July 2010
Volume 51, Issue 7
Free
Glaucoma  |   July 2010
Neuroprotective Effects of C-Type Natriuretic Peptide on Rat Retinal Ganglion Cells
Author Affiliations & Notes
  • Jia Ma
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
    the Department of Ophthalmology, the First Affiliated Hospital, Kunming Medical College, Kunming, People's Republic of China; and
  • Wenhan Yu
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Yun Wang
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Guiqun Cao
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Suping Cai
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Xiaoming Chen
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Naihong Yan
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Yuansheng Yuan
    the Department of Ophthalmology, the First Affiliated Hospital, Kunming Medical College, Kunming, People's Republic of China; and
  • Hong Zeng
    Glaucoma Research, Alcon Research, Ltd., Fort Worth, Texas.
  • Debra L. Fleenor
    Glaucoma Research, Alcon Research, Ltd., Fort Worth, Texas.
  • Xuyang Liu
    From the Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, People's Republic of China;
  • Iok-Hou Pang
    Glaucoma Research, Alcon Research, Ltd., Fort Worth, Texas.
  • Corresponding author: Xuyang Liu, Ophthalmic Laboratories and Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, 610041, People's Republic of China; xliu1213@gmail.com
  • Footnotes
    3  These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.
Investigative Ophthalmology & Visual Science July 2010, Vol.51, 3544-3553. doi:10.1167/iovs.09-5049
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Jia Ma, Wenhan Yu, Yun Wang, Guiqun Cao, Suping Cai, Xiaoming Chen, Naihong Yan, Yuansheng Yuan, Hong Zeng, Debra L. Fleenor, Xuyang Liu, Iok-Hou Pang; Neuroprotective Effects of C-Type Natriuretic Peptide on Rat Retinal Ganglion Cells. Invest. Ophthalmol. Vis. Sci. 2010;51(7):3544-3553. doi: 10.1167/iovs.09-5049.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To evaluate the potential neuroprotective effects of C-type natriuretic peptide (CNP) on rat retinal ganglion cells (RGCs).

Methods.: Cultured adult rat retinal cells were treated with vehicle, CNP, or atrial natriuretic peptide (ANP), followed by cytotoxic insults (glutamate, TNFα, or withdrawal of trophic factor). RGC survival was analyzed by counting Thy-1-positive cells in each well. For in vivo evaluation, N-methyl-d-aspartate (NMDA) with or without CNP was injected intravitreally into rat eyes. At various time points after injection, retinal cross-sections were analyzed for thickness changes in the retinal layers, and retinal flat mounts were assessed by counting cresyl violet–labeled or TUNEL-positive cells. Expressions of natriuretic peptide receptor-B (NPRB) and apoptosis-related genes in retina, including Bcl-xL, BAX, and μ-calpain, were analyzed by quantitative reverse transcription–polymerase chain reaction (qRT-PCR).

Results.: At 50 and 500 nM, CNP, but not ANP, significantly (P < 0.05) protected against glutamate-insult and trophic factor withdrawal–induced RGC death in vitro. Neither peptide significantly affected TNFα-induced cytotoxicity. Intravitreal injection of NMDA (20 nanomoles) significantly (P < 0.05) decreased the thickness of the inner plexiform layer (IPL), induced cell loss, increased the number of TUNEL-positive cells in the RGC layer, and upregulated the expression of Bcl-xL, BAX, and μ-calpain. All these effects were significantly (P < 0.05) alleviated by concomitant injection of CNP (4.5 nmol, 10 μg). The neuroprotective effects of CNP were maintained up to 14 days after CNP injection.

Conclusions.: CNP protects rat RGCs against the apoptotic damage induced by insults such as excitatory amino acid, both in vitro and in vivo.

Glaucoma is a leading cause of vision loss worldwide. 1 It is estimated that 60.5 million people will have glaucoma in 2010, increasing to 79.6 million by 2020. 2 Glaucoma is a progressive optic neuropathy and retinopathy, caused by intraocular pressure (IOP) and other possible risk factors, such as age, race, family history, diabetes, pathologic myopia, and so on, resulting in the loss of retinal ganglion cells (RGCs) and eventually causing irreversible functional visual defect. 3,4 Although elevated IOP, among all risk factors, is an important one, reduction of IOP alone is often insufficient to prevent progression of glaucoma in some patients. 5,6 Therefore, neuroprotective strategies to minimize or delay RGC loss are critical for the future direction of glaucoma therapy. 
