December 2010
Volume 51, Issue 12
Free
Biochemistry and Molecular Biology  |   December 2010
Enhancement of Angiogenic Potential of Endothelial Cells by Contact with Retinal Pigment Epithelial Cells in a Model Simulating Pathological Conditions
Author Affiliations & Notes
  • Rima Dardik
    From the Institute of Thrombosis and Hemostasis, Sheba Medical Center, Tel Hashomer, Israel;
    Laboratory of Eye Research, Felsenstein Medical Research Center, Petah Tikva, Israel;
  • Tami Livnat
    From the Institute of Thrombosis and Hemostasis, Sheba Medical Center, Tel Hashomer, Israel;
    Laboratory of Eye Research, Felsenstein Medical Research Center, Petah Tikva, Israel;
  • Yael Nisgav
    Laboratory of Eye Research, Felsenstein Medical Research Center, Petah Tikva, Israel;
  • Dov Weinberger
    Laboratory of Eye Research, Felsenstein Medical Research Center, Petah Tikva, Israel;
    Department of Ophthalmology, Beilinson Medical Center, Petah Tikva, Israel; and
    Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel.
  • Corresponding author: Dov Weinberger, Department of Ophthalmology, Beilinson Medical Center and Tel-Aviv University School of Medicine, Tel Aviv, Israel; dwin@zahav.net.il
  • Footnotes
    3  These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.
Investigative Ophthalmology & Visual Science December 2010, Vol.51, 6188-6195. doi:10.1167/iovs.09-5095
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Rima Dardik, Tami Livnat, Yael Nisgav, Dov Weinberger; Enhancement of Angiogenic Potential of Endothelial Cells by Contact with Retinal Pigment Epithelial Cells in a Model Simulating Pathological Conditions. Invest. Ophthalmol. Vis. Sci. 2010;51(12):6188-6195. doi: 10.1167/iovs.09-5095.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Choroidal neovascularization (CNV) is the leading cause of vision loss in chorioretinal diseases involving contact between retinal pigment epithelial (RPE) and endothelial cells (ECs). The aim of this study was to investigate changes in the angiogenic potential of ECs induced by RPE-EC interaction in two models of RPE-EC coculture.

Methods.: RPE and ECs were grown in contact or noncontact coculture. Selection of ECs was achieved using magnetic beads coated with antibodies specific for EC surface proteins. Angiogenesis was assessed by analyzing the expression of EC genes involved in angiogenesis by RT-PCR. Tube formation on Matrigel was used as a functional angiogenesis assay. Expression and activity of matrix metalloproteases (MMPs) were examined by RT-PCR and zymography, respectively.

Results.: Coculture of ECs with RPE in the contact model under normoxic conditions induced markedly upregulated EC mRNA expression of 16 genes involved in positive regulation of angiogenesis. Solo ECs subjected to hypoxia demonstrated upregulated expression of the same 16 genes, including VEGF and HIF1. The EC VEGF level was not affected by coculture with RPE in the noncontact model. ECs demonstrated enhanced tube formation on Matrigel after contact coculture with RPE. EC MMP2 mRNA and activity levels were elevated in contact, but not in noncontact, coculture.

Conclusions.: Coculture of ECs with RPE under conditions enabling direct EC-RPE contact enhances the proangiogenic potential of ECs under normoxia, to an extent similar to that induced by hypoxia, suggesting that ECs in direct contact with RPE cells might be more prone to pathologic angiogenesis involved in CNV formation.

