Mitochondrial DNA Haplogroups Associated with Age-Related Macular Degeneration

Nitin Udar; Shari R. Atilano; Masood Memarzadeh; David S. Boyer; Marilyn Chwa; Stephanie Lu; Barak Maguen; Jonathan Langberg; Pinar Coskun; Douglas C. Wallace; Anthony B. Nesburn; Nikan Khatibi; Dieter Hertzog; Khoi Le; Daniel Hwang; M. Cristina Kenney

doi:10.1167/iovs.08-2646

Abstract

purpose. To examine the mtDNA control regions in normal and age-related macular degeneration (AMD) retinas. To identify the mtDNA variations associated with AMD.

methods. Retinas from 10 normal and 11 AMD globes were isolated and analyzed for mtDNA rearrangements by long extension-polymerase chain reaction (LX-PCR) and for the nature and frequency of single-nucleotide polymorphisms (SNPs) in the mtDNA control region by direct sequencing. Blood DNA was extracted from 99 AMD and 92 age-matched control subjects. The sequence variations that define haplogroups H, I, J, K, T, V, X, and U were characterized by PCR, restriction enzyme digestion, and/or sequencing.

results. LX-PCR of retinal mtDNAs revealed high levels of rearrangements in the patients with AMD and the control subjects, consistent with the decline in mitochondrial function with age. However, the AMD retinas had higher oxidized DNA levels and a higher number of SNPs than controls (P = 0.02). The control region SNPs T16126C and A73G, commonly found in haplogroups J and T, were more frequent in the AMD retinas than in normal retinas. The associations between AMD and haplogroups J and T were confirmed and extended by analysis of blood DNA. SNPs at position a T16126C (J; odds ratio [OR] = 3.66), T16126C+G13368A (JT; OR = 10.27), A4917G+A73G (T4; OR = 5), and T3197C+A12308G (U5; OR = ∞), were all strongly associated with AMD.

conclusions. AMD retinas exhibited increased mtDNA control region SNPs compared to normal retinas. This correlated with an increased frequency of mtDNA SNPs associated with haplogroups J, T and U in patients with AMD. These results implicate mitochondrial alterations in the etiology of AMD.

Age-related macular degeneration (AMD) is a major cause of blindness among the elderly in the developed world. Approximately 23% of individuals 65 to 74 years of age and 35% to 40% of those 75 to 84 years of age have some pathologic signs of AMD. Studies have implicated genetic factors, inflammation, and oxidative stress in the development of AMD.¹ ² ³ ⁴ ⁵ ⁶ ⁷ ⁸ ⁹ ¹⁰ ¹¹ ¹² ¹³ ¹⁴

Organs requiring large amounts of energy, such as brain, heart, muscles, and retina, are dramatically affected by mitochondrial dysfunction. The mitochondrial (mt)DNA defects associated with diseases can be inherited maternally, such as Leber’s hereditary optic neuropathy, or develop through somatic mutations. Generally, the mtDNA defects are either point mutations or single nucleotide polymorphisms (SNPs) or alternatively, large scale deletions or rearrangements such as that found in chronic progressive external ophthalmoplegia and Kearns-Sayre syndrome. Chiefly responsible for aerobic respiration, mitochondria are also used in some apoptotic pathways¹⁵that are thought to be involved in the pathologic course of AMD.¹⁶

The maternally inherited mtDNA is 16,569 nucleotide (nt) pairs and encodes for 37 genes, 13 protein subunits essential for oxidative phosphorylation (OXPHOS), 2 ribosomal RNAs (rRNA), and 22 transfer RNAs (tRNA).¹⁷ ¹⁸mtDNA is susceptible to oxidative damage and has a higher sequence evolution rate than does the nuclear DNA. Over the past 200,000 years, mtDNA variations have accumulated along radiating maternal lineages, and individual mtDNA haplogroup tree branches correlate with the geographic origin of the populations in which they are found. Many haplogroups are founded by one or more functional genetic variants and associated SNPs, which may modify mitochondrial OXPHOS to facilitate the adaptation of the mitochondrial energetics of that population to its environment (e,g., nature and availability of calories, thermal stress, infectious agents) Haplogroups are increasingly being correlated to a broad spectrum of common diseases.¹⁶ ¹⁹ ²⁰ ²¹ ²² ²³ ²⁴ ²⁵ ²⁶ ²⁷ ²⁸Most recently, an association of mtDNA haplogroups with characteristic AMD retinal lesions was demonstrated.²⁹Moreover, A4917G, a defining polymorphism for the T haplogroup, was reported as an independent predictor of AMD.³⁰

The mtDNA control region is noncoding but important for mtDNA replication and transcription. The H- and L-strand promoters, sites for origins of replication, mitochondrial transcription factor A binding sites, and conserved sequence blocks are located in the mtDNA control region. Mutations in the control region have been described in patients with Alzheimer’s disease and other disorders associated with oxidative stress.³¹

Using retinal DNA in the present study, we sequenced the entire mtDNA control region from AMD and normal retinas to identify variations. Our results showed that AMD retinas had increased numbers of SNPs per individual in the control region compared with normal retinas. Then, using informative SNPs, we analyzed blood DNA to establish the haplogroups for each individual in the study and showed that AMD was associated with mtDNA polymorphisms characteristic for the J, T, and U haplogroups.

Materials and Methods

Collection of AMD and Age-Matched Control Retinas

Normal retinas (n = 10; mean age, 80 ± 4.33 years; range, 52–97) and AMD retinas (n = 11, mean age 81.4 ± 2.65 years; range, 69–93) were collected from the National Disease Research Interchange (Philadelphia, PA) and the San Diego Eye Bank (Table 1) . The retinas were dissected, snap frozen and stored at −70°C. The diseased specimens had a clinical diagnosis and medical history of AMD that significantly impaired vision. A board–certified ophthalmologist using a dissecting microscope verified the pathology in the macular area.