The pathophysiologic mechanism underlying RGC death in glaucoma remains unclear. Several theories have been proposed—for example, excitotoxicity, deprivation of trophic factors, vascular insufficiency, reactive gliosis, and immunologic abnormality. 49 However, none has been universally accepted. Correspondingly, various neuroprotective compounds and methods have been evaluated. Some are specifically designed to address a particular mechanism, whereas others can protect RGCs against multiple insults. 10  
C-type natriuretic peptide (CNP) is a member of the natriuretic peptide family. 11,12 Other members include atrial natriuretic peptide (ANP) 13 and brain natriuretic peptide (BNP). 14 These peptides interact with cytoplasmic membrane-spanning receptors, designated natriuretic peptide receptor (NPR)-A and -B. NPR-A has higher affinities for ANP and BNP, whereas NPRB preferentially binds to CNP. The receptors themselves are guanylyl cyclases. When activated, they exert their biological effects, mainly by increasing the production of cyclic (c)GMP. 1517 Systemically, the peptides are involved in diuresis, natriuresis, vasorelaxation, and antimitogenesis. 16,17  
In the eye, NPRs have been found in the anterior segment, such as ciliary processes, ciliary muscle, and trabecular meshwork. 18 Activation of these receptors increases the cGMP level in the cell, affects calcium influx, and in the case of ciliary muscle, decreases contractility. 1824 Functionally, the natriuretic peptides are potent ocular hypotensives. Intraocular injection of ANP, BNP, or CNP can lower rabbit IOP for hours or even days. Among these peptides, CNP is the most potent IOP-lowering member, indicating that NPRB is the major receptor subtype that mediates this effect. 23,25  
Natriuretic peptides and NPRs have also been found in the retina. By immunohistochemistry, ANP, BNP, and CNP were detected in the inner and outer plexiform and nuclear layers of the human retina, as well as the cytoplasm of RGCs. 26 In the rat and rabbit, the distribution of these peptides are similar, except that ANP appears absent in the RGCs. 27,28 Interestingly, ANP, BNP, and CNP were located in different parts of rat Müller cells. ANP and BNP are present in the main trunks and major processes, whereas, CNP localizes in the endfeet and major processes. These findings raise a possibility that these peptides, when released from the Müller cells, perform layer-specific functions in the retina. 27 Expression of NPR-A and -B in human and rat retina was verified by molecular cloning and RT-PCR. 18,26,2931 NPR-A expression in the ganglion cell layer, the inner nuclear layer, and the outer nuclear layer in the rat retina has been shown by immunohistochemistry. 32  
Although their biological functions in the retina are not well understood, the presence of natriuretic peptides and their receptors suggests a potential autocrine or paracrine function. Analogous to their putative roles in other tissues, the natriuretic peptides may modulate ion and fluid distributions between the intra- and extracellular space in the retina. They may serve as neurotransmitters or neuromodulators, similar to other neuropeptides. Most important, they may even act as neuroprotectants. In fact, ANP was implicated as contributing to the spreading depression-induced neuroprotection in the rat cerebral cortex. 33 In cultured PC12 cells, both ANP and BNP inhibit apoptotic DNA fragmentation and increase cell survival. 34 Recently, ANP was demonstrated to ameliorate NMDA-induced retinal neurotoxicity via NPR-A in the rat retina. Its effect is most likely mediated by dopamine and activation of the dopamine D1 receptor. 32  
To evaluate the potential direct neuroprotective effects of natriuretic peptides on RGCs, we tested ANP and CNP for their protective effects against several insults in cultured adult rat retina cells. We found that CNP, but not ANP, was efficacious. We then further evaluated CNP in an NMDA model of retinopathy and found that pretreatment with CNP provided a neuroprotective effect against NMDA-induced cell death in the retina. 
Methods
Experimental Animals
Young adult male Sprague-Dawley rats (∼8-week-old; body weight, 180–220 g) were used in the studies. They were housed in rooms where temperature (23 ± 1°C), humidity (55% ± 5%), and lighting (12-hour light/12-hour dark cycle) were controlled, and water and food were available ad libitum. The rats used in cultured RGC studies were from Charles River Laboratories (Wilmington, MA), and those used in the in vivo studies were from the Experimental Animal Center of Sichuan University (Chengdu, People's Republic of China). All studies were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
Retinal Ganglion Cell Culture
Culture of retinal neurons was performed as reported. 35 Briefly, rats were euthanatized by CO2 asphyxiation and their eyes enucleated. The retina from each eye was dissected and incubated in a papain solution, containing 2 mg/mL papain (Sigma-Aldrich, St. Louis, MO), 0.4 mg/mL dl-cysteine (Sigma-Aldrich), and 0.4 mg/mL bovine serum albumin (Sigma-Aldrich) in cell growth medium (Neurobasal; Gibco/Invitrogen, Carlsbad, CA), for 25 minutes at 37°C, then washed three times with RGC culture medium (Neurobasal/B27 medium [components from Sigma-Aldrich, unless otherwise specified], containing 100 U/mL penicillin, 100 μg/mL streptomycin, 1 mM pyruvate [Gibco/Invitrogen], 2 mM glutamine [Gibco/Invitrogen], 5 μg/mL insulin, 100 μg/mL transferrin, 100 μg/mL bovine serum albumin, 60 ng/mL progesterone, 16 μg/mL putrescine, 40 ng/mL sodium selenite, 40 ng/mL thyroxine, and 40 ng/mL tri-iodothyronine), 50 ng/mL brain-derived neurotrophic factor (BDNF; Biosource, Camarillo, CA), 10 ng/mL ciliary neurotrophic factor (CNTF; Biosource), 10 ng/mL basic fibroblast growth factor (bFGF; Biosource), 5 μM forskolin (Sigma-Aldrich), and 1% fetal calf serum (Atlas Biologicals, Fort Collins, CO). The retinal pieces were triturated by passing them through a fire-polished, disposable glass pipette until the cells were dispersed. Cell density in the suspension was assessed (Coulter counter; Beckman Coulter, Fullerton, CA). Cells (1 × 106–3 × 106 per well) were placed onto poly-d-lysine- and laminin-coated, eight-well culture slides (surface area, 0.69 cm2/well; BD BIosciences, Franklin Lakes, NJ) and cultured in 95% air/5% CO2 at 37°C. 