Choroidal neovascularization (CNV) is the leading cause of vision loss in various pathologic conditions in which the Bruch's membrane is ruptured or damaged, among them angioid streaks, high myopia, inappropriate laser burn, and choroidal rupture after ocular contusion. 1 3  
In spite of the remarkable etiologic variety of the diseases associated with CNV, significant similarity is found between the pathologic blood vessels developing in these diseases in terms of cellular composition and morphology. 1 This observation has led to the suggestion that CNV tends to develop under conditions where the retinal pigment epithelial (RPE) and endothelial cells (ECs) are no longer separated by the Bruch's membrane, resulting in exposure of the two cell types to each other. 4  
In the adult eye, the innermost vascular layer of the choroid, containing the choriocapillaris, lies adjacent to the Bruch's membrane and is separated from the RPE cells by the Bruch's membrane matrix. There is no direct contact between the RPE cells and the ECs of the choriocapillaries. However, ocular diseases involving a newly formed contact between RPE cells and the choriocapillaries, such as angioid streaks, irregular crack-like dehiscences in the Bruch's membrane, and traumatic choroidal rupture, all are associated with CNV formation. 5 Lacquer cracks found in high myopia are considered to represent mechanical fissures in the RPE–Bruch's membrane–choriocapillaries complex secondary to eyeball elongation in highly myopic eyes, which might result in later development of CNV. 6 Moreover, the animal model of CNV development is based on using a laser burn to rupture the Bruch's membrane. 2,7 Immediately after exposure to the laser, a circular area is observed, indicating disruption of the RPE–Bruch's membrane–choroids complex. Then, later, the number of RPE cells and endothelial cells significantly increase, reflecting enhanced cell proliferation and migration, and newly formed vascular tubes can be seen. The volume of CNV vessels increases exponentially, and after a week, a well-defined CNV network is present. This model strongly suggests that the direct contact between RPE and ECs due to Bruch's membrane rupture triggers a pro-angiogenic response. Moreover, CNV membranes were shown to be composed mainly of RPE cells and choroidal microvascular endothelial cells. 8  
Several in vitro studies have addressed the issue of RPE-EC interaction and its potential role in the development of CNV. Geisen et al. 9 reported that both proliferation and migration of choroidal EC was significantly increased when ECs were grown in either contact or noncontact coculture with RPE. Sakamoto et al. 10 demonstrated that RPE cells modulate tube formation by ECs embedded in type-I collagen gel. In our study, we used two models of EC-RPE coculture: the well-established noncontact model mimicking the normal conditions, 11,12 and the contact model that we developed to mimic direct EC-RPE contact occurring in the pathologic conditions associated with Bruch's membrane rupture, as described above. The latter model of EC-RPE coculture recapitulates the conditions when RPE cells are no longer polarized and ECs are activated; therefore, the physiologic apposition of EC to basal RPE is lost. Our aim was to examine the effect of EC-RPE coculture, with and without direct contact between the two cell types, on the angiogenic profile of ECs per se. Isolation of ECs after contact coculture with RPE enabled us to study the angiogenic properties in terms of expression of endothelial genes/proteins involved in angiogenesis and their capacity to form tubes on extracellular matrix. Our results indicate that direct contact between RPE cells and ECs enhances the pro-angiogenic activity of ECs. 
Materials and Methods
Cells and Materials
Human RPE cells (ARPE-19 cell line) were purchased from ATCC (Manassas, VA) and cultured under standard conditions according to the manufacturer's instructions. The experiments were performed using passages 10–25. Human dermal microvascular ECs, kindly donated by Rong Shao 13 (Biomedical Research Institute, Baystate Medical Center/University of Massachusetts at Amherst, Springfield, MA), were grown in endothelial basal medium supplemented with growth factor cocktail (PromoCell, Heidelberg, Germany) and 10% fetal calf serum. Normal human skin fibroblasts were purchased from PromoCell and cultured according to the manufacturer's instructions. Extracellular matrix (Matrigel) was purchased from BD Biosciences (San Jose, CA). 
EC-RPE Contact Coculture and EC Selection
RPE cells and ECs were plated at a concentration of 6.7 × 103 cells/cm2 each and cultured together for 7 days in a mixture of RPE/EC (1:1) medium (coculture medium). Pure cultures of solo RPE cells and solo ECs (control samples) were plated simultaneously with EC-RPE cocultures and grown as described above in their own culture media. 
After coculture, the cells were detached by incubation with 5 mM EDTA in PBS for 30 minutes ECs were separated from the cell mixture using magnetic beads coated with either anti-VEGFR2 antibody (PlusCellect human VEGFR2/KDR kit; R&D Systems, Minneapolis, MN) or anti-CD31 antibody (PlusCellect human CD31 kit; R&D Systems). After selection, purity of the EC population was verified by flow cytometry using a PE-conjugated anti-VEGFR2 antibody or PE-conjugated anti-CD31 antibody (R&D Systems) according to the antibody used for EC isolation. Separated ECs were further used for RNA extraction and measurement of VEGF levels. 
EC-RPE Noncontact Coculture
The EC-RPE noncontact cocultures were grown using Transwell inserts, as described previously. 11,12 RPE cells and ECs were plated at a density of 1.3 × 104 cells/cm2. RPE cells were plated on the bottom of the plate, and ECs were plated on top of a 0.4 μm Transwell insert (Millicell inserts; Millipore, Billerica, MA). Cells were cultured in coculture medium for 7 days. For RNA extraction, the cells were detached by 30 minutes of incubation with 5 mM EDTA in PBS. 
RNA Preparation
Total RNA from control solo ECs, ECs grown under conditions of hypoxia induced by incubation with 100 μM CoCl2 for 12 hours, or ECs separated from contact or noncontact EC-RPE coculture was extracted using a commercial reagent (Trizol; Invitrogen Corporation, Eugene, OR) according to the manufacturer's instructions. RNA samples were reverse-transcribed into cDNA using reverse transcriptase and random oligonucleotides (Moloney Murine Leukemia Virus; Invitrogen). 
Quantitative Real-Time PCR Assay
Quantification of VEGF levels in cDNA samples was performed by real-time PCR analysis (Sybr Green qPCR Supermix; Invitrogen), and amplification was monitored (ABI/Prism 7700 Sequence Detector System; Applied Biosystems). GAPDH and HPRT were used as reference genes in all real-time PCR experiments. In each PCR experiment, mRNA levels of the gene of interest were calculated using GAPDH or HPRT as a reference gene. Primer sequences used for PCR analysis (see Table 2) were selected using the Primer3 software (http://frodo.wi.mit.edu/primer3/). 
Flow Cytometry
Cells grown in contact coculture and cells selected by anti-VEGFR2– or anti-CD31–coated beads were incubated with PE-conjugated mouse anti-human VEGFR2– or PE-conjugated mouse anti-human CD31 (R&D Systems), respectively, for 15 minutes at room temperature, followed by flow cytometry analysis (Epics; Beckman Coulter, Luton, UK). 
Examination of VEGF Levels by ELISA
Cellular proteins were extracted in ice-cold lysis buffer (1% Triton X-100 in tris-buffered saline; 0.15 M NaCl, 20 mM TrisHCl, pH 7.5) containing protease inhibitors (Boeringer-Manheim, Germany). Protein concentrations were measured using the Bradford assay (Bio-Rad, Munich, Germany). VEGF levels in cellular extracts were measured by a commercial ELISA assay (PeproTech, London, UK) according to the manufacturer's instructions. 
Examination of PEDF Levels by ELISA
PEDF levels in cellular extracts and in conditioned medium samples were measured by a commercial ELISA assay (Chemicon/Upstate/Linco, Temecula, CA) according to the manufacturer's instructions. 
Real-Time PCR Array
Expression of angiogenesis-related genes was examined using an array system according to the manufacturer's instructions (RT-Profiler PCR Array System; SuperArray Bioscience Corporation, Frederick, MD). 
Zymography
Media samples were collected before cell harvesting. Media samples from noncontact cocultures were taken as a mixture of the upper and lower compartments. For control, we used a mixture of media from solo RPE and EC cultures grown separately. The media samples were centrifuged 10 minutes at 310g to remove floating cells. Supernatants were resolved on 8% SDS-PAGE containing 1% gelatin. The gel was incubated in renaturing buffer (2.5% Triton X-100) for 30 minutes at room temperature, followed by 30 minutes of incubation in developing buffer (Tris base 50mM, Tris-HCl 0.2M, NaCl 0.2M, CaCl2 5 mM, Brij 35 0.02%) with gentle agitation. The gel was then incubated in developing buffer at 37°C overnight, and stained (Coomassie R-250, Sigma, Rehovot, Israel) for at least 2.5 hours with gentle agitation. The samples were viewed and analyzed (LI-COR Odyssey imaging system; LI-COR Biosciences, Lincoln, NE). 
Immunohistochemistry
Cultures were grown on 12 mm coverslips (Thermo Scientific), fixed in 4% paraformaldehyde in PBS and permeabilized with 0.2% Triton X-100 in PBS for 10 minutes. Antigen retrieval was performed using 10 mM citric acid for 15 minutes at 95°C. The samples were incubated with rabbit anti-human von Willebrand factor (vWF) antibody (1:200; Dako, Copenhagen, Denmark) overnight at 4°C, followed by rhodamine-conjugated goat anti-rabbit IgG (1:100; Jackson, ImmunoResearch Laboratories, Inc., West Grove, PA) and 300 nM 4′,6′-diamidino-2-phenylidole (Sigma). Images of representative slides were captured digitally using standard microscope and camera settings (Olympus Optical Co., Tokyo, Japan). 
Statistical Analysis
Statistical analysis was performed by one-way ANOVA with post-hoc Student's t-tests (GraphPad Prism version 4.00 for Windows; GraphPad Software, San Diego, CA). P < 0.05 was considered significant. 
Results
Two Models of Coculture
Two models of EC-RPE coculture were evaluated: contact coculture, in which RPE cells and ECs were plated together, followed by selection of ECs by either anti-VEGFR2– or anti-CD31–coated magnetic beads; and noncontact coculture, in which RPE cells plated in culture plates were covered by Transwell inserts, in which ECs were plated. Immunostaining of ECs in a representative field of contact coculture is shown in Figure 1. An organized structure resembling EC tubes can be seen in contact coculture with RPE (Figs. 1A, 1B). 
Figure 1.
 