Long-Extension Polymerase Chain Reaction (LX-PCR)

The total DNA isolated from normal and AMD retinas were used for LX- PCR amplification by modifications of methods described previously.³² ³³ ³⁴LX-PCR products were separated by electrophoresis on a 0.8% agarose gel stained with ethidium bromide. The mtDNA rearrangements (bands < 16 kb) were quantified (manual counting) by two independent investigators.³³The method for LX-PCR has been demonstrated to be reliable and represents the mtDNA through verification by Southern blot using a full-length digoxigenin-labeled mtDNA probe by our laboratory as well as others.³⁴ ³⁵ ³⁶The LX-PCR technique was further substantiated by sequencing individual bands showing they were indeed mtDNA and not artifact.³⁶

Immunohistochemistry of AMD and Normal Retinas

Immunohistochemistry was performed on paraffin embedded AMD (n = 5) and normal (n = 5) eyes using mouse anti-OXPOS complex V subunit d monoclonal antibodies (anti-ATP synthase subunit d; Invitrogen-Molecular Probes, Inc, Eugene, OR) and goat anti-8-hydroxydeoxyguanidine (8-OH-dG) polyclonal antibody (Chemicon, Temecula, CA). 8-OH-dG recognizes oxidized DNA bases damaged by hydroxyl radicals. Nuclei were stained with DAPI stain (Molecular Probes). Controls samples included use of the secondary antibody alone.

Collection of Blood Specimens from AMD and Control Patient Selections

The study was approved by the institutional review boards of University of California Irvine (HS 2003-3131) and Cedars-Sinai Medical Center (IRB 1708). Informed consents were obtained from participants and the study was performed according to the tenets of the Declaration of Helsinki for research involving human subjects. A total of 154 subjects, including 73 control patients (average age, 76.18 ± 0.7886 years; range, 65–93) and 81 patients with AMD (average age, 77.94 ± 0.7333 years; range, 65–92) were studied (P = 0.104). The patients with AMD were from a private practice ophthalmology office that specializes in retinal diseases (Retina-Vitreous Associates Medical Group). The age-matched control patients were from a private practice general ophthalmology office (American Eye Institute). The offices are approximately 2 miles apart and serve the same demographic and ethnic population, which was predominantly European haplogroup Caucasian. In the case population there were 91.4% European haplogroup Caucasians and 8.6% other/non-European lineage. The control population was 86.3% European haplogroup Caucasians and 13.7 other/non-European lineage (P = 0.124). Therefore, in this study the cases and controls were matched for both age and ethnicity.

Classification of AMD

The subjects underwent a complete dilated ophthalmic examination by Board certified ophthalmologists (DSB, ABN, and MCK) including slit lamp and indirect ophthalmic examinations with a 90-D lens or a fundus contact lens. Fundus photos, fluorescence and/or indocyanine green angiography were performed. The photographs and angiograms were read by masked graders who were board certified retinal specialists.⁸The subjects were graded according to the Clinical Age-Related Maculopathy Staging System (CARMS).³⁷Grade 3 had large soft drusen or several intermediate size drusen or drusenoid retinal pigment epithelial detachment and for this study is referred to as early AMD (see Table 5 ). In this study, the late-term AMD is the combination of grade 4, which is geographic atrophy, and grade 5, which is neovascular or serous exudative AMD. No stage 1 or 2 patients with AMD were included in this study.

Extraction of Total DNA from Blood and Retinal Tissue

DNA was extracted from venous blood samples of case and age-matched control populations (Puregene DNA extraction kit; Gentra, Minneapolis, MN). DNA was extracted from frozen retinal tissue by methods described previously.³⁴In this study we used blood DNA for the haplogroup studies and the retinal DNA for the LX-PCR amplification and sequencing of the mtDNA control region. This is consistent with numerous investigations that use blood DNA to identify haplogroup patterns of large groups of people for epidemiologic, disease profiles, and population migration studies.

Haplogroup Analyses

PCR and restriction enzyme digestions on the mtDNA were performed to ascertain the mitochondrial haplogroup of each patient.²² ²⁴ ³⁸Table 2presents the oligonucleotide primers, polymorphic sites, PCR parameters, and restriction enzymes used. Results were visualized on 2% agarose gels. We have defined haplogroup UK as positive for the A12308G SNP, K as positive for both the A12308G and G9055A SNPs, and U as positive for haplogroup A12308G SNP but negative for the A9055G SNP. The T haplogroup is defined by G13368A and A4917G. The J haplogroup is defined by G13708A, C16069T, and T16126C (see Table 4 ).

Sequencing

All sequenced PCR products were treated to remove unused primers and nucleotides (ExoSAP-IT; USB Corp., Cleveland, OH). Retina products were sequenced for the mtDNA control region (F: CTAAGCCAATCACTTTATTG; R: GCTGCGTGCTTGATGCTTGT). Haplogroup products were sequenced for specific SNPs. Sequencing was performed at the UCLA Sequencing and Genotyping Core facility. Sequence analyses were with the Mutation Surveyor program, (Softgenetics, State College, PA). Base changes were called heteroplasmic if the sequencing results gave a reduction and simultaneous increase of the SNP allele of more than ±30%. Homoplasmy was identified when there was no change in the signal peak heights of ±20%. Primers were designed using PRIMER 3 (Whitehead Institute for Biomedical Research; MIT, Cambridge, MA).³⁹

Statistical Analyses

LX-PCR and semiquantitative PCR were analyzed by unpaired t-test (two-tailed) using commercial software (GraphPad Prism; GraphPad Software, San Diego, CA) while haplogroup study data were analyzed by the Fisher exact text. Odds ratios and P values were calculated at http://home.clara.net/sisa/t-test.htm.

Results

mtDNA Analyses of Retinal Tissues

The mtDNA isolated from AMD (n = 11) and age-matched control (n = 10) retinas were examined using LX-PCR analyses, which allows amplification of the entire mitochondrial genome and any subgenomic-sized product that contains the primer sites. The full-length mtDNA LX-PCR product is ∼16.2 kb. The smaller sized mtDNA bands which represent rearrangements, degradations or deletion, were quantified and the mean ± SEM calculated (Fig. 1) . The normal versus AMD retinal LX-PCR mtDNA had 9.60 ± 1.24 and 10.89 ± 0.82 smaller sized bands per individual, respectively, (P = 0.41). The smaller products were heterogeneous in size and no one pattern was dominant. The ratios of mtND2, representing mtDNA, and 18s RNA, representing nDNA, in the normal and AMD retinal samples were similar to each other (1.34 ± 0.27 vs. 1.371 ± 0.489,P = 0.867; data not shown). These results show that the retinas of 80 year olds, whether AMD or control, have sustained a high level of somatic mtDNA damage, which is likely to have resulted in a significant age-related decline in mitochondrial function.