The cell cultures contained RGC-enriched retinal neurons. 35 More than 90% of the cells were neurons, and they labeled positively with neuron-specific enolase antibody. Approximately 20% to 30% of these cells expressed the RGC markers Thy-1 and neurofilament-L. Morphologically, the Thy-1-positive cells had the characteristic appearance of neurons. After 2 to 3 days in culture, neurite outgrowth typically had two to four main branches ∼20 to 50 μm in length. Cells in culture were negative for arrestin (photoreceptors), glial fibrillary acidic protein (astroglia and Müller cells), glutamine synthetase (Müller cells), and ED1 (microglia). Less than 10% of the cells were labeled with the protein kinase Cα antibody (rod bipolar cells). 35  
For glutamate-induced toxicity studies, the cells were pretreated with vehicle, ANP (Sigma-Aldrich), or CNP (Sigma-Aldrich) for 30 minutes, followed by 100 μM glutamate (Sigma-Aldrich) for 3 days. For TNFα-induced toxicity studies, the cells were pretreated with vehicle or the indicated compounds for 30 minutes, followed by 10 ng/mL TNFα (Sigma-Aldrich) for 3 days. For trophic factor withdrawal studies, three trophic factors, bFGF, BDNF, and CNTF, were removed from the culture medium. The cells were cultured in this medium with the indicated compounds for 3 days. At the end of the incubation period, the cells were fixed and labeled for Thy-1, an RGC marker, by immunocytochemistry (primary antibody against Thy-1, diluted 1:500; Chemicon, Temecula, CA; secondary antibody: AlexaFluor 594-labeled goat anti-mouse IgG, 1:300; Invitrogen/Molecular Probes, Eugene, OR). Cell survival was quantified by counting Thy-1-positive cells in each well. For each test condition, three wells were evaluated in each of two or three separate studies (n = 6–9). 
Intravitreal Injection
Before the in vivo studies, all eyes were examined routinely to exclude any disorders of the cornea, iris, pupil, lens, vitreous, and retina. On the day of intravitreal injection, the rats were anesthetized with an intraperitoneal injection of 10% chloral hydrate (3 mL/kg body weight; Kelong, Chengdu, China) and a topical drop of 0.4% hydrochloric oxybuprocaine (Santen, Osaka, Japan) on the cornea, and their pupils were dilated with 1% tropicamide (Mydrin-p; Japan). A single 5-μL bolus of (1) sterile 0.1 M PBS (pH 7.4) as the control, (2) 4 mM NMDA (total injected amount, 20 nanomoles; Sigma-Aldrich) in PBS, (3) 0.9 mM CNP (total injected amount, 4.5 nanomoles or 10 μg) in PBS, or (4) 4 mM NMDA+0.9 mM CNP, was injected intravitreally with a 10-μL microsyringe (Hamilton, Reno, NV) under an ophthalmic surgical microscope. Rats with postsurgical complications such as cataract or intravitreal hemorrhage were excluded from the studies. The remaining rats were killed by an intraperitoneal overdose injection of 10% chloral hydrate at the indicated time points (as shown in Figs. 2 3 4 5 6 78). The eyes were enucleated and prepared for the following assessments. 
Retina Cross-Section
Enucleated eyes were fixed in 4% paraformaldehyde (Kelong, Chengdu, China) in 0.1 M PBS (pH 7.4) for 24 hours at 4°C, followed by dehydration and paraffin embedding. Four-μm-thick cross sections through the optic disc were produced. The sections were dewaxed, rehydrated, and stained with hematoxylin-eosin (HE). Images of each section were acquired at 200× magnification, with a light microscope for morphologic analysis. Thickness measurements of various retinal layers were performed at a region 1.0 to 1.5 mm from the margin of the optic nerve head. Four images of each retina were chosen, and each image was measured three times. The mean of the 12 measurements for each retinal layer is reported as a single value for each retina. All quantifications were performed in a masked manner. For each time point of each test condition, four animals were used (n = 4). 
Retina Flat Mount
Rat eyes were oriented by a suture placed around the insertion of the superior rectus muscle, enucleated, fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.4) for 2 hours at room temperature, and washed two times in 0.1 M PBS. After the anterior segment was removed, a cut through the posterior eye cup was made opposite to the suture marker toward the optic nerve head. The retina was carefully separated from the sclera and dissected from the eye cup at the optic nerve head. The isolated retina was then placed on a 1% gelatin-treated glass slide with the vitreous side facing up, flattened by three shorter cuts, and flat mounted with a fine brush. The whole-retina flat mount was air dried and then immersed in 0.5% Triton X-100 for 1 minute. 