Immunostaining of ECs with anti-vWF antibody. Representative pictures of immunostaining of EC with anti-vWF antibody in contact and noncontact coculture with RPE. DAPI was used for nuclei staining. (A) Contact coculture. (B) Contact coculture, (C) Noncontact coculture. (D) EC alone. Magnification: (A, C, D) ×200; (B) ×400.
Figure 1.
 
Immunostaining of ECs with anti-vWF antibody. Representative pictures of immunostaining of EC with anti-vWF antibody in contact and noncontact coculture with RPE. DAPI was used for nuclei staining. (A) Contact coculture. (B) Contact coculture, (C) Noncontact coculture. (D) EC alone. Magnification: (A, C, D) ×200; (B) ×400.
Isolation of ECs from Contact Coculture
Solo RPE and solo ECs were first examined for surface expression of VEGFR2 and CD31 (PECAM-1) receptors using flow cytometry. As shown in Figure 2, surface expression of CD31 was observed in EC but not in RPE cells. VEGFR2 was expressed by both cell types; however, the mean fluorescence intensity (MFI) demonstrated by ECs was much higher compared with that observed in RPE cells (MFI: 250 vs. 32 [arbitrary units] for ECs and RPE cells, respectively), suggesting that the number of VEGFR2 receptors expressed on the EC surface is much higher than that expressed on the RPE cell surface (Fig. 2, lower panel). After contact coculture with RPE cells for 7 days, ECs were separated from RPE cells using magnetic beads coated with either anti-CD31 or anti-VEGFR2 antibody. The purity of the EC population after separation was verified by flow cytometry using either PE-conjugated anti-CD31 or PE-conjugated anti-VEGFR2 antibody for cells isolated by magnetic beads coated with anti-CD31 or anti-VEGFR2 antibody, respectively (Fig. 3). ECs isolated from contact coculture using anti-CD31–coated beads showed 99% purity (CD31 positive cells), compared with 90% purity measured in the EC population isolated from contact coculture by anti-VEGFR2–coated beads (VEGFR2–positive cells demonstrating high MFI). We further confirmed the exclusive binding of anti-CD31 antibody to ECs, and the highly preferential binding of anti-VEGFR2 antibody to ECs, compared with RPE cells, by examining the ability of both antibodies to bind RPE cells. We incubated solo RPE cells with either anti-CD31– or anti-VEGFR2–coated beads and counted the number of cells bound to the beads. Incubation of a pure population of RPE cells with anti-CD31–coated beads resulted in binding of <1% of RPE cells. A similar experiment performed with anti-VEGFR2–coated beads revealed that approximately 10% of the RPE cells were bound by the beads. 
Figure 2.
 
Examination of solo RPE cells and solo ECs for the expression of CD31 (top panel) and VEGFR2 (bottom panel) by flow cytometry. RPE cells do not express CD31, as opposed to intensive CD31 surface expression observed on ECs. VEGFR2 was detected on the surface of both cell types; however, the staining intensity was much higher on ECs.
Figure 2.
 
Examination of solo RPE cells and solo ECs for the expression of CD31 (top panel) and VEGFR2 (bottom panel) by flow cytometry. RPE cells do not express CD31, as opposed to intensive CD31 surface expression observed on ECs. VEGFR2 was detected on the surface of both cell types; however, the staining intensity was much higher on ECs.
Figure 3.
 
Isolation of ECs from EC-RPE contact coculture using magnetic beads coated with either anti-VGFR2 (left panel) or anti-CD31 (right panel) antibodies. ECs were separated from EC-RPE contact cocultures using magnetic beads coated with either anti-VEGFR2 or anti-CD31 antibodies. Isolated ECs were further examined for the expression of VEGFR2 or CD31 by flow cytometry analysis, using PE-conjugated anti- VEGFR2 or PE-conjugated anti-CD31 antibodies, respectively. The VEGFR2 graph shows weak expression of VEGFR2 on the surface of solo RPE cells (black histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-VEGFR2–coated magnetic beads (green histogram). The CD31 graph shows no expression of CD31 on RPE cells (a gray-filled histogram completely overlapping the nonimmune IgG histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-CD31–coated magnetic beads (green histogram). Bottom panel: immunostaining of ECs isolated from EC-RPE contact coculture using anti-CD31–coated beads with anti-vWF antibody. Left: vWF antibody+DAPI; right: second antibody only + DAPI.
Figure 3.
 
Isolation of ECs from EC-RPE contact coculture using magnetic beads coated with either anti-VGFR2 (left panel) or anti-CD31 (right panel) antibodies. ECs were separated from EC-RPE contact cocultures using magnetic beads coated with either anti-VEGFR2 or anti-CD31 antibodies. Isolated ECs were further examined for the expression of VEGFR2 or CD31 by flow cytometry analysis, using PE-conjugated anti- VEGFR2 or PE-conjugated anti-CD31 antibodies, respectively. The VEGFR2 graph shows weak expression of VEGFR2 on the surface of solo RPE cells (black histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-VEGFR2–coated magnetic beads (green histogram). The CD31 graph shows no expression of CD31 on RPE cells (a gray-filled histogram completely overlapping the nonimmune IgG histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-CD31–coated magnetic beads (green histogram). Bottom panel: immunostaining of ECs isolated from EC-RPE contact coculture using anti-CD31–coated beads with anti-vWF antibody. Left: vWF antibody+DAPI; right: second antibody only + DAPI.
Effects of Contact and Noncontact Coculture with RPE and Hypoxia on EC VEGF mRNA and Protein Levels
CoCl2 was used as a hypoxia-mimicking factor. Previous in vitro studies have clearly demonstrated that CoCl2 induces HIF1A expression, accompanied by upregulation of VEGF expression in ECs, 14 RPE, 12 and other cells. 15  
Quantitative real-time PCR was used to examine the effect of coculture and hypoxia on VEGF mRNA levels in ECs. As shown in Figure 4A, coculture with RPE induced a significant increase in the endothelial VEGF level: 36 ± 16 and 75 ± 35–fold increase in EC isolated using anti-CD31– and VEGFR2–coated beads, respectively. 
Figure 4.
 
Effect of coculture on endothelial VEGF mRNA and protein levels. VEGF mRNA (A) and protein (B) levels in ECs grown in contact coculture with either RPE cells or skin fibroblasts with and without exposure to hypoxia. Results were obtained in ECs isolated from EC-RPE cocultures using anti-VEGFR2– and anti-CD31–coated magnetic beads. (A) *P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC-RPE noncontact coculture; P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC contact coculture with skin fibroblasts; P < 0.05 for ECs subjected to hypoxia (incubation with CoCl2 for 12 hours in the absence of RPE) after 7 days of noncontact coculture with RPE versus ECs grown in noncontact coculture with RPE for 7 days followed by incubation for 12 hours in the absence of RPE without CoCl2. The results are expressed relative to untreated solo ECs; mean ± SD of three separate experiments performed in triplicate. *P < 0.05 versus solo EC. **P < 0.05 for hypoxia versus normoxia. The results are expressed in ng VEGF/100 μg protein; mean ± SD of three separate experiments performed in duplicate.
Figure 4.
 