Evidence of Oxidative Damage in AMD Retinas

To determine whether this high level of mtDNA damage is due to oxidative stress, we assessed the relative levels of oxidative DNA damage by staining the retinas with 8-OH-dG, a sensitive and stable marker of oxidatively damaged DNA. The retinal structure was defined by DAPI staining for the nuclear layers and by staining for the nuclear DNA-encoded mitochondrial subunit ATP synthase subunit d. In Figure 2the photoreceptor nuclei stained blue, the ATP synthase subunit d stained green, and the 8-OH-dG rich DNA stained red. The ATP synthase subunit d is found in the retinal outer segment adjacent to the photoreceptor nuclei of the normal and AMD retinas. In areas of active disease, the AMD retinas show increased staining of 8-OH-gD in the outer segment region, suggesting increased oxidative damage to the mtDNA. Age-matched normal retinas had minimal 8-OH-dG staining of the retina.

Sequencing Analyses of the Retinal mtDNA Control Region

Increased mtDNA oxidative damage could increase the mtDNA somatic mutation rate. To assess this possibility, the entire mtDNA control region of the retinas was sequenced. A total of 50 nucleotide variants were detected in the 21 individuals studied, with each individual having between 1 to 12 SNPs (Tables 3A 3B) . On average, AMD retinas were found to have 8.9 ± 0.96 nucleotide changes while controls retinas had 5.8 ± 0.71 variants (P = 0.02). Thus, the AMD retinas were found to have more mtDNA control region variants than normals, perhaps reflecting a greater somatic mtDNA mutation rate.

Haplogroup Analyses Case and Control Populations

Analysis of the retinal mtDNA control region SNPs revealed that specific variations correlated with AMD. The A73G SNP, a common mtDNA variation, was found in 91% of AMD retinas (10/11) but in 40% (4/10) of the normal retinas (Table 3C) , the T16126C SNP was present in 64% (7/11) of AMD retinas compared with 20% (2/10) of control retinas and the C16069T SNP was found in 45% (5/11) of AMD retinas versus 10%(1/10) of control retinas. The T16126C and C16069T SNPs are commonly associated with mtDNA haplogroups J and the A73G SNP is frequently associated with a subset of haplogroup T.

Since the number of retinal samples studied were small and to determine whether this correlation was statistically significant, we examined the peripheral blood samples from 81 case patients and 73 age-matched controls to investigate association with common European mtDNA haplogroups H, I, J, K, T, U, V and X. Table 4shows the distribution of SNPs from the subjects with any AMD (early and late AMD combined). The haplogroup H was present in 33% of the AMD and 32.9% of control subjects (Table 4)which is consistent with previous studies of European populations and demonstrates the similarity of our case and control population substructure. No statistically significant differences were seen for haplogroups H, I, K, V, or X. Consistent with the retinal study we found a strong association of T16126C SNP in 24.7% (20/81) of the any AMD population compared to 8.2% (6/73) of the controls (odds ratio [OR] = 3.66; P = 0.004). The G13708A SNP (J haplogroup) had 12.3% (10/81) in the case population and 4.1% (3/73) in the control population (OR = 3.29; P = 0.044). The C16069T SNP was present in 9.9% (8/81) of the AMD but 4.1% (2/73) of the control (OR = 3.89; P = 0.055) subjects. We also examined combinations of haplogroup-related SNPs (Table 4) . The 16126+13368 SNPs (JT haplogroup) had significant association to AMD (OR = 10.27; P = 0.003). The case population was analyzed further for the J haplogroup subsets (Fig. 3)and showed J(2/11), J2(3/11), J1A(1/11), and J1C(5/11).

The aggregate T haplogroup SNPs A4917G, G13368A, and A73G SNPs also correlated with AMD. The A4917G SNP was found in 12.2% of the AMD but only 2.7% of the control population (OR = 5; P = 0.02). The T4 subset (SNPs 4917+73) also had a significant association with the case population (OR = 5; P = 0.02; Fig. 3 , Table 4 ). We also found that the SNPs related to the U haplogroup (A12308G+ and G9005A−) had increased association with AMD (OR = 5.58; P = 0.013; Table 4 ). The combination T3197C+A12308G (subset U5) was found in 6 of 81 case subjects but none of the controls (OR = ∞; P = 0.019). Figure 3shows the U subsets to be U1A(1/11), U4A(1/11), U5A(4/11), U5B(3/11), and U6A(2/11) (Fig. 3) .

Table 5shows the association between the three most prevalent mtDNA haplogroups (J, T, and U) in early AMD (grade 3) and late AMD (grades 4 and 5) compared with the control population. In the early AMD population, the U haplogroup SNPs (A12308G+ and G9055A−) (OR = 10.4; P = 0.01) and the T haplogroup SNP A4917G (OR = 7.1; P = 0.05) were associated with the case population. The late AMD group showed strong association with all SNPs associated with the J, T, and U haplogroups, including both the single SNPs and combination of SNPs.

Sequencing confirmed the RFLP changes and that restriction site variants were due to the expected nucleotide variants.

Discussion

The retina has one of the highest oxygen consumption rates of any tissue in the body, presumably due to continuous demand for mitochondrial ATP for visual function. The continuous, high exposure of light results in photo and oxidative damage to retinal cells. Since mtDNA damage accumulates with age and is associated with increased mitochondrial oxidative stress,⁴⁰it follows that human retinas would accumulate high levels of mtDNA damage by age 80. This finding was confirmed by LX-PCR analysis of retinas of both AMD and control subjects. Indeed the frequency and distribution of mtDNA rearrangements was sufficiently high to saturate the gel, making subtle distinctions between the control subjects and patients with AMD impossible. The high rate of mtDNA damage maybe the product of oxidative damage⁴¹based on increased levels of 8-OH-dG of the AMD retinas observed with immunohistochemistry. Increased oxidative DNA damage has also been reported in RPE and choroid of aging rodents.⁴²The excessive accumulation of age-related somatic mtDNA variations could severely inhibit the mtDNA biosynthetic capacity, inhibit mitochondrial function, and lead to apoptosis.⁴³

Consistent with increased mtDNA damage in the AMD retinas, sequencing of the mtDNA control region revealed an increase in the number of variants in AMD retinal mtDNAs versus controls (P = 0.02), which may represent sites for hot spots in this critical mtDNA region. Higher levels of SNPs in the mtDNA control region may impair mitochondrial copies and/or the functional efficiency, thereby contributing to decreased energy production and cell death.⁴³Because mtDNA control regions were amplified and sequenced in aggregate for each sample, only those new mutations that predominate would be detected. Presumably, the differential would have been greater if somatic variants at low percentages could have been detected.