Ganglion Layer Cell Count
The treated retina flat mounts were stained with 0.1% cresyl violet for 20 to 30 minutes, dehydrated, and mounted with Canada balsam. Each retina was divided into superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. Each quadrant was further divided into central, midcentral, and peripheral regions. An image from each region, equivalent to 4.7 × 10−3-mm2 area, was acquired via a light microscope (Eclipse TE2000-U, Nikon Corp., Japan) at 400× magnification. The number of cresyl violet–stained neurons in the 12 images was counted; each image was counted three times. All 36 counts were averaged to give a mean value for each retina, expressed as the number of cells per square millimeter. During cell counting, no attempt was made to distinguish RGCs from displaced amacrine cells or other neuronlike cells. However, morphologically distinguishable glial cells, degenerated cells, and vascular endothelial cells were excluded from the cell counts. All quantification was performed in a masked manner. For each time point of each test condition, four animals were used. 
Apoptotic Cell Count
Apoptotic neurons in the retinal flat mounts were stained with TUNEL (Apop-Taq In Situ Apoptosis Detection Kit; Roche, Burgdorf, Switzerland) according to the manufacturer's protocol. The pretreated flat-mounted retinas were incubated in the nuclease-free proteinase K working solution for 10 minutes at 37°C and then in the TUNEL reaction mixture for 60 minutes at 37°C in a dark, humidified chamber. After the slides were rinsed with 0.01 M PBS and mounted with buffer glycerol, fluorescent images were taken with a fluorescence microscope at 200× magnification (area of each image, 1.9 × 10−2 mm2). The method of cell counting was the same as that described for ganglion cell layer cell counts. All quantification was performed in a masked manner. For each time point of each test condition, four animals were used. 
Quantitative Reverse Transcription–Polymerase Chain Reaction
Retinal levels of mRNA of NPRB, Bcl-xL, BAX, μ-calpain, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were analyzed by quantitative reverse transcription–polymerase chain reaction (qRT-PCR). Each sample consisted of a pool of three retinas. The reverse transcription of total RNA, extracted from rat retina (TRIzol Reagent; Invitrogen), was performed according to the method recommended by the manufacturer (RevertAid First Strand cDNA Synthesis Kit; Fermentas, Vilnius, Lithuania). Twelve microliters of mixture containing 2 μg retinal RNA, 1 μL oligo(dT) 18 (0.5 μg/μL), and complimentary DEPC-H2O was incubated at 70°C for 5 minutes, followed by adding 4 μL 5× reaction buffer, 1 μL RNase inhibitor (20 U/μL), 2 μL dNTP mix (10 mM), and 1 μL M-MuLv reverse transcriptase (200 U/μL). The total reaction mixture was incubated sequentially at 25°C for 10 minutes, 42°C for 1 hour, and 72°C for 10 minutes. The target cDNAs were amplified by PCR (MyCycler; Bio-Rad, Hercules, CA). PCR was performed in 30 μL of total reaction volume containing 2 μL template cDNA, 3 μL 10× PCR buffer, 3 μL MgCl2 (25 mM), 3 μL dNTP mix (2.5 mM), 0.9 μL of 10 pM specific sense and antisense primers for the different genes (Table 1), and 0.3 μL DNA polymerase (5 U/μL; Taq; Applied Biosystems, Inc. [ABI], Foster City, CA). The cycling protocol consisted of one cycle of 3 minutes at 94°C followed by 35 cycles of denaturation for 10 seconds at 94°C, annealing for 30 seconds at the proper temperature (Table 1), extension for 30 seconds at 72°C, and then extension for 10 minutes at 72°C. Fluorescence quantitative PCR was performed (iCycler; Bio-Rad). The total reaction mixture was the same as just stated, plus 0.2 μL 2× SYBR green (Invitrogen). The cycling protocol consisted of one cycle of 2 minutes at 94°C followed by 45 cycles of 10 seconds at 95°C, 10 seconds at 60°C, 40 seconds at 72°C, and 20 seconds at 84°C (for fluorescence collection and detection). The GAPDH mRNA level was used to normalize the mRNA levels of specific targets for each sample. Primers for specific cDNAs, synthesized by Invitrogen (Shanghai, China), are listed in Table 1
Table 1.
 
The Primers of the Specific Genes for the Real-Time Quantitative PCR
Table 1.
 
The Primers of the Specific Genes for the Real-Time Quantitative PCR
Gene Sequence Primers (5′→3′) Annealing Temperature (°C)
GAPDH (NM_017008) Sense CCTCAAGATTGTCAGCAAT 55
Anti-sense CCATCCACAGTCTTCTGAGT
NPRB (NM_053838) Sense CCAAATTCTACCCCACTCTG 60
Anti-sense TAAGAAGTGTCACCACCTGC
Bcl-xL (NM_031535) Sense CACCTACCTGAATGACCACCT 55
Anti-sense GCAGTTAGGGATCTCCACAG
BAX (NM_017059) Sense TTGTTACAGGGTTTCATCCAGG 55
Anti-sense AGACACTCGCTCAGCTTCTTG
μ-Calpain (NM_019152) Sense ACCCAGGAACTAGATGACCA 55
Anti-sense TACCGTCTCGATCCATGAGG
Statistical Analysis
Data are presented as the mean ± SEM. Differences among three or more groups were analyzed by one-way ANOVA followed by Bonferroni tests (SPSS 15.0 statistic analysis software for Window, SPSS Inc., Chicago, IL). Results with P < 0.05 were considered statistically significant. 