Effect of coculture on endothelial VEGF mRNA and protein levels. VEGF mRNA (A) and protein (B) levels in ECs grown in contact coculture with either RPE cells or skin fibroblasts with and without exposure to hypoxia. Results were obtained in ECs isolated from EC-RPE cocultures using anti-VEGFR2– and anti-CD31–coated magnetic beads. (A) *P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC-RPE noncontact coculture; P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC contact coculture with skin fibroblasts; P < 0.05 for ECs subjected to hypoxia (incubation with CoCl2 for 12 hours in the absence of RPE) after 7 days of noncontact coculture with RPE versus ECs grown in noncontact coculture with RPE for 7 days followed by incubation for 12 hours in the absence of RPE without CoCl2. The results are expressed relative to untreated solo ECs; mean ± SD of three separate experiments performed in triplicate. *P < 0.05 versus solo EC. **P < 0.05 for hypoxia versus normoxia. The results are expressed in ng VEGF/100 μg protein; mean ± SD of three separate experiments performed in duplicate.
To exclude the possibility that contamination with RPE was responsible for the elevated VEGF mRNA level in ECs isolated by VEGFR2–coated beads, we examined the VEGF mRNA level in EC/RPE mixtures at the ratio of 9:1 (corresponding to 10% contamination demonstrated by the experiment described above). The VEGF mRNA level in these mixtures was increased 1.8 ± 0.5-fold compared with EC alone. 
Exposure of solo EC to hypoxia induced a 39 ± 10-fold upregulation in the endothelial VEGF level. Subjection of the contact RPE/EC coculture to hypoxia did not significantly affect the level of EC VEGF mRNA beyond the enhancement induced by coculture with RPE cells (Fig. 4). Contact coculture of ECs with skin fibroblasts instead of RPE cells did not affect the level of endothelial VEGF mRNA, indicating that the upregulation in VEGF mRNA induced by contact coculture was unique to RPE cells. 
Analysis of intracellular VEGF protein levels by ELISA revealed a ∼3-fold increase in EC VEGF protein level after either contact coculture with RPE cells or exposure of solo EC to hypoxia (Fig. 4B), supporting the results obtained by RT-PCR analysis. 
Coculture with RPE cells in the noncontact model affected neither the mRNA nor the protein level of EC VEGF (Figs. 4A, 4B). 
In view of the lack of effect of noncontact coculture on EC VEGF expression, we examined the capacity of ECs grown in noncontact coculture with RPE to respond to hypoxia. ECs cultured in transwells (noncontact coculture with RPE) for 7 days were transferred to empty wells and exposed to CoCl2. After incubation with CoCl2, the VEGF and HIF1A mRNA levels were increased 16.5 ± 8.5-fold and 1.8 ± 0.3-fold, respectively, compared with ECs cultured under the same conditions without CoCl2
Analysis of PEDF Levels
The EC PEDF mRNA was increased 1.8 ± 0.5-fold after contact coculture with RPE cells. However, intracellular PEDF levels in extracts of ECs isolated from contact coculture were similar to those observed in solo ECs. Furthermore, PEDF protein levels observed in the conditioned medium of EC-RPE contact coculture were similar to those measured in the mixture of conditioned media collected from solo RPE and solo EC cultures (data not shown). 
Analysis of EC Genes Involved in Angiogenesis Regulation after Coculture with RPE and Exposure to Hypoxia
After observation of enhanced VEGF expression in ECs after coculture in contact with RPE cells, we examined other genes involved in regulation of angiogenesis. 
Using a PCR array including 88 genes encoding proteins involved in angiogenesis, we compared ECs grown in contact coculture with RPE cells to solo ECs subjected to hypoxia. The results are presented in Table 1
Table 1.
 
Expression of Pro-Angiogenic Genes by ECs after Contact Coculture with RPE Cells and Exposure to Hypoxia
Table 1.
 
Expression of Pro-Angiogenic Genes by ECs after Contact Coculture with RPE Cells and Exposure to Hypoxia
Gene Ratio between mRNA Level in ECs Grown in Contact Coculture with RPE and mRNA Level in Solo EC
Separation by anti-VEGFR2 Separation by anti–CD-31 Ratio between mRNA Level in Solo ECs Subjected to Hypoxia and mRNA Level in Solo ECs under Normoxia
ANGLPT3 50.8 4.2 67.5
Collagen IV 3526.4 1047 868.9
EGF 6.9 2.0 4.5
FGF1 35.1 36.1 5.8
FGF2 20.6 9.4 10.9
FGFR3 81.7 2.9 35.2
HIF1A 5.4 6.2 2.5
IL1B 2.1 5.4 2.3
Alpha v 20.8 3.3 13.0
MMP2 2.6 2.1 2.7
TGFA 5.2 9.1 6.2
TGFB2 6.8 9.5 2.4
TGFBR 7.1 2.7 6.5
TNFA 4.3 1.7 9.3
VEGFA 183.9 75.7 147.2
VEGFC 4.4 2.0 6.5
Table 2.
 
Sequences of Oligonucleotide Primers Used in Real-Time PCR Assays
Table 2.
 
Sequences of Oligonucleotide Primers Used in Real-Time PCR Assays
Gene Forward Primer Reverse Primer
GAPDH ccacatcgctcagacaccat ggcaacaatatccactttaccagagt
HPRT gaccagtcaacaggggacat cctgaccaaggaaagcaaag
VEGF tcctcacaccattgaaacca gatcctgccctgtctctctg
MMP2 atgacagctgcaccactgag agttcccaccaacagtggac
HIF1A ccacctatgacctgcttggt tatccaggctgtgtcgactg
PEDF cccgctggactatcacctta cctcgggttttcttctaggg
Sixteen out of the 88 genes, all of which are involved in positive regulation of angiogenesis, were elevated to a similar extent in both ECs grown in contact coculture with RPE cells under normoxia and solo ECs subjected to hypoxia. 
Analysis of MMP Expression and Activity
To examine additional processes involved in angiogenesis, we examined changes in MMP levels. MMPs were tested both for mRNA levels using quantitative RT-PCR, and for protein activity levels using zymography. RT-PCR analysis using angiogenesis PCR array demonstrated upregulation of endothelial MMP2 mRNA level after contact coculture with RPE cells (Table 1). No change was observed in the mRNA level of MMP9 (data not shown). Further RT-PCR analysis demonstrated that the level of endothelial MMP2 mRNA was significantly increased after contact coculture with RPE cells and remained unchanged in noncontact coculture (Fig. 5A). 
Figure 5.
 