Sequencing of the control regions from the AMD retinas revealed that certain haplogroup-associated control region SNPs were more prevalent in the patients with AMD than in the control subjects. These included the C16069T and T16126C SNPs commonly associated with haplogroup J and the A73G SNP frequently associated with haplogroup T. The association observed between retinal mtDNA and haplogroups J and T were then confirmed in a survey of the mtDNA haplogroups of blood samples from 81 AMD and 73 control subjects. Consistent with our findings, Canter et al.³⁰reported the haplogroup T-associated SNP A4917G as an independent predictor of AMD, and Jones et al.²⁹showed some association of J and U haplogroups with clinically recognized AMD retinal lesions. Haplogroup J was associated with large, soft drusen, which are recognized risk factors for the development of wet AMD, and haplogroup U was linked to retinal pigment abnormalities.⁴⁴Of interest, their study did not find associations with the late stages of AMD.²⁹However, it might be a sampling factor since 85% of their patient population had early AMD, and only 15% subjects had late AMD. In our study the AMD patient base came from retina specialists, and over 77% of patients with AMD had the most severe forms of AMD. This population showed significant associations of SNPs with J, T, and U haplogroups. Control region SNPs associated with U haplogroup were not found in the AMD retinas. The discrepancies between increased frequency of U haplogroup SNPs in blood DNA (11/81) versus retinal DNA may be explained by insufficient numbers of AMD retinas (n = 11) which leads to limitations of the power for the retinal cases and controls. A larger number of AMD retinas must be analyzed.

Within European populations, haplogroups J, T, and U are often associated with altered disease risk. The presence of haplogroup J increases the probability of blindness for individuals harboring the milder Leber’s hereditary optic neuropathy mutations at positions 11778, 14484, and 10663.⁴⁵ ⁴⁶Haplogroup J has been associated with increased risk of optic neuritis in patients with multiple sclerosis⁴⁷ ; and haplogroups J, T, and U with altered risk for Parkinson’s and Alzheimer’s diseases.¹⁹ ⁴⁸ ⁴⁹It has been proposed that these haplogroup-related SNPs harbor functional polymorphisms that alter the efficiency of mitochondrial energy production³¹by leading to a partially uncoupled OXPHOS which then requires that more calories be consumed for the same amount of ATP produced, resulting in greater body heat production. This effect would be advantageous in the temperate zone where coping with periods of extreme cold stress would be critical for survival.²⁷ ²⁸Consistent with this model, the sperm motility of haplogroup T and U mtDNAs was less than the common European haplogroup H, and these putative “uncoupled” mtDNAs are enriched in Northern Europe over Southern Europe.⁵⁰

Overall, our results suggest that defects in mitochondrial energy metabolism are important factors in the etiology of AMD. The mtDNA haplogroups associated with reduced mitochondrial ATP production increase the risk of AMD. We hypothesize that the partial and thus subclinical deficiencies in OXPHOS associated with haplogroups J, T, and U are then exacerbated by the age-related accumulation of somatic mtDNA damage, including both mtDNA control region base substitution mutations and total mtDNA rearrangements/mutations. As OXPHOS is inhibited, there is increased production of mitochondrial reactive oxygen species which causes addition mtDNA damage and dysfunction. Ultimately, as mitochondrial energy production falls below the retinal photoreceptor cell bioenergetic threshold, the mitochondrial permeability transition pore (mtPTP) is activated, and photoreceptors are destroyed through the intrinsic apoptosis pathway. This mitochondrial scenario of AMD, may not only explain many of the previously puzzling features of AMD but offers an array of new therapeutic approaches for the disease targeted toward increasing mitochondrial energy production, decreasing mitochondrial ROS, and stabilizing the mtPTP.

Supported by the Discovery Eye Foundation, the Lincy Foundation, the Henry L. Guenther Foundation, the Iris and B. Gerald Cantor Foundation, the Gilbert Foundation, and Research to Prevent Blindness.

Submitted for publication July 31, 2008; revised October 30 and December 9, 2008; accepted April 8, 2009.

Disclosure: N. Udar, None; S.R. Atilano, None; M. Memarzadeh, None; D.S. Boyer, None; M. Chwa, None; S. Lu, None; B. Maguen, None; J. Langberg, None; P. Coskun, None; D.C. Wallace, None; A.B. Nesburn, None; N. Khatibi, None; D. Hertzog, None; K. Le, None; D. Hwang, None; M.C. Kenney, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: M. Cristina Kenney, Department of Ophthalmology, University of California Irvine, Medical Center, 101 The City Drive, Orange, CA 92868; [email protected].

Table 1.

View Table

Donor Information for Normal and AMD Retinas

Table 2.