Results
Effects of Natriuretic Peptides on Cultured Rat RGC Survival
To determine whether natriuretic peptides are neuroprotective, we evaluated ANP and CNP in the cultured rat retinal cell model with three different insults: glutamate, TNFα, and withdrawal of trophic factor. We chose these cytotoxic insults because they have been implicated in glaucomatous retinopathy with different molecular mechanisms. 36 Under the conditions used in these studies, there were 100 to 200 RGCs per control well. Treatment with glutamate (100 μM), an excitatory amino acid, caused significant morphologic changes in many RGCs, including the loss of neurites, an increased number of vacuoles in the cytoplasm, and compromised integrity of the plasma membrane. 35 Incubation with glutamate also reduced the number of RGCs in culture. Only approximately 60% of cells survived after a 3-day treatment (Figs. 1A, 1B). The effect had been shown to be mediated mainly by the NMDA receptor, since MK801 was the most efficacious antagonist. 35 Incubation of the cells with CNP dose-dependently protected against glutamate-induced toxicity (Fig. 1B). Maximum protection was achieved by 50 nM CNP, where 88% ± 4% (mean ± SEM, n = 6) of RGCs survived the insult, significantly different (P < 0.001) from RGC survival with glutamate alone (62% ± 2%, n = 9; Fig. 1B). In contrast, ANP (5–500 nM) treatment did not produce significant protection (Fig. 1A). ANP or CNP by itself did not affect RGC survival (data not shown). 
Figure 1.
 
Effects of natriuretic peptides on survival of cultured adult rat RGCs. Cultured adult rat retinal cells were treated with the indicated concentrations of ANP (A, C, E) or CNP (B, D, F) in the presence of various insults: 100 μM of glutamate (A, B), 10 ng/mL TNFα (C, D), or trophic factor withdrawal (E, F). After a 3-day incubation, the cells were fixed and labeled with anti-Thy-1 antibody. Surviving RGCs were counted manually. Vehicle-treated (the no-insult control group in each experiment defined 100%). Symbols represent the mean and SEM (n = 6–9). *P < 0.05, **P < 0.01, ***P < 0.001 versus the respective insult-only group by one-way ANOVA, followed by Bonferroni's test.
Figure 1.
 
Effects of natriuretic peptides on survival of cultured adult rat RGCs. Cultured adult rat retinal cells were treated with the indicated concentrations of ANP (A, C, E) or CNP (B, D, F) in the presence of various insults: 100 μM of glutamate (A, B), 10 ng/mL TNFα (C, D), or trophic factor withdrawal (E, F). After a 3-day incubation, the cells were fixed and labeled with anti-Thy-1 antibody. Surviving RGCs were counted manually. Vehicle-treated (the no-insult control group in each experiment defined 100%). Symbols represent the mean and SEM (n = 6–9). *P < 0.05, **P < 0.01, ***P < 0.001 versus the respective insult-only group by one-way ANOVA, followed by Bonferroni's test.
In addition to glutamate, the survival of RGCs in culture was also sensitive to TNFα (10 ng/mL); approximately 60% of cells survived after a 3-day treatment (Figs. 1C, 1D). Neither ANP nor CNP (5–500 nM) significantly protected the cells against this insult (Figs. 1C, 1D). 
Removal of BDNF, bFGF, CNTF, and forskolin from the culture medium (trophic factor withdrawal) for 3 days caused a significant loss of RGCs. CNP partially but significantly protected the RGCs against this insult in a concentration-dependent manner. At 50 and 500 nM CNP, 75% ± 4% (n = 6; P < 0.05) and 76% ± 7% (n = 9; P < 0.01) of RGCs survived the trophic factor withdrawal-induced cytotoxicity, respectively, compared with 56% ± 3% (n = 9) survival with the insult alone (Fig. 1F). Again, ANP was not protective (Fig. 1E). 
Effects of NMDA and CNP on Inner Plexiform Layer Thickness
The in vitro neuroprotective effect of CNP but not ANP on RGCs led us to assess the potential in vivo protective effects of CNP against excitotoxicity-induced RGC death. Excitotoxic amino acid NMDA, when injected intravitreally, causes morphologic changes and RGC loss in the rat retina. 37 We confirmed these findings and further demonstrated that co-injection of CNP mitigated the changes. For example, Figure 2 shows representative HE-stained rat retinal sections at different time points, up to 14 days after different treatments. Intravitreal injection of PBS did not produce any observable changes in the retina, whereas 20 nanomoles of NMDA produced a time-dependent, obvious thinning of the inner plexiform layer (IPL) and an apparent reduction in cell density in the GCL. Other than that, NMDA injection did not induce any visible changes in the inner nuclear layer (INL), outer nuclear layer (ONL), and outer plexiform layer (OPL). These NMDA-induced retinal changes appeared to be diminished when CNP (10 μg, 4.5 nanomoles) was co-injected. Intravitreal injection of CNP alone did not affect the retina (Fig. 2). 
Figure 2.
 
Representative images of hematoxylin-eosin–stained, paraffin-embedded rat retinal sections obtained 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg, or 4.5 nanomoles), or NMDA+CNP. Scale bar, 50 μm.
Figure 2.
