomes 2 and 16, confirming a translocation between the long arm of chromosome 16 and the long arm of chromosome 2 (Fig. 1C). However, the long arm of the der(2) chromosome was shorter than expected. We hypothesized that in addition to the translocation, a chromosome 2 inversion may be present. We interpreted the karyotype as: 46, XY, inv(2)(p22.3q12.1)t(2;16)(q12.1;q12.2). CGH array experiments with a resolution of 1 Mb demonstrated that no microscopic rearrangements greater than 1 Mb were present at the chromosomal breakpoint. 

Figure 1.

 

Cytogenetic and molecular characterization of the inv(2) (p22.3q12.1)t(2;16)(q12.1;q12.2) complex translocation. (A, B) Partial karyotype (A) and ideogram (B) with G-banding technique showing respectively the normal and derivative chromosomes 2 and 16. Arrow: the chromosomal breakpoint localization. (C) FISH results using the 2p subtelomeric probe RP5-892G20, the 16p subtelomeric probe CTB-191K2, chromosome 2 and 16 centromeric probes pBS4D and pZ16.A, respectively, labeled with biotin/Cy5 (white), digoxigenin/Cy5.5 (yellow), FITC (purple), and rhodamine (pink). Whole chromosome painting of chromosomes 2 (red) and 16 (green) showing the translocation between chromosome 2 and 16 and an unexpected aspect of der(2) leading to a supplementary investigation as shown in (D). (D) FISH results using clones spanning the three breakpoints: RP11-68N21 (labeled with FITC; green) at 2p22.3, RP11-315P20 (labeled with rhodamine; red) at 2q12.1, and RP11-1061C23 (labeled with Cy3.5; blue) at 16q12.2. 2p (RP5-892G20) and 16p (CTB-191K2) subtelomeric probes respectively labeled with biotin (yellow) and digoxigenin (white) were used for chromosome identification. Cohybridization of red and blue signals on der(16) confirms the t(2;16); cohybridization of red and green signals on der(2) demonstrate the pericentric inversion of chromosome 2.

Direct sequencing of currently known genes involved in human diseases of the anterior segment of the eye showed that PITX2 (isoforms a and b), PAX6, and FOXC1 were not mutated. Considering these results, we decided to clone the chromosomal breakpoints by FISH. For this purpose, we selected a panel of 2p22.3, 2q12.1, and 16q12.2 BAC clones as probes for FISH experiments. RP11-68N21 generated three signals, one at 2p22.3 on the nonrearranged chromosome 2 and two on the inverted chromosome 2, respectively, at 2p22.3 and 2q12.1, attesting that this BAC spanned the locus involved in the chromosome 2 inversion. RP11-315P20 also generated three signals, one at 2q12.1 on the nonrearranged chromosome 2, one at 2p22.3 on the rearranged chromosome 2, and one at 16q12.2 on the derivative chromosome (der)16. This finding suggested that the 2q inversion locus and the translocation locus were identical and localized within the BAC 315P20 at 2q12.1. Finally, we found that RP11-1061C23, localized at 16q12.2, also gave three signals: one clearly localized on the nonrearranged chromosome 16, one on the der(16) chromosome, and one on the long arm of the der(2) chromosome, attesting that this BAC was hybridizing at the chromosome 16 breakpoint. Cohybridization of these three BACS showed colocalization of the BACs RP11-68N21 and RP11-315P20 at 2p22.3, BACs RP11-68N21 and RP11-1061C23 at 2q12.1, and BACs RP11-315P20 and RP11-1061C23 at 16q12.2 (Fig. 1D). These findings confirmed the complex chromosomal rearrangement. According to the UCSC database (http://genome.ucsc.edu; NCBI human genome build 36.1), the clones spanning the inversion breakpoints 2p22.3 and 2q12.1 are free of known genes or ESTs. However, RP11-1061C23, which overlaps the 16q12.2 breakpoint, contains the IRX3 gene, which belongs to the IRXB cluster. 