Effect of coculture on MMP2 levels. (A) EC MMP2 mRNA levels after contact versus noncontact coculture with RPE cells. ECs were separated from contact coculture using either anti-VEGFR2 antibody or anti-CD31 antibody. Results are expressed relatively to solo EC (control). *P < 0.05 versus noncontact coculture. (B) MMP2 activity levels in conditioned media of solo ECs and solo RPE (mixture of conditioned media of the two cell cultures grown separately) and EC + RPE cells grown in noncontact and contact coculture analyzed by zymography. Note the ∼2-fold enhancement in the activity of MMP2 in contact EC-RPE coculture compared with solo cultures, but not in noncontact coculture. MMP9 activity was not significantly affected by either contact or noncontact coculture conditions.
Figure 5.
 
Effect of coculture on MMP2 levels. (A) EC MMP2 mRNA levels after contact versus noncontact coculture with RPE cells. ECs were separated from contact coculture using either anti-VEGFR2 antibody or anti-CD31 antibody. Results are expressed relatively to solo EC (control). *P < 0.05 versus noncontact coculture. (B) MMP2 activity levels in conditioned media of solo ECs and solo RPE (mixture of conditioned media of the two cell cultures grown separately) and EC + RPE cells grown in noncontact and contact coculture analyzed by zymography. Note the ∼2-fold enhancement in the activity of MMP2 in contact EC-RPE coculture compared with solo cultures, but not in noncontact coculture. MMP9 activity was not significantly affected by either contact or noncontact coculture conditions.
Conditioned media were collected from contact coculture, noncontact coculture, and ECs and RPE cells grown separately (as described in Materials and Methods), followed by analysis of MMPs activity in the various media. As demonstrated by zymography, ECs and RPE cells grown in the contact coculture model exhibited a ∼2-fold enhancement in the activity of MMP2, compared with that of a mixture of conditioned media collected from EC and RPE cultures separately. No enhancement in MMP2 activity was observed in the noncontact coculture of ECs with RPE cells. The activity of MMP9 remained unchanged in both coculture models (Fig. 5B). 
Matrigel Tube Formation Assay
Matrigel tube formation assay was used to evaluate the proangiogenic activity of ECs grown in coculture with RPE cells. After coculture in contact with RPE cells, ECs demonstrated enhanced tube formation on Matrigel after 3 hours of incubation, compared with control ECs. No difference between control ECs and ECs separated from coculture could be observed after 6 hours of incubation on Matrigel (Figs. 6A, 6B). 
Figure 6.
 
Effect of contact coculture on tube formation capacity of EC. (A) Tube formation on Matrigel by ECs isolated by anti-CD31–coated beads from contact versus noncontact coculture with RPE cells, compared with control ECs (solo EC subjected to the procedure of isolation by anti-CD31–coated beads). (B) Quantitation performed by counting the number of tubes per field in three fields from two wells (two separate experiments). *P < 0.05 versus control ECs and ECs after noncontact coculture.
Figure 6.
 