 
Representative images of hematoxylin-eosin–stained, paraffin-embedded rat retinal sections obtained 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg, or 4.5 nanomoles), or NMDA+CNP. Scale bar, 50 μm.
To quantify the morphologic observations, we measured thickness of the IPL, INL, OPL, and ONL on rat cross-sections 1.0 to 1.5 mm from the margin of the optic nerve head. In agreement with the findings shown in Figure 2, the thickness of the INL, OPL, or ONL was not significantly affected by the various treatments (data not shown). In contrast, intravitreal injection of 20 nanomoles NMDA decreased IPL thickness, which was significantly different from that in PBS-injected eyes at the same time points, starting at 18 hours after injection and lasting for at least 14 days (Fig. 3). At 14 days, in the PBS-injected eyes, IPL thickness was 22.0 ± 1.1 μm (n = 4), whereas in the NMDA-injected eyes, it was 9.5 ± 0.4 μm (n = 4; P < 0.001). Coadministration of CNP with NMDA partially reduced the detrimental effect of NMDA, which achieved statistical significance on days 7 and 14. IPL thickness at day 14 in animals injected with both NMDA and CNP was 17.1 ± 0.04 μm (n = 4; P < 0.01 versus PBS; P < 0.001 versus NMDA; Fig. 3). Injection of CNP itself did not significantly affect IPL thickness (21.8 ± 0.8 μm at day 14; n = 4; P > 0.05 versus PBS; Fig. 3). 
Figure 3.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on IPL thickness. Thickness of the IPL from each rat retina was obtained from hematoxylin/eosin-stained, paraffin-embedded retinal sections 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injection of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or both NMDA and CNP. Four images of each retina were randomly chosen, and each image was measured three times. The mean of the 12 measurements is reported as a single value for each retina. Results are shown as the mean ± SEM (n = 4). Results at each time point were compared by one-way ANOVA, followed by Bonferroni's test. Although all pair-wise comparisons were performed, for the sake of clarify, only comparisons versus the PBS group and between the NMDA and NMDA+CNP groups are indicated. *P < 0.05 versus the PBS group; #P < 0.05 NMDA versus NMDA+CNP group.
Figure 3.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on IPL thickness. Thickness of the IPL from each rat retina was obtained from hematoxylin/eosin-stained, paraffin-embedded retinal sections 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injection of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or both NMDA and CNP. Four images of each retina were randomly chosen, and each image was measured three times. The mean of the 12 measurements is reported as a single value for each retina. Results are shown as the mean ± SEM (n = 4). Results at each time point were compared by one-way ANOVA, followed by Bonferroni's test. Although all pair-wise comparisons were performed, for the sake of clarify, only comparisons versus the PBS group and between the NMDA and NMDA+CNP groups are indicated. *P < 0.05 versus the PBS group; #P < 0.05 NMDA versus NMDA+CNP group.
Effects of NMDA and CNP on GCL Cell Count
As implicated by morphologic observations, the NMDA (20 nanomoles) injection appeared to decrease cell density in GCL in the retinal cross sections, which was partially reversed by CNP (4.5 nanomoles; Fig. 2). To confirm these observations, we stained rat retinal flat mounts with cresyl violet, to label cells in the GCL, and counted stained neuronlike cells in randomly selected images, each representing a 4.7 × 10−3-mm2 area, of the central, midperipheral, and peripheral regions of all four quadrants. During cell counting, we were not able to distinguish RGCs from displaced amacrine cells or other neuronlike cells. However, morphologically distinguishable glial cells, degenerated cells, and vascular endothelial cells were excluded. Figure 4 shows representative images obtained at different time points of the different treatments. 
Figure 4.
 
Representative photomicrographs of cresyl violet–stained rat retina flat-mount midcentral region at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles) or NMDA+CNP.
Figure 4.
 
Representative photomicrographs of cresyl violet–stained rat retina flat-mount midcentral region at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles) or NMDA+CNP.
Quantification of GCL neuron counts demonstrated that PBS injection itself did not have significant effects on cell survival up to 14 days (Fig. 5). However, NMDA (20 nanomoles) treatment significantly decreased neuron counts at all time points (P < 0.001 versus PBS). At 6 hours, NMDA-treated retinas had 25% fewer cresyl violet–labeled neurons than did the PBS-treated retinas. This cell loss increased to 48% at 14 days (Fig. 5). Concomitant treatment with CNP (4.5 nanomoles) reduced the NMDA effect, especially at later time points. At 14 days, the retinas with both CNP and NMDA treatment had only 24% fewer cell counts relative to that of PBS-treated retinas (P < 0.001 versus PBS, P < 0.01 versus NMDA; Fig. 5). CNP (4.5 nanomoles) injection alone slightly decreased cresyl violet–labeled neurons. Compared with the PBS-treated retinas, CNP-injected retinas had 7% fewer cells at 14 days (P < 0.001 versus PBS; Fig. 5). 