To better localize the chromosome 16 breakpoint, we performed Southern blot analysis with probes surrounding the IRX3 locus. As shown in Figure 2, one of these probes, probe H, allowed us to map the breakpoint located approximately 2 kb from the IRX3 3′UTR within a 625-bp region. Unfortunately, we were not able to clone the breakpoint at a better resolution by using inverse PCR. UCSC database analysis of this region showed a 331-bp Alu sequence and no conserved noncoding element. 

Figure 2.

 

Mapping of the translocation breakpoint by Southern blot. Genomic DNA of our patient (P) compared with control DNA (C), after digestion with restriction enzymes. Additional bands (arrows) were detected in the P sample for both BamHI and EcoRI but not for HindIII. Arrowhead: the breakpoint localization approximately 2 kb from the IRX3 3′UTR between the BamHI and HindIII sites in a 625-bp region.

Because the evolutionarily conserved Irx genes are involved in eye development in many animals, from fruit flies to mice, we performed in situ hybridization with probes against IRX3 in human embryonic sections at Carnegie stage (C)13 (29–31 days after fertilization, dpf), C15 (35-38 dpf), and C19 (48-51 dpf) and on fetal sections at 9.5 and 14.5 weeks after fertilization (wpf). IRX3 is expressed (Fig. 3) in the central nervous system, particularly the midbrain, limb mesenchyme, and the esophageal and tracheal mesenchyme. From C15 on, IRX3 was expressed in facial mesenchyme involved in eye formation, in particular anterior segment development. At C19, IRX3 was expressed in the facial ectoderm of the eyelid. In addition, IRX3 transcripts could be observed in the mesenchyme of the gut as well as in the developing limb bud, in particular in the perichondrium. At 9.5 wpf, IRX3 was clearly expressed again in the eyelid epidermis, in the cornea, in the ciliary margin and weakly in the retina. Finally, at 14.5 wpf, we found IRX3 expression in the ciliary margin, lens, cornea, and the neural retina itself. IRX3 is therefore clearly expressed in regions involved in the embryologic development of the anterior segment of the eye. 

Figure 3.

 

In situ hybridization to probes against IRX3 in human embryonic and fetal sections. (A) Embryo at C13 (29–31 dpf), hematoxylin-eosin (HE) stain. Sagittal section in the head, transverse in the body. (B) Adjacent section shows signal with antisense probe to IRX3 transcripts (white), in dorsal cephalic mesenchyme, brain, lateral mesoderm, and the neural tube. (C) Negative control using sense IRX3 probe. (D) Sagittal section (transverse caudally) of embryo at C15 (35–38 dpf), HE stain. Arrows: esophagus (left); and trachea (right). (E) Adjacent section with antisense probe signal in the central nervous system except the prosencephalon, lateral mesoderm, tongue, and (arrows) esophageal and tracheal mesenchyme. (F) Lateral parasagittal section from the same embryo with limbs and developing inner ear structures. (G) IRX3 is expressed in the midbrain, proximal forelimb and outer hindlimb mesenchyme, and strongly in the facial mesenchyme surrounding the nonexpressing optic evagination from the forebrain. (H) Sagittal section through the face and distal forelimb of a C19 (48–51 dpf) embryo, HE stain. (I) Adjacent section showing intense IRX3 expression in the midbrain and facial ectoderm—in particular, of the eyelids and lower ocular mesenchyme—and more discrete expression in the retina, the temporal bone surrounding the inner ear, and the perichondria of the digits. (J) Coronal section through eyes of fetus at 9.5 wpf, HE stain. (K) Adjacent section with IRX3 transcripts in retina, cornea, eyelid epidermis, and ciliary margin. (L) Sagittal section through eye of fetus at 14.5 wpf, HE stain. (M) IRX3 antisense probe shows signal in ciliary margin, lens, neural retina, and diffusely in the cornea. (N) Compared with sense probe negative control hybridization to this adjacent section, the sclera does not express IRX3 at this stage. cm, ciliary margin; co, cornea; el, eyelid; fl, forelimb; g, gut; h, heart; hl, hindlimb; lm, lateral mesoderm; lv, liver; mes, mesencephalon; nt, neural tube; opt, optic evagination; ot, otic vesicle; ph, pharynx; pros, prosencephalon; ret, retina; rh, rhombencephalon; sc, spinal cord; scl, sclera; t, tongue; tb, temporal bone. Scale bar, 1 mm.