View Table

mtDNA Haplogroup Analysis

Table 2.

mtDNA Haplogroup Analysis

Related Haplogroup	Primer	Restriction Enzyme
H	F AATGATCTGCTGCAGTGCTC	AluI
7028	R TCCGGATAGGCCGAGAA
I	F GCTATCGGGCCCATACCCCGAAAATGT	BtsI
4529	R GGATGCGGTTGCTTGCGTGAGGAAATA
J	F CCGGAGATGAAAACCTTTTTCCAAGGAC	HpyCH4V
16126	R TGATGTGTGATAGTTGAGGGTTGATTGC
J	F CCGGAGATGAAAACCTTTTTCCAAGGAC	AflII
16069	R ATGTACGAAATACATAGCGGTTGTTGATGCTT
J	F TCCATCATCCACAACCTTAAC	BstNI
13708	R GATTGTTAGCGGTGTGGTCG
K	F ACCACCCAACAATGACTAATC	HaeII
9055	R GTTGTCGTGCAGGTAGAGG
T	F TAGCCTTCTCCACTTCAAGTC	Sau96I
13368	R AGAAACCTGTGAGGAAAGGTATT
V	F ACCTATCACACCCCATCCTAAA	NheI
4580	R AAGGATTATGGATGCGGTT
UK	F GCCACATAGCCCTCGTAGT	HinfI
12308	R TATTTGGAGTTGCACCAAGATT
X	F ACTTAACTTGACCGCTCTGAG	DdeI
1715	R ATTGGTGGCTGCTTTTAGGC
T	F CTCCGGGCCCATAACACTTGGGGGTAG	ApaLI
73	R TGTGTGGAAAGTGGCTGTGCAGACATTCA
T	F GCCCCCATCTCAATCATATACCAAATCTCTCC	BfaI
4917	R TGCGAGATAGTAGTAGGGTCGTGGTGCTGGA

Figure 1.

View Original Download Slide

LX-PCR of retinal mtDNA. Representative ethidium bromide–stained gel showing LX-PCR mtDNA from AMD and control retinas. The ages are given above each lane representing a different individual. The 16.2-kb product corresponds to the full-length mtDNA and the smaller sized LX-PCR products (<16.2 and >1.0 kb) represent mtDNA rearrangement/deletions. The 18s represents nuclear DNA. Quantitation of the number of smaller sized bands per individual in AMD and control retinas showed a similar number of smaller products (10.89 ± 0.82 vs. 9.60 ± 1.24 smaller sized bands per individual). M, marker.

Figure 2.

View Original Download Slide

Immunohistochemistry shows increased 8-OH-dG staining in AMD retinas (red). In normal and AMD retinas, the complex V, subunit d (ATP) staining patterns were similar to each other (green). Nuclei are blue, as identified with the DAPI staining. In the control tissues, no staining was observed when only secondary antibody (IgG only) was used on the tissue sections.

Table 3.

View Table

Sequencing of the Retinal mtDNA Control Region

Table 3.

Sequencing of the Retinal mtDNA Control Region

A. First 25 Polymorphisms
Donor	Polymorphisms
		73	143	146	150	152	185	195	199	203	204	217	228	250	295	462	477	482	489	497	508	709	15833	15852	15907	15924
		A>G	G>A	T>C	C>T	T>C	G>A	T>C	T>C	G>A	T>C	T>C	G>A	T>C	C>T	C>T	T>C	T>C	T>C	C>T	A>G	G>A	C>T	T>C	A>G	A>G
N-3	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
N-5	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0
N-6	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	1
N-7	1	0	0	0	0	1	0	0	0	0	0	1	0	1	1	0	1	1	0	0	0	0	0	0	0
N-8	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
N-9	1	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0
N-10	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
N-11	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0
N-12	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
N-13	0	1	0	0	0	0	1	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
A-14	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0
A-15	1	0	0	0	0	1	0	0	0	0	0	1	0	1	1	0	0	1	0	0	0	0	0	0	0
A-16	1	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
A-17	1	0	0	0	0	1	0	0	0	0	0	1	0	1	1	0	0	1	0	0	0	0	0	0	0
A-19	1	0	0	0	0	1	0	0	0	0	0	1	0	1	1	0	0	1	0	0	0	0	0	0	0
A-20	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0
A-21	1	0	0	0	0	1	0	0	0	0	0	1	0	1	1	0	1	1	0	0	0	0	0	0	0
A-22	1	0	0	0	0	1	0	0	0	0	0	1	0	1	1	0	1	1	0	0	1	0	0	0	0
A-23	1	0	0	0	0	0	0	1	1	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1
A-24	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
A-25	1	0	0	0	1	0	1	1	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	1	0
B. Remaining 25 Polymorphisms
Donor	Polymorphisms
		15928	16051	16069	16092	16093	16126	16129	16129	16172	16182	16183	16189	16192	16223	16224	16239	16261	16263	16294	16296	16304	16311	16319	16391	16519
		G>A	A>G	C>T	T>C	T>C	T>C	G>A	G>C	T>C	A>C	Adel	T>C	C>T	C>T	T>C	C>T	C>T	T>C	C>T	C>T	T>C	T>C	G>A	G>A	T>C
N-3	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0
N-5	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0
N-6	0	0	0	0	2	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	1
N-7	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
N-8	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1
N-9	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	1	1	0	0	0	1
N-10	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	1	1	0
N-11	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1
N-12	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	1
N-13	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0
A-14	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	1
A-15	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
A-16	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0
A-17	0	0	1	2	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0
A-19	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
A-20	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	1	1	1	0	0	0	0
A-21	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
A-22	1	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0
A-23	0	0	0	0	0	0	1	0	1	0	0	0	0	1	0	0	0	0	0	0	0	1	0	1	1
A-24	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1
A-25	0	1	0	0	0	0	0	1	0	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0
C. Sequence of Normal and AMD Retinas
	73	185	228	295	303	303	462	489	16069	16126	16311	16519
	A>G	G>A	G>A	C>T	C-CC	C-CCC	C>T	T>C	C>T	T>C	T>C	T>C
Incidence in control subjects	4/10	1/10	1/10	1/10	4/10	4/10	1/10	1/10	1/10	2/10	4/9	4/9
Incidence in AMD	10/11	5/11	5/11	5/11	3/11	3/11	5/11	5/11	5/11	7/11	1/9	1/9
% Controls	40.00	10.00	10.00	10.00	40.00	40.00	10.00	10.00	10.00	20.00	44.00	44.00
% AMD	91.00	45.00	45.00	45.00	27.00	27.00	45.00	45.00	45.00	64.00	11.00	11.00

0, no allele; 1, homozygous SNP; 2, heterozygous SNP. Numbers are bold for emphasis.

Table 4.

View Table

Distribution of SNPs from Any AMD Compared to Age-Matched Control Subjects

Table 4.