Figure 5.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on cresyl violet–labeled neurons in retina flat mounts. Cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of cresyl violet–stained neurons in the 12 images was counted, three times in each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 5.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on cresyl violet–labeled neurons in retina flat mounts. Cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of cresyl violet–stained neurons in the 12 images was counted, three times in each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Effects of NMDA and CNP on Retinal Neuron Apoptosis
NMDA-induced death of retinal neurons very likely involves apoptosis. To assess this phenomenon, we labeled rat retina flat mounts at different time points after the various treatments with TUNEL and counted TUNEL-positive cells in the central, midcentral, and peripheral regions of all four quadrants. Figure 6 shows representative images. It is obvious that intravitreal injection of 20 nanomoles NMDA was associated with a larger number of TUNEL-positive cells, especially within the first 24 hours after treatment. In contrast, the other groups had far fewer cells with TUNEL staining. 
Figure 6.
 
Representative fluorescent images of TUNEL-staining of the midcentral region of rat retina flat mounts at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or NMDA+CNP.
Figure 6.
 
Representative fluorescent images of TUNEL-staining of the midcentral region of rat retina flat mounts at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or NMDA+CNP.
Quantification of apoptotic GCL neuron counts demonstrated that PBS injection itself did not have significant effects on cell apoptosis up to 14 days (Fig. 7). However, intravitreal injection of 20 nanomoles NMDA induced a dramatically higher number of TUNEL-positive cells at all time points (P < 0.05 versus PBS), especially within the first 24 hours after treatment (P < 0.001 versus PBS) (Fig. 7). In contrast, CNP-treated (4.5 nanomoles) retinas had far fewer TUNEL-positive cells, similar to PBS-treated retinas at all time points (P > 0.05 versus PBS; Fig. 7). Furthermore, concomitant treatment with CNP (4.5 nanomoles) reduced the NMDA (20 nanomoles) effect with significantly fewer TUNEL-positive cells relative to that of only NMDA-treated retinas (P < 0.01 or 0.001 versus NMDA) at all time points (Fig. 7). 
Figure 7.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on TUNEL-labeled cells in retina flat mounts. TUNEL-positive cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area, of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of TUNEL-stained neurons in the 12 images was counted, three times for each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 7.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on TUNEL-labeled cells in retina flat mounts. TUNEL-positive cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area, of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of TUNEL-stained neurons in the 12 images was counted, three times for each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Effects of NMDA and CNP on Retinal mRNA Expression of NPRB, Bcl-xL, BAX, and μ-Calpain
To further characterize the NMDA and CNP effects, we analyzed the retinal mRNA levels of NPRB and molecules known to be involved in apoptosis—Bcl-xL, BAX, and μ-calpain—by qRT-PCR at three time points: 6 hours, 24 hours, and 4 days. Each sample contained a pool of three retinas. The mRNA levels of these specific targets in each sample were normalized against the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA level, and their normalized levels in the PBS-treated retina were set at 100%. 
There was no significant difference in NPRB mRNA expression in the treatment groups at any time point (P > 0.05, ANOVA; Fig. 8A). In contrast, the mRNA levels of the apoptosis-related molecules Bcl-xL, BAX, and μ-calpain were elevated in the NMDA-treated (20 nanomoles) retinas, albeit with different temporal profiles. For example, a significant increase in Bcl-xL mRNA (625% ± 150%; P < 0.001 versus PBS) was observed only at 4 days after NMDA injection (Fig. 8B). A trend of elevated BAX mRNA levels was noted at 6 hours (254% ± 35%; P > 0.05, ANOVA) after NMDA treatment that became statistically significant at 24 hours (475% ± 48%; P < 0.001 versus PBS) and at 4 days (537% ± 226%; P < 0.05 versus PBS; Fig. 8C). NMDA raised the mRNA level of μ-calpain only at the 6-hour time point (598% ± 59%; P < 0.001 versus PBS; Fig. 8D). All these NMDA-induced changes were significantly reduced by concomitant treatment with CNP (4.5 nanomoles; P < 0.01–0.001 versus NMDA), whereas CNP (4.5 nanomoles) injection by itself did not significantly affect the mRNA levels of these molecules (Figs. 8B–8D). 
Figure 8.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on the retinal mRNA levels of NPRB and Bcl-xL, BAX, and μ-calpain. The GAPDH mRNA level was used to normalize the mRNA levels of specific targets for each sample (n = 3). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 8.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on the retinal mRNA levels of NPRB and Bcl-xL, BAX, and μ-calpain. The GAPDH mRNA level was used to normalize the mRNA levels of specific targets for each sample (n = 3). The analyses and probabilities for the results are expressed as described in Figure 3.
Discussion
Excitotoxicity, deprivation of trophic factors, and TNFα have been proposed as possible mechanisms underlying RGC death in glaucoma. 4,79 In this report, we found that glutamate, TNFα, and withdrawal of trophic factor jeopardized the survival of cultured adult rat RGCs, and similar to previous findings, the insults at their maximum effects caused the death of approximately half of the RGCs. 35 At the present time, it is not clear whether the neurons surviving these insults differed biologically or functionally from those that perished. ANP, at 500 nM, showed a trend of protection (approximately 10%) against glutamate- and TNFα-induced cell death, but the effect was not statistically significant. In contrast, CNP conferred a partial yet significant protection against both glutamate- and trophic factor withdrawal–induced cytotoxicity. The maximum protection afforded appeared to be better against excitotoxicity. In fact, RGC survival in the presence of both CNP (50 nM) and glutamate was not significantly different from the no-insult control group (P > 0.05). The different efficacies of CNP protection in cell survival against the different insults confirm that different mechanisms of cytotoxicity are evoked by these insults, and CNP is effective in modulating some of the mechanisms, such as excitotoxicity, but not all of them. 