These results prompted us to use quantitative RT-PCR to evaluate IRX3 and IRX5 expression in peripheral blood lymphocytes of our patient versus that in 15 unaffected control blood samples. We did not find any difference in IRX3 or IRX5 expression between our patient and the 15 control samples. IRX3 does not appear to be expressed in postnatal lymphocytes. Unfortunately fibroblasts, where the IRX genes may be expressed, were not available from the patient. 

Discussion

We describe the molecular characterization of an inv(2)(p22.3q12.1)t(2;16)(q12.1;q12.2) complex chromosomal rearrangement associated with a congenital, bilateral malformation of the anterior segment of the eye designated as severe ASOD with glaucoma. We propose that this rearrangement may be responsible for disruption of the expression of IRX3 or other IRXB genes, leading to the severe malformation of the anterior segment of the eye. 

During the third to fifth weeks of gestation, development of the anterior segment is in great part due to reciprocal inductions between the neural optic evagination, the overlying ectoderm, and intervening neural-crest–derived mesenchyme. On the basis of clinical data, animal models and temporal pattern of expression, some genes are particularly important in coordinating these processes. This is the case for the PAX6, FOXC1, and PITX2 transcription factor genes. PAX6 is considered by some to be a “master” gene in eye development that encodes multiple protein isoforms involved in both cornea and lens formation. ⁴³ Many reports show that in humans, this gene is implicated in aniridia, isolated cataracts, macular hypoplasia, keratitis, and Peters' anomaly. ^3–5,44 These clinical permutations are registered in the PAX6 mutation database (http://pax6.hgu.mrc.ac.uk/ provided in the public domain by the Human Genetics Unit, Medical Research Council, Edinburgh, Scotland, UK). ⁴⁵ Similarly, both human disease and murine models have demonstrated the importance of FOXC1 and PITX2 in the development of the anterior segment of the eye. For example, mutations in FOXC1 are associated with Axenfeld-Rieger anomaly or iris hypoplasia and FOXC1-knockout mice have anterior segment abnormalities similar to those reported in humans. ⁴⁶ Rieger syndrome is linked with certain PITX2 mutations. ^47–51  

In our patient, no mutation of these genes was found. However, in this complex chromosomal translocation, the der(16) breakpoint is located close (∼2 kb) to the IRX3 3′UTR. IRX3 belongs to the Iroquois gene family (named after the Drosophila bristle phenotype), which has been conserved during animal evolution from at least the time of a common ancestor with Caenorhabditis elegans (in which there is only one such gene) to vertebrates, in which there are between 6 and 11 IRX genes subsequent to multiple duplication events. ^{21,22,24–26,29,52,53} These genes encode for proteins with a highly conserved homeodomain of the TALE (three amino acid loop extension) superclass, as well as a 13-amino-acid domain called the Iroquois domain. ⁵⁴ In all species, Irx proteins are involved in early embryonic organ specification and patterning—in particular, the head, limbs, and eyes. ^28,31–39 In the mouse eye, Irx1, Irx3, Irx5, and Irx6 display very similar patterns of expression during organogenesis. At E9.5, Irx3 and Irx5 expression is first observed in the cephalic mesenchyme of neural crest origin, surrounding the optic vesicle. Irx1 and Irx6 are only subsequently coexpressed in this region at E10.5. By E12.5, the Irx genes are still expressed in the mesenchyme but also begin to be expressed in the neural retina, while decreasing in intensity in the mesenchyme. Irx genes are finally expressed exclusively in the neural cell layer of the retina at E16.5. ²² These data are concordant with our results of IRX3 expression in human embryonic and fetal sections. In particular, we observed IRX3 expression in midfacial mesenchyme surrounding the nonexpressing optic evagination, in preocular ectoderm, and later in the ciliary margin and in the lens. Altogether, these data indicate that the IRX3 gene is functionally involved in the development of the anterior segment of the human eye. 