Distribution of SNPs from Any AMD Compared to Age-Matched Control Subjects

SNPs rs Number	Any AMD (%)	Normal (%)	P	OR	95% CI	Related Haplogroups
C7028T	27/81 (33)	24/73 (32.9)	0.13	1.02	0.52–1.99	H
rs56497622
A4529T	1/81 (1.2)	1/73 (1.4)	0.50	0.90	0.06–12.89	I
rs9701642
G13708A	10/81 (12.3)	3/73 (4.1)	0.044	3.29	0.87–12.45	J
rs28359178
C16069T	8/81 (9.9)	2/73 (4.1)	0.055	3.89	0.79–18.96	J
NA
T16126C	20/81 (24.7)	6/73 (8.2)	0.004	3.66	1.38–9.72	J
NA
T16126C, C16069T	8/81 (9.9)	2/73 (2.7)	0.055	3.89	0.80–18.95	J
NA, NA
G13708A, C16069T, T16126C	8/81 (9.8)	2/73 (2.7)	0.055	3.89	0.79–18.95	J
rs28359178, NA, NA
T16126C, G13368A	11/81 (13.6)	1/73 (1.4)	0.003	10.27	1.41–74.95	JT
NA, rs3899498
G13368A	10/81 (12.3)	1/73 (1.4)	0.0068	9.20	1.25–67.75	T
rs3899498
A4917G	10/81 (12.2)	2/73 (2.7)	0.02	5	1.05–23.64	T
rs28357980
A4917G, G13368A	9/81 (11.1)	1/73 (1.4)	0.012	8.17	1.10–60.76	T
rs28357980, rs3899498
A4917G, A73G	10/81 (12.3)	2/73 (1.4)	0.02	5	1.03–23.63	T4
rs28357980, rs3087742
A12308G	24/81 (29.6)	16/73 (21.9)	0.08	1.5	0.72–3.11	UK
rs2853498
A12308G, G9055A+	13/81 (16.0)	14/73 (19.2)	0.147	0.81	0.85–1.85	K
rs2853498, rs28348268
A12308G, G9055A−	11/81 (13.6)	2/73 (2.7)	0.013	5.58	1.19–26.08	U
rs2853498, rs28358268
A12308G, T3197C, C16270T	5/81 (6.17)	0/73 (0)	0.037	Infinity	Infinity	U5
rs2853498, rs2854131, rs2857290
G4580A	1/81 (1.2)	1/73 (1.4)	0.501	0.90	0.06–12.89	V
rs28357975
C1715T	5/81 (6.2)	4/73 (5.5)	0.263	1.135	0.30–4.39	X
rs28658366

95% CI, 95% confidence interval.

Figure 3.

View Original Download Slide

Subsets of the J, T, and U haplogroups found in the AMD samples.

Table 5.

View Table

The J, T, and U Haplogroup–Related SNPs of Early and Late AMD Compared to Age-Matched Control Subjects

Table 5.

The J, T, and U Haplogroup–Related SNPs of Early and Late AMD Compared to Age-Matched Control Subjects

SNPs	Early AMD	Late AMD	Normal	Related Haplogroups
C7028T, n (%)	7/18 (38.8)	20/63 (31.74)	24/73 (32.9)	H
OR [95% CI]	1.29 [0.45–3.77]	0.95 [0.46–1.95]
P	0.19	0.14
G13708A, n (%)	1/18 (5.5)	9/63 (14.29)	3/73 (4.1)	J
OR [95% CI]	1.52 [0.16–14.39]	3.39 [1.00–15.06]
P	0.42	0.03
C16069T, n (%)	1/18 (5.5)	7/63 (11.1)	2/73 (4.1)	J
OR [95% CI]	2.31 [0.21–25.13]	4.43 [0.89–22.20]
P	0.39	0.04
T16126C, n (%)	3/18 (16.67)	17/63 (26.98)	6/73 (8.2)	J
OR [95% CI]	2.23 [0.50–9.96]	4.13 [1.51–11.26]
P	0.18	0.003
G13708A, C16069T, T16126C, n (%)	1/18 (5.5)	7/63 (11.1)	2/73 (2.7)	J
OR [95% CI]	2.31 [0.21–25.13]	4.44 [0.89–22.20]
P	0.39	0.04
T16126C, C16069T, n (%)	1/18 (5.5)	7/63 (11.1)	2/73 (2.7)	J
OR [95% CI]	2.31 [0.21–25.13]	4.44 [0.89–22.20]
P	0.39	0.04
T16126C, G13368A, n (%)	2/18 (11.1)	9/63 (14.3)	1/73 (1.4)	JT
OR [95% CI]	8.17 [0.75–89.07]	10.89 [1.46–81.38]
P	0.09	0.004
G13368A, n (%)	2/18 (11.1)	8/63 (12.7)	1/73 (1.4)	T
OR [95% CI]	8.17 [0.75–89.07]	9.50 [1.26–71.94]
P	0.09	0.008
A4917G, n (%)	3/18 (16.67)	7/63 (11.1)	2/73 (2.7)	T
OR [95% CI]	7.1 [1.09–46.25]	4.44 [0.89–22.20]
P	0.05	0.04
A4917G, G13368A, n (%)	2/18 (11.1)	7/63 (11.1)	1/73 (1.4)	T
OR [95% CI]	8.17 [0.75–89.07]	8.17 [1.06–62.86]
P	0.09	0.02
A4917G, A73G, n (%)	3/18 (16.67)	7/63 (11.1)	2/73 (1.4)	T4
OR [95% CI]	7.1 [1.09–46.24]	4.44 [0.89–22.20]
P	0.05	0.04
A12308G, G9055A, n (%)	4/18 (22.2)	7/63 (11.1)	2/73 (2.7)	U
OR [95% CI]	10.4 [1.69–60.85]	4.44 [0.89–22.20]
P	0.01	0.04
A12308G, T3197C, n (%)	3/18 (16.67)	4/63 (3.17)	0/73 (0)	U5
OR [95% CI]	Infinity [infinity]	Infinity [infinity]
P	0.006	0.043

The authors thank the San Diego Eye Bank for providing the ocular tissue.