Effect of contact coculture on tube formation capacity of EC. (A) Tube formation on Matrigel by ECs isolated by anti-CD31–coated beads from contact versus noncontact coculture with RPE cells, compared with control ECs (solo EC subjected to the procedure of isolation by anti-CD31–coated beads). (B) Quantitation performed by counting the number of tubes per field in three fields from two wells (two separate experiments). *P < 0.05 versus control ECs and ECs after noncontact coculture.
ECs cocultured with RPE cells in the noncontact model did not demonstrate enhanced tube formation on Matrigel at either a 3- or 6-hour time point (Figs. 6A, 6B). 
Discussion
The choriocapillaries are normally separated from the RPE layer by the Bruch's membrane. Thus, under normal physiological conditions, there is no direct contact between RPE cells and endothelial cells of the choriocapillaries. However, pathologic conditions, such as angioid streaks (irregular crack-like dehiscences in the Bruch's membrane), 16 traumatic choroidal rupture, 1 laser burns, 17 and pathologic myopia, 3 all which are characterized by disruption and disorganization of the retinal pigment epithelium layer and the Bruch's membrane, possibly involving direct EC-RPE contact, are associated with CNV formation. We used a model of EC-RPE coculture that recapitulates the conditions when RPE cells are no longer polarized and ECs are activated; therefore, the physiologic apposition of EC to basal RPE is lost. 
The precise mechanisms underlying the development of pathologic neovascular blood vessels from the normal choriocapillaries layer are not entirely understood. However, it is conceivable that this transformation involves both RPE cells and ECs. Numerous studies suggest existence of a pathologic cascade initiated by changes in the RPE barrier function, 2 followed by activation of ECs, thus leading to EC proliferation, migration, invasion via degradation of extracellular matrix by MMPs, 18 and formation of pathologic choroidal blood vessels. 
RPE cells have been shown to play an inductive role in the vascular development of the choroids. 19,20 During the embryonic phase of eye development, formation of the choriocapillaries is linked to pigmentation. The choroidal vasculature never forms properly if the RPE layer fails to develop, as is the situation with colobomas. 21 Zhao and Overbeek have developed a mouse model in which the RPE layer could be induced to differentiate into neural retina. 22 The authors have further demonstrated that no vascular structures were present in regions where the RPE layer was converted to neural retina, suggesting that the choroid fails to form properly in the absence of RPE. 19 Furthermore, RPE cells are also considered to be the major source of VEGF in the retina. 23,24 According to the commonly accepted paradigm, VEGF secreted by the RPE cells triggers pro-angiogenic responses in ECs via paracrine activation. 25 Indeed, inhibition of VEGF synthesis in RPE cells using knockdown of HIF-1α was shown to inhibit proliferation, migration, and tube formation in ECs grown in noncontact coculture with these cells. 12 In addition, CNV was shown to be dramatically inhibited by inhibition of VEGF receptor tyrosine kinase activity in a mouse model of CNV, further emphasizing the importance of paracrine activation of EC VEGF receptors. 26 However, autocrine activation by endothelial VEGF may significantly contribute to this process, as suggested by studies in knockout mice. Genetic ablation experiments have demonstrated that deletion of VEGF specifically in endothelial cells is associated with endothelial degeneration and increased lethality, despite normal levels of circulating VEGF protein observed in the mutant mice. 27 This important study, showing that the lack of endothelial VEGF could not be compensated by VEGF secreted by other cells, indicates that although the quantitative contribution of endothelial VEGF to the total VEGF level may be negligible, autocrine VEGF signaling in ECs is of high functional significance. Of note, overexpression of endogenous endothelial VEGF was reported to be associated with cerebral arteriovascular malfolmartions, further indicating the crucial importance of regulation of endothelial VEGF expression. 28  
In the present study, we investigated the effects of RPE-EC interaction in both contact and noncontact coculture models, representing pathologic and normal conditions, respectively, on the angiogenic behavior of EC per se. After coculture in direct contact, ECs were separated from RPE cells using either anti-CD31– or anti-VEGFR2–coated magnetic beads. This procedure enabled us to examine the angiogenic properties of ECs after direct contact with RPE cells. ECs cocultured in contact with RPE, followed by separation from the mixed culture, exhibited enhanced angiogenic properties, including increased expression of VEGF and MMP2 at both mRNA and protein levels. Furthermore, ECs grown in contact with RPE cells demonstrated upregulated mRNA levels of several other proangiogenic genes, which were also upregulated after exposure of solo ECs to hypoxia (see Table 1). Of note, the levels of endothelial PEDF, a potent inhibitor of angiogenesis counteracting VEGF, 29 were not affected by growing ECs in contact coculture with RPE. Interestingly, neither mRNA nor protein levels of EC VEGFR2 were affected by contact coculture (data not shown). However, enhanced VEGFR2–mediated signaling is possible in view of the functional studies of Matrigel tube formation, indicating accelerated tube formation rate induced by exposure of ECs to contact coculture with RPE. It must be emphasized that the proangiogenic effects described above were observed only in ECs grown in direct contact with RPE cells; none of these effects could be observed in ECs separated from RPE cells after noncontact coculture. This profound importance of RPE-EC contact was evident in both mRNA and protein assays of VEGF and MMP2, as well as in Matrigel tube formation assay. Our findings indicating the significance of RPE-EC contact are in agreement with those of Peterson et al., 11 who demonstrated that direct contact of ECs with RPE and/or RPE extracellular matrix enhances EC transmigration through the RPE barrier. This enhanced migration was found to be associated with increased activity of the GTPase Rac1 in the ECs, mediated by activation of PI3K and Akt-1. 11 It must be noted that Hartnett et al., 30 who investigated the effect of EC-RPE interaction on the RPE barrier function, discovered that coculture with EC induced RPE barrier dysfunction in both contact and noncontact coculture. The observation that ECs residing in close proximity with RPE exerted a deleterious effect on RPE barrier function independent of direct contact with the RPE cells indicated that this effect was mediated by a soluble factor, and VEGF was proposed to be a likely candidate. 30 However, in view of the fact that inhibition of VEGF was only partially effective in the restoration of RPE barrier function, 30 involvement of other molecular mechanisms in this process cannot be excluded. For example, involvement of FGF2 in CNV is suggested by a recent study showing that combined inhibition of VEGF and FGF2 is more effective in inhibiting RPE-induced angiogenesis in an in vitro model, compared with exclusive inhibition of VEGF. 31 The latter observation is an agreement with the data of Geisen et al. 9 showing that RPE-induced enhancement of EC proliferation, observed to be independent of direct EC-RPE contact, was not mediated by VEGF. 
Our findings indicating that direct contact between RPE cells and ECs promotes angiogenesis are supported by various animals models of CNV, demonstrating extensive blood vessel growth after disruption of the Bruch's membrane either mechanically 4 or by laser photocoagulation. 7 Of note, our observations are in agreement with the results of in vivo study performed by Ida et al. 32 in mice with sustained VEGF expression, demonstrating that RPE cells modulate neovascularization by proliferating and surrounding the new vessels in an attempt to reestablish the blood-retinal barrier, but fail to cause vessel regression. This failure may reflect enhanced proangiogenic potential of EC after prolonged contact with RPE. 
Based on the results presented in this study and findings described in the literature, it seems possible that the contact of ECs with RPE due to Bruch's membrane disruption further compromises RPE barrier function, 30 followed by induction of VEGF and MMP2 activity in ECs, thus further enhancing Bruch's membrane degradation and promoting CNV development and invasion into the retina. 
Footnotes
 Disclosure: R. Dardik, None; T. Livnat, None; Y. Nisgav, None; D. Weinberger, None
References
Grossniklaus HE Green WR . Choroidal neovascularization. Am J Ophthalmol. 2004;137:496–503. [CrossRef] [PubMed]
Lassota N . Clinical and histological aspects of CNV formation: studies in an animal model (Thesis 2). Acta Ophthalmol. 2008;86:1–24. [CrossRef] [PubMed]
Miller DG Singerman LJ . Natural history of choroidal neovascularization in high myopia. Curr Opin Ophthalmol. 2001;12:222–224. [CrossRef] [PubMed]
Lassota N Kiilgaard JF la Cour M Scherfig E Prause JU . Natural history of choroidal neovascularization after surgical induction in an animal model. Acta Ophthalmol. 2008;86:495–503. [CrossRef] [PubMed]
Spaide RF . Choroidal neovascularization in younger patients. Curr Opin Ophthalmol. 1999;10:177–181. [CrossRef] [PubMed]
Ohno-Matsui K Yoshida T Futagami S . Patchy atrophy and lacquer cracks predispose to the development of choroidal neovascularisation in pathological myopia. Br J Ophthalmol. 2003;87:570–573. [CrossRef] [PubMed]
Ryan SJ . Subretinal neovascularization. Natural history of an experimental model. Arch Ophthalmol. 1982;100:1804–1809. [CrossRef] [PubMed]
Grossniklaus HE Miskala PH Green WR . Histopathologic and ultrastructural features of surgically excised subfoveal choroidal neovascular lesions: submacular surgery trials report no. 7. Arch Ophthalmol. 2005;123:914–921. [CrossRef] [PubMed]
Geisen P McColm JR Hartnett ME . Choroidal endothelial cells transmigrate across the retinal pigment epithelium but do not proliferate in response to soluble vascular endothelial growth factor. Exp Eye Res. 2006;82:608–619. [CrossRef] [PubMed]
Sakamoto T Sakamoto H Murphy TL . Vessel formation by choroidal endothelial cells in vitro is modulated by retinal pigment epithelial cells. Arch Ophthalmol. 1995;113:512–520. [CrossRef] [PubMed]
Peterson LJ Wittchen ES Geisen P Burridge K Hartnett ME . Heterotypic RPE-choroidal endothelial cell contact increases choroidal endothelial cell transmigration via PI 3-kinase and Rac1. Exp Eye Res. 2007;84:737–744. [CrossRef] [PubMed]
Zhao W Wang YS Hui YN . Inhibition of proliferation, migration and tube formation of choroidal microvascular endothelial cells by targeting HIF-1alpha with short hairpin RNA-expressing plasmid DNA in human RPE cells in a coculture system. Graefes Arch Clin Exp Ophthalmol. 2008;246:1413–1422. [CrossRef] [PubMed]
Shao R Guo X . Human microvascular endothelial cells immortalized with human telomerase catalytic protein: a model for the study of in vitro angiogenesis. Biochem Biophys Res Commun. 2004;321:788–794. [CrossRef] [PubMed]
Kim KS Rajagopal V Gonsalves C Johnson C Kalra VK . A novel role of hypoxia-inducible factor in cobalt chloride- and hypoxia-mediated expression of IL-8 chemokine in human endothelial cells. J Immunol. 2006;177:7211–7224. [CrossRef] [PubMed]
Yuan Y Hilliard G Ferguson T Millhorn DE . Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha. J Biol Chem. 2003;278:15911–15916. [CrossRef] [PubMed]
Georgalas I Papaconstantinou D Koutsandrea C . Angioid streaks, clinical course, complications, and current therapeutic management. Ther Clin Risk Manag. 2009;5:81–89. [PubMed]
Ying HS Symons RC Lin KL Solomon SD Gehlbach PL . Accidental Nd:YAG laser-induced choroidal neovascularization. Lasers Surg Med. 2008;40:240–242. [CrossRef] [PubMed]
Berglin L Sarman S van der Ploeg I . Reduced choroidal neovascular membrane formation in matrix metalloproteinase-2-deficient mice. Invest Ophthalmol Vis Sci. 2003;44:403–408. [CrossRef] [PubMed]
Zhao S Overbeek PA . Regulation of choroid development by the retinal pigment epithelium. Mol Vis. 2001;7:277–282. [PubMed]
Marneros AG Fan J Yokoyama Y . Vascular endothelial growth factor expression in the retinal pigment epithelium is essential for choriocapillaris development and visual function. Am J Pathol. 2005;167:1451–1459. [CrossRef] [PubMed]
Torczynski E . Normal and abnormal ocular development in man. Prog Clin Biol Res. 1982;82:35–51. [PubMed]
Zhao S Overbeek PA . Tyrosinase-related protein 2 promoter targets transgene expression to ocular and neural crest-derived tissues. Dev Biol. 1999;216:154–163. [CrossRef] [PubMed]
Kvanta A Algvere PV Berglin L Seregard S . Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor. Invest Ophthalmol Vis Sci. 1996;37:1929–1934. [PubMed]
Lopez PF Sippy BD Lambert HM Thach AB Hinton DR . Transdifferentiated retinal pigment epithelial cells are immunoreactive for vascular endothelial growth factor in surgically excised age-related macular degeneration-related choroidal neovascular membranes. Invest Ophthalmol Vis Sci. 1996;37:855–868. [PubMed]
Ng EW Adamis AP . Targeting angiogenesis, the underlying disorder in neovascular age-related macular degeneration. Can J Ophthalmol. 2005;40:352–368. [CrossRef] [PubMed]
Kwak N Okamoto N Wood JM Campochiaro PA . VEGF is major stimulator in model of choroidal neovascularization. Invest Ophthalmol Vis Sci. 2000;41:3158–3164. [PubMed]
Lee S Chen TT Barber CL . Autocrine VEGF signaling is required for vascular homeostasis. Cell. 2007;130:691–703. [CrossRef] [PubMed]
Jabbour MN Elder JB Samuelson CG . Aberrant angiogenic characteristics of human brain arteriovenous malformation endothelial cells. Neurosurgery. 2009;64:139–146; discussion 146–138. [CrossRef] [PubMed]
Zhang SX Wang JJ Gao G Parke K Ma JX . Pigment epithelium-derived factor downregulates vascular endothelial growth factor (VEGF) expression and inhibits VEGF-VEGF receptor 2 binding in diabetic retinopathy. J Mol Endocrinol. 2006;37:1–12. [CrossRef] [PubMed]
Hartnett ME Lappas A Darland D McColm JR Lovejoy S D'Amore PA . Retinal pigment epithelium and endothelial cell interaction causes retinal pigment epithelial barrier dysfunction via a soluble VEGF-dependent mechanism. Exp Eye Res. 2003;77:593–599. [CrossRef] [PubMed]
Stahl A Paschek L Martin G Feltgen N Hansen LL Agostini HT . Combinatory inhibition of VEGF and FGF2 is superior to solitary VEGF inhibition in an in vitro model of RPE-induced angiogenesis. Graefes Arch Clin Exp Ophthalmol. 2009;247:767–773. [CrossRef] [PubMed]
Ida H Tobe T Nambu H Matsumura M Uyama M Campochiaro PA . RPE cells modulate subretinal neovascularization, but do not cause regression in mice with sustained expression of VEGF. Invest Ophthalmol Vis Sci. 2003;44:5430–5437. [CrossRef] [PubMed]
Figure 1.
 