Like other genes implicated in several developmental processes, regulation of IRX gene expression is coordinated in a spatial and temporal manner. Such coordination can be accomplished by tissue-specific transcription factors binding of enhancers, sometimes at distances ranging over 1 Mb 5′ or 3′ to the coding sequences that control either the expression of individual homeobox genes or the entire cluster. Examples are the SOX9 gene or the HOXD gene cluster, respectively. ^55,56 The human IRXA cluster spans 1.8 Mb, and the IRXB cluster spans 1.3 Mb. No other genes are interspaced between the IRX genes in the clusters. In the IRXB cluster, IRX3 is located at the centromeric end and has a 5′ telomere to 3′ centromere transcriptional orientation, which is opposite that of IRX5 and IRX6. In 2005, de la Calle-Mustienes et al., ²³ using transgenic Xenopus and zebrafish embryos, demonstrated that 22 highly conserved noncoding regions (HCNCRs) that lie within the IrxB cluster (and one located just telomeric to the Irx6 locus) direct the spatiotemporally specific expression of IrxB genes. In 2006, Pennacchio et al. ⁵⁷ tested 167 HCNCRs, conserved between humans and the pufferfish Takifugu rubripes or ultraconserved between humans and rodents, in a transgenic mouse assay. A meticulous analysis of these data showed that 21 HCNCRs lay within the IRXB cluster, 17 between IRX3 and IRX5 and 4 between IRX5 and IRX6 (Fig. 4). Functional tests showed that only 4 HCNCRs among the 21 have an enhancer activity in the eye during the mouse's embryonic development. Enhancers 26 and 27 are located between IRX5 and IRX6 and are probably involved in IRX5 and IRX6 expression. Enhancer 157, located 330 kb centromeric to IRX3 in intron 11of the FTO gene induces in a murine transgenic assay an eye-specific expression resembling that of IRX3. This gene is involved in controlling body fat. Its expression during embryonic development and its invalidation in mice did not show any activity in ocular embryogenesis. ^58,59 Enhancer 59 is located in the first intron of the RPGRIP1L gene (retinitis pigmentosa GTPase regulator interacting protein 1–like gene). This gene is expressed in several types of fetal and adult tissues but mainly in the brain, kidneys, ovaries, and testes and at the level of the retinal photoreceptors. ^60,61 Knockout mice Rpgrip1l ^−/− which are not viable, show exencephaly, polydactyly, abnormalities of lateralization, and microphthalmia. ⁶⁰ In humans, mutations of RPGRIP1L are found in patients presenting with the recessive syndromes oculo-cerebro-renal or type B Joubert and Meckel syndromes. ^60,61 This gene is involved in eye embryogenesis. It is reasonable to assume that enhancer 59 is associated with the control of the expression of RPGRIP1L in the eye. We therefore hypothesize that enhancer 157 plausibly plays a role in IRXB gene expression in the developing human eye. In addition, the chromosomal rearrangement delocalizes the IRXB cluster at the 2p22.3 region covered by the RP11-68N21. No known genes or HCNCRs were found. Accordingly, the translocation separates the IRXB cluster from enhancer 157, which has a specific eye expression thus deregulating the complex spatiotemporal expression and generating the ASOD observed in our patient. 

Figure 4.

 

HCNCRs having an enhancer activity and driving expression in the eye during mouse development. Double-pointed vertical arrow: the translocation breakpoint; star: sequence with enhancer activity.

In our patient, the translocation separates the IRXB complex from this enhancer, among others, and may deregulate the spatiotemporal expression of the IRXB cluster gene(s). 

Although the evolutionarily conserved IRX genes have been implicated in various developmental processes in animal models, so far no human disease linked to an IRX gene has been reported, perhaps due in part to the existence of functional compensation between these genes, as has been reported. ⁶² We describe a child with a severe ASOD associated with a complex chromosomal rearrangement inv(2)(p22.3q12.1)t(2:16)(q12.1;q12.2) because of the potential deregulation of IRXB genes by a positional effect. 

Footnotes

 Disclosure: M. Chaabouni, None; H. Etchevers, None; M.C. De Blois, None; P. Calvas, None; M.C. Waill-Perrier, None; M. Vekemans, None; S.P. Romana, None

The authors thank the patient and his family for participating in the study, Tania Attié-Bitach for constructive discussion, and Geraldine Goudefroye and Genevieve Molina for technical assistance.