TomanySC, WangJJ, Van LeeuwenR, et al. Risk factors for incident age-related macular degeneration: pooled findings from 3 continents. Ophthalmology. 2004;111(7)1280–1287. [CrossRef] [PubMed]

Muller-EberhardHJ, SchreiberRD. Molecular biology and chemistry of the alternative pathway of complement. Adv Immunol. 1980;29:1–53. [PubMed]

MoshfeghiDM, BlumenkranzMS. Role of genetic factors and inflammation in age-related macular degeneration. Retina. 2007;27(3)269–275. [CrossRef] [PubMed]

EdwardsAO, RitterR, 3rd, AbelKJ, et al. Complement factor H polymorphism and age-related macular degeneration. Science. 2005;308(5720)421–424. [CrossRef] [PubMed]

KleinRJ, ZeissC, ChewEY, et al. Complement factor H polymorphism in age-related macular degeneration. Science. 2005;308(5720)385–389. [CrossRef] [PubMed]

HainesJL, HauserMA, SchmidtS, et al. Complement factor H variant increases the risk of age-related macular degeneration. Science. 2005;308(5720)419–421. [CrossRef] [PubMed]

ConleyYP, ThalamuthuA, JakobsdottirJ, et al. Candidate gene analysis suggests a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy. Hum Mol Genet. 2005;14(14)1991–2002. [CrossRef] [PubMed]

NarayananR, ButaniV, BoyerDS, et al. Complement factor H polymorphism in age-related macular degeneration. Ophthalmology. 2007;114(7)1327–1331. [CrossRef] [PubMed]

TanimotoS, TamuraH, UeT, et al. A polymorphism of LOC387715 gene is associated with age-related macular degeneration in the Japanese population. Neurosci Lett. 2007;414(1)71–74. [CrossRef] [PubMed]

ShastryBS. Further support for the common variants in complement factor H (Y402H) and LOC387715 (A69S) genes as major risk factors for the exudative age-related macular degeneration. Ophthalmologica. 2006;220(5)291–295. [CrossRef] [PubMed]

HamdiHK, KenneyC. Age-related macular degeneration: a new viewpoint. Front Biosci. 2003;8:e305–14. [CrossRef] [PubMed]

DeWanA, BrackenMB, HohJ. Two genetic pathways for age-related macular degeneration. Curr Opin Genet Dev. 2007;17(3)228–233. [CrossRef] [PubMed]

YoshidaT, DeWanA, ZhangH, et al. HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration. Mol Vis. 2007;13:545–548. [PubMed]

YangZ, CampNJ, SunH, et al. A variant of the HTRA1 gene increases susceptibility to age-related macular degeneration. Science. 2006;314(5801)992–993. [CrossRef] [PubMed]

GreenDR, ReedJC. Mitochondria and apoptosis. Science. 1998;281(5381)1309–1312. [CrossRef] [PubMed]

DunaiefJL, DentchevT, YingGS, MilamAH. The role of apoptosis in age-related macular degeneration. Arch Ophthalmol. 2002;120(11)1435–1442. [CrossRef] [PubMed]

WallaceDC. Diseases of the mitochondrial DNA. Annu Rev Biochem. 1992;61:1175–1212. [CrossRef] [PubMed]

WallaceDC. Mitochondrial DNA mutations in diseases of energy metabolism. J Bioenerg Biomembr. 1994;26(3)241–250. [CrossRef] [PubMed]

van der WaltJM, NicodemusKK, MartinER, et al. Mitochondrial polymorphisms significantly reduce the risk of Parkinson disease. Am J Hum Genet. 2003;72(4)804–811. [CrossRef] [PubMed]

van der WaltJM, DementievaYA, MartinER, et al. Analysis of European mitochondrial haplogroups with Alzheimer disease risk. Neurosci Lett. 2004;365(1)28–32. [CrossRef] [PubMed]

FesahatF, HoushmandM, PanahiMS, et al. Do haplogroups H and U act to increase the penetrance of Alzheimer’s disease?. Cell Mol Neurobiol. 2007;27(3)329–334. [CrossRef] [PubMed]

Hassani-KumlehH, HoushmandM, PanahiMS, et al. Mitochondrial D-loop variation in Persian multiple sclerosis patients: K and A haplogroups as a risk factor!. Cell Mol Neurobiol. 2006;26(2)119–125. [CrossRef] [PubMed]

HuertaC, CastroMG, CotoE, et al. Mitochondrial DNA polymorphisms and risk of Parkinson’s disease in Spanish population. J Neurol Sci. 2005;236(1–2)49–54. [CrossRef] [PubMed]

CastroMG, HuertaC, RegueroJR, et al. Mitochondrial DNA haplogroups in Spanish patients with hypertrophic cardiomyopathy. Int J Cardiol. 2006;112(2)202–206. [CrossRef] [PubMed]

TorroniA, HuoponenK, FrancalacciP, et al. Classification of European mtDNAs from an analysis of three European populations. Genetics. 1996;144(4)1835–1850. [PubMed]

TorroniA, SchurrTG, CabellMF, et al. Asian affinities and continental radiation of the four founding Native American mtDNAs. Am J Hum Genet. 1993;53(3)563–590. [PubMed]

Ruiz-PesiniE, MishmarD, BrandonM, et al. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science. 2004;303(5655)223–226. [CrossRef] [PubMed]

MishmarD, Ruiz-PesiniE, GolikP, et al. Natural selection shaped regional mtDNA variation in humans. Proc Natl Acad Sci U S A. 2003;100(1)171–176. [CrossRef] [PubMed]

JonesMM, ManwaringN, WangJJ, et al. Mitochondrial DNA haplogroups and age-related maculopathy. Arch Ophthalmol. 2007;125(9)1235–1240. [CrossRef] [PubMed]

CanterJA, OlsonLM, SpencerK, et al. Mitochondrial DNA polymorphism A4917G is independently associated with age-related macular degeneration. PLoS ONE. 2008;3(5)e2091. [CrossRef] [PubMed]

CoskunPE, BealMF, WallaceDC. Alzheimer’s brains harbor somatic mtDNA control-region mutations that suppress mitochondrial transcription and replication. Proc Natl Acad Sci U S A. 2004;101(29)10726–10731. [CrossRef] [PubMed]

MelovS, ShoffnerJM, KaufmanA, WallaceDC. Marked increase in the number and variety of mitochondrial DNA rearrangements in aging human skeletal muscle. Nucleic Acids Res. 1995;23(20)4122–4126. [CrossRef] [PubMed]