Immunostaining of ECs with anti-vWF antibody. Representative pictures of immunostaining of EC with anti-vWF antibody in contact and noncontact coculture with RPE. DAPI was used for nuclei staining. (A) Contact coculture. (B) Contact coculture, (C) Noncontact coculture. (D) EC alone. Magnification: (A, C, D) ×200; (B) ×400.
Figure 1.
 
Immunostaining of ECs with anti-vWF antibody. Representative pictures of immunostaining of EC with anti-vWF antibody in contact and noncontact coculture with RPE. DAPI was used for nuclei staining. (A) Contact coculture. (B) Contact coculture, (C) Noncontact coculture. (D) EC alone. Magnification: (A, C, D) ×200; (B) ×400.
Figure 2.
 
Examination of solo RPE cells and solo ECs for the expression of CD31 (top panel) and VEGFR2 (bottom panel) by flow cytometry. RPE cells do not express CD31, as opposed to intensive CD31 surface expression observed on ECs. VEGFR2 was detected on the surface of both cell types; however, the staining intensity was much higher on ECs.
Figure 2.
 
Examination of solo RPE cells and solo ECs for the expression of CD31 (top panel) and VEGFR2 (bottom panel) by flow cytometry. RPE cells do not express CD31, as opposed to intensive CD31 surface expression observed on ECs. VEGFR2 was detected on the surface of both cell types; however, the staining intensity was much higher on ECs.
Figure 3.
 
Isolation of ECs from EC-RPE contact coculture using magnetic beads coated with either anti-VGFR2 (left panel) or anti-CD31 (right panel) antibodies. ECs were separated from EC-RPE contact cocultures using magnetic beads coated with either anti-VEGFR2 or anti-CD31 antibodies. Isolated ECs were further examined for the expression of VEGFR2 or CD31 by flow cytometry analysis, using PE-conjugated anti- VEGFR2 or PE-conjugated anti-CD31 antibodies, respectively. The VEGFR2 graph shows weak expression of VEGFR2 on the surface of solo RPE cells (black histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-VEGFR2–coated magnetic beads (green histogram). The CD31 graph shows no expression of CD31 on RPE cells (a gray-filled histogram completely overlapping the nonimmune IgG histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-CD31–coated magnetic beads (green histogram). Bottom panel: immunostaining of ECs isolated from EC-RPE contact coculture using anti-CD31–coated beads with anti-vWF antibody. Left: vWF antibody+DAPI; right: second antibody only + DAPI.
Figure 3.
 
Isolation of ECs from EC-RPE contact coculture using magnetic beads coated with either anti-VGFR2 (left panel) or anti-CD31 (right panel) antibodies. ECs were separated from EC-RPE contact cocultures using magnetic beads coated with either anti-VEGFR2 or anti-CD31 antibodies. Isolated ECs were further examined for the expression of VEGFR2 or CD31 by flow cytometry analysis, using PE-conjugated anti- VEGFR2 or PE-conjugated anti-CD31 antibodies, respectively. The VEGFR2 graph shows weak expression of VEGFR2 on the surface of solo RPE cells (black histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-VEGFR2–coated magnetic beads (green histogram). The CD31 graph shows no expression of CD31 on RPE cells (a gray-filled histogram completely overlapping the nonimmune IgG histogram), a mixed population of RPE and ECs stained immediately after detachment by EDTA (turquoise histogram), and ECs isolated by anti-CD31–coated magnetic beads (green histogram). Bottom panel: immunostaining of ECs isolated from EC-RPE contact coculture using anti-CD31–coated beads with anti-vWF antibody. Left: vWF antibody+DAPI; right: second antibody only + DAPI.
Figure 4.
 