JessieBC, SunCQ, IronsHR, et al. Accumulation of mitochondrial DNA deletions in the malignant prostate of patients of different ages. Exp Gerontol. 2001;37(1)169–174. [CrossRef] [PubMed]

AtilanoSR, CoskunP, ChwaM, et al. Accumulation of mitochondrial DNA damage in keratoconus corneas. Invest Ophthalmol Vis Sci. 2005;46(4)1256–1263. [CrossRef] [PubMed]

GuG, ReyesPE, GoldenGT, et al. Mitochondrial DNA deletions/rearrangements in Parkinson disease and related neurodegenerative disorders. J Neuropathol Exp Neurol. 2002;61(7)634–639. [PubMed]

MelovS, HinerfeldD, EspositoL, WallaceDC. Multi-organ characterization of mitochondrial genomic rearrangements in ad libitum and caloric restricted mice show striking somatic mitochondrial DNA rearrangements with age. Nucleic Acids Res. 1997;25(5)974–982. [CrossRef] [PubMed]

SeddonJM, SharmaS, AdelmanRA. Evaluation of the clinical age-related maculopathy staging system. Ophthalmology. 2006;113(2)260–266. [CrossRef] [PubMed]

AndrewsR, RessiniotisT, TurnbullDM, et al. The role of mitochondrial haplogroups in primary open angle glaucoma. Br J Ophthalmol. 2006;90(4)488–490. [CrossRef] [PubMed]

RozenS, SkaletskyH. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–386. [PubMed]

WallaceDC. A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet. 2005;39:359–407. [CrossRef] [PubMed]

DonosoLA, KimD, FrostA, et al. The role of inflammation in the pathogenesis of age-related macular degeneration. Surv Ophthalmol. 2006;51(2)137–152. [CrossRef] [PubMed]

WangAL, LukasTJ, YuanM, NeufeldAH. Increased mitochondrial DNA damage and down-regulation of DNA repair enzymes in aged rodent retinal pigment epithelium and choroid. Mol Vis. 2008;14:644–651. [PubMed]

SubramaniamV, GolikP, MurdockDG, et al. MITOCHIP assessment of differential gene expression in the skeletal muscle of Ant1 knockout mice: coordinate regulation of OXPHOS, antioxidant, and apoptotic genes. Biochim Biophys Acta. 2008;1777(7–8)666–675. [CrossRef] [PubMed]

RoquetW, Roudot-ThoravalF, CoscasG, SoubraneG. Clinical features of drusenoid pigment epithelial detachment in age related macular degeneration. Br J Ophthalmol. 2004;88(5)638–642. [CrossRef] [PubMed]

HofmannS, BezoldR, JakschM, et al. Wolfram (DIDMOAD) syndrome and Leber hereditary optic neuropathy (LHON) are associated with distinct mitochondrial DNA haplotypes. Genomics. 1997;39(1)8–18. [CrossRef] [PubMed]

BrownMD, SunF, WallaceDC. Clustering of Caucasian Leber hereditary optic neuropathy patients containing the 11778 or 14484 mutations on an mtDNA lineage. Am J Hum Genet. 1997;60(2)381–387. [PubMed]

ReynierP, Penisson-BesnierI, MoreauC, et al. mtDNA haplogroup J: a contributing factor of optic neuritis. Eur J Hum Genet. 1999;7(3)404–406. [CrossRef] [PubMed]

ChagnonP, GeeM, FilionM, et al. Phylogenetic analysis of the mitochondrial genome indicates significant differences between patients with Alzheimer disease and controls in a French-Canadian founder population. Am J Med Genet. 1999;85(1)20–30. [CrossRef] [PubMed]

KhusnutdinovaEGI, Ruiz-PesiniE, DerbenevaO, et al. A mitochondrial etiology of neurodegenerative diseases: evidence from Parkinson disease. Ann N Y Acad Sci. 2008;1147:1–20. [CrossRef] [PubMed]

Montiel-SosaF, Ruiz-PesiniE, EnriquezJA, et al. Differences of sperm motility in mitochondrial DNA haplogroup U sublineages. Gene. 2006;368:21–27. [CrossRef] [PubMed]

Jump To...

Related Articles

From Other Journals

Related Topics

Donor	Age (y)	Sex	Ethnicity	Stage
N-3	52	M	C	N/A
N-5	79	M	N/A	N/A
N-6	73	N/A	N/A	N/A
N-7	76	M	C	N/A
N-8	79	F	C	N/A
N-9	79	M	C	N/A
N-10	85	F	C	N/A
N-11	88	F	C	N/A
N-12	91	M	C	N/A
N-13	97	F	C	N/A
A-14	69	F	C	Disciform scar
A-15	88	M	C	Macular atrophy
A-16	77	F	C	Disciform scar
A-17	78	F	C	Macular atrophy
A-19	83	F	C	Disciform scar
A-20	89	F	C	Macular atrophy
A-21	71	F	C	Macular atrophy
A-22	N/A	M	C	Disciform scar
A-23	93	F	C	Disciform scar
A-24	88	F	C	Disciform scar
A-25	90	M	C	Disciform scar

Donor	Age (y)	Sex	Ethnicity	Stage
N-3	52	M	C	N/A
N-5	79	M	N/A	N/A
N-6	73	N/A	N/A	N/A
N-7	76	M	C	N/A
N-8	79	F	C	N/A
N-9	79	M	C	N/A
N-10	85	F	C	N/A
N-11	88	F	C	N/A
N-12	91	M	C	N/A
N-13	97	F	C	N/A
A-14	69	F	C	Disciform scar
A-15	88	M	C	Macular atrophy
A-16	77	F	C	Disciform scar
A-17	78	F	C	Macular atrophy
A-19	83	F	C	Disciform scar
A-20	89	F	C	Macular atrophy
A-21	71	F	C	Macular atrophy
A-22	N/A	M	C	Disciform scar
A-23	93	F	C	Disciform scar
A-24	88	F	C	Disciform scar
A-25	90	M	C	Disciform scar

Jump To...

This feature is available to authenticated users only.

Related Articles

From Other Journals

Related Topics

To View More...

You must be signed into an individual account to use this feature.