Effect of coculture on endothelial VEGF mRNA and protein levels. VEGF mRNA (A) and protein (B) levels in ECs grown in contact coculture with either RPE cells or skin fibroblasts with and without exposure to hypoxia. Results were obtained in ECs isolated from EC-RPE cocultures using anti-VEGFR2– and anti-CD31–coated magnetic beads. (A) *P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC-RPE noncontact coculture; P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC contact coculture with skin fibroblasts; P < 0.05 for ECs subjected to hypoxia (incubation with CoCl2 for 12 hours in the absence of RPE) after 7 days of noncontact coculture with RPE versus ECs grown in noncontact coculture with RPE for 7 days followed by incubation for 12 hours in the absence of RPE without CoCl2. The results are expressed relative to untreated solo ECs; mean ± SD of three separate experiments performed in triplicate. *P < 0.05 versus solo EC. **P < 0.05 for hypoxia versus normoxia. The results are expressed in ng VEGF/100 μg protein; mean ± SD of three separate experiments performed in duplicate.
Figure 4.
 
Effect of coculture on endothelial VEGF mRNA and protein levels. VEGF mRNA (A) and protein (B) levels in ECs grown in contact coculture with either RPE cells or skin fibroblasts with and without exposure to hypoxia. Results were obtained in ECs isolated from EC-RPE cocultures using anti-VEGFR2– and anti-CD31–coated magnetic beads. (A) *P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC-RPE noncontact coculture; P < 0.05 for ECs isolated from EC-RPE contact coculture versus EC contact coculture with skin fibroblasts; P < 0.05 for ECs subjected to hypoxia (incubation with CoCl2 for 12 hours in the absence of RPE) after 7 days of noncontact coculture with RPE versus ECs grown in noncontact coculture with RPE for 7 days followed by incubation for 12 hours in the absence of RPE without CoCl2. The results are expressed relative to untreated solo ECs; mean ± SD of three separate experiments performed in triplicate. *P < 0.05 versus solo EC. **P < 0.05 for hypoxia versus normoxia. The results are expressed in ng VEGF/100 μg protein; mean ± SD of three separate experiments performed in duplicate.
Figure 5.
 
Effect of coculture on MMP2 levels. (A) EC MMP2 mRNA levels after contact versus noncontact coculture with RPE cells. ECs were separated from contact coculture using either anti-VEGFR2 antibody or anti-CD31 antibody. Results are expressed relatively to solo EC (control). *P < 0.05 versus noncontact coculture. (B) MMP2 activity levels in conditioned media of solo ECs and solo RPE (mixture of conditioned media of the two cell cultures grown separately) and EC + RPE cells grown in noncontact and contact coculture analyzed by zymography. Note the ∼2-fold enhancement in the activity of MMP2 in contact EC-RPE coculture compared with solo cultures, but not in noncontact coculture. MMP9 activity was not significantly affected by either contact or noncontact coculture conditions.
Figure 5.
 
Effect of coculture on MMP2 levels. (A) EC MMP2 mRNA levels after contact versus noncontact coculture with RPE cells. ECs were separated from contact coculture using either anti-VEGFR2 antibody or anti-CD31 antibody. Results are expressed relatively to solo EC (control). *P < 0.05 versus noncontact coculture. (B) MMP2 activity levels in conditioned media of solo ECs and solo RPE (mixture of conditioned media of the two cell cultures grown separately) and EC + RPE cells grown in noncontact and contact coculture analyzed by zymography. Note the ∼2-fold enhancement in the activity of MMP2 in contact EC-RPE coculture compared with solo cultures, but not in noncontact coculture. MMP9 activity was not significantly affected by either contact or noncontact coculture conditions.
Figure 6.
 
Effect of contact coculture on tube formation capacity of EC. (A) Tube formation on Matrigel by ECs isolated by anti-CD31–coated beads from contact versus noncontact coculture with RPE cells, compared with control ECs (solo EC subjected to the procedure of isolation by anti-CD31–coated beads). (B) Quantitation performed by counting the number of tubes per field in three fields from two wells (two separate experiments). *P < 0.05 versus control ECs and ECs after noncontact coculture.
Figure 6.
 
Effect of contact coculture on tube formation capacity of EC. (A) Tube formation on Matrigel by ECs isolated by anti-CD31–coated beads from contact versus noncontact coculture with RPE cells, compared with control ECs (solo EC subjected to the procedure of isolation by anti-CD31–coated beads). (B) Quantitation performed by counting the number of tubes per field in three fields from two wells (two separate experiments). *P < 0.05 versus control ECs and ECs after noncontact coculture.
Table 1.
 
Expression of Pro-Angiogenic Genes by ECs after Contact Coculture with RPE Cells and Exposure to Hypoxia
Table 1.
 
Expression of Pro-Angiogenic Genes by ECs after Contact Coculture with RPE Cells and Exposure to Hypoxia
Gene Ratio between mRNA Level in ECs Grown in Contact Coculture with RPE and mRNA Level in Solo EC
Separation by anti-VEGFR2 Separation by anti–CD-31 Ratio between mRNA Level in Solo ECs Subjected to Hypoxia and mRNA Level in Solo ECs under Normoxia
ANGLPT3 50.8 4.2 67.5
Collagen IV 3526.4 1047 868.9
EGF 6.9 2.0 4.5
FGF1 35.1 36.1 5.8
FGF2 20.6 9.4 10.9
FGFR3 81.7 2.9 35.2
HIF1A 5.4 6.2 2.5
IL1B 2.1 5.4 2.3
Alpha v 20.8 3.3 13.0
MMP2 2.6 2.1 2.7
TGFA 5.2 9.1 6.2
TGFB2 6.8 9.5 2.4
TGFBR 7.1 2.7 6.5
TNFA 4.3 1.7 9.3
VEGFA 183.9 75.7 147.2
VEGFC 4.4 2.0 6.5
Table 2.
 
Sequences of Oligonucleotide Primers Used in Real-Time PCR Assays
Table 2.
 
Sequences of Oligonucleotide Primers Used in Real-Time PCR Assays
Gene Forward Primer Reverse Primer
GAPDH ccacatcgctcagacaccat ggcaacaatatccactttaccagagt
HPRT gaccagtcaacaggggacat cctgaccaaggaaagcaaag
VEGF tcctcacaccattgaaacca gatcctgccctgtctctctg
MMP2 atgacagctgcaccactgag agttcccaccaacagtggac
HIF1A ccacctatgacctgcttggt tatccaggctgtgtcgactg
PEDF cccgctggactatcacctta cctcgggttttcttctaggg
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×