Glutamate has been shown to play a role in the pathologic course of various neurodegenerative diseases, including retinal ischemia, 38 diabetic retinopathy, 39 optic nerve ischemia, 40 and even stroke and epilepsy. 41 In glaucoma, it has been suggested that the initial damage to retinal cells induces an excessive release of glutamate, which subsequently damages neighboring RGCs, induces more glutamate release, and perpetuates the feed-forward cycle. 42 Because of the potential involvement of glutamate in glaucoma and the in vitro CNP results presented herein, we chose to investigate the potential protective effects of CNP against intravitreal NMDA-induced retinal toxicity in vivo. 
In this study, we found that intravitreal injection of 20 nanomoles NMDA decreased the thickness of IPL and the number of neurons in the GCL of the rat. These results are consistent with those reported in other studies. 4346 These excitotoxic effects were all partially reversed by treatment with 4.5 nanomoles (10 μg) CNP. CNP protected against the NMDA-induced time-dependent thinning of IPL. At day 14 of NMDA injection, the thickness of IPL was reduced to 43% of that of the vehicle control, whereas when CNP was added, the IPL thickness was significantly improved to 77% of control. This finding correlated with a partial protection by CNP against the NMDA-induced reduction in GCL cell density. Again, at day 14 after NMDA treatment, the GCL cell density was reduced to 52% of the control value, and CNP significantly, although incompletely, mitigated the NMDA effect. Raising the GCL cell density to 76% of control CNP injection by itself did not affect the thickness of IPL. It did significantly reduce the GCL cell density (9%). The biological implication of this minor change is uncertain at this time. 
In addition to morphologic changes, intravitreal injection of 20 nanomoles NMDA also induced apoptosis of RGCs. It has been reported that apoptosis of the RGCs often appears at 18 to 24 hours after NMDA injection and is sustained for 4 to 14 days. 32,37,45,4750 We demonstrated that apoptosis of GCL neurons induced by 20 nanomoles NMDA occurred as early as 6 hours and peaked at 24 hours after injection. However, minimal RGC apoptosis was noticed at day 4 and thereafter, even though the number of cells in the GCL decreased, at least until day 14. This result suggests that the neurons in this layer were dying continually, probably due to the secondary neuronal death. Our study showed that 4.5 nanomoles (10 μg) CNP protected the neurons in GCL from 20 nanomoles NMDA-induced degeneration throughout the study period, from 6 hours to 14 days. CNP itself, similar to the vehicle control, did not induce significant apoptosis of retinal neurons. 
These morphologic and biochemical analyses clearly indicate the protective effects of CNP against excitotoxicity in the retina, but its molecular mechanism of action remains unclear. Excitotoxicity in the retina has been proposed to involve excessive Ca2+ influx and intracellular Ca2+ overload of the RGC, leading to μ-calpain activation and apoptotic cell death. 4346 Calpains, such as μ-calpain (calpain 1) and m-calpain (calpain 2), belong to a family of Ca2+-dependent cysteine proteases and are ubiquitous in the central nervous system (CNS), including the RGCs. 45 μ-Calpain, but not m-calpain, when activated by stresses such as Ca2+ overload, induces proteolysis in the cell, which has been implicated as a major process in pathologic neuronal cell death in many neurodegenerative disorders—excitotoxicity in the retina, for example. 45,5153 CNP activates NPRB and stimulates intracellular (c)GMP production. cGMP affects the functions of several downstream signaling molecules. For example, it activates cGMP-dependent protein kinase (also known as protein kinase G) and cyclic nucleotide-gated ion channels, which in turn increases K+ efflux, causes membrane hyperpolarization, reduces Ca2+ influx, and suppresses Ca2+ release from the endoplasmic reticulum. cGMP also decreases various signaling systems' responsiveness to Ca2+. 12,17 A cGMP-mediated suppression of Ca2+ influx, release, and responsiveness may therefore be responsible, at least in part, for the neuroprotective effects of CNP on these cells. 
To attempt to elucidate the molecular effects of NMDA and CNP, we evaluated the retinal expression of μ-calpain, as well as that of Bcl-2 and BAX, gene products involved in the cell apoptosis cascade, 54,55 after intravitreal injection of the compounds. Our findings showed that 20 nanomoles NMDA increased mRNA expression of μ-calpain in the retina at 6 hours after treatment, but the level returned to baseline at later time points. NMDA also increased the expression of both BAX and Bcl-xL. It induced an increase of BAX expression in a time-dependent manner. The increased expression of BAX mRNA was noted at 4 days after injection, suggesting that the proapoptotic BAX gene was still turned on by the insult when there was minimal RGC apoptosis at day 4 and thereafter. Of note, the mRNA level of Bcl-xL followed a different temporal pattern. It was not elevated until 4 days after NMDA treatment. These data implicate a temporal sequence of molecular events initiated by NMDA, from the increased expression of μ-calpain, leading to BAX and Bcl-xL activation. These effects of NMDA were completely blocked by the co-injection of 4.5 nanomoles (10 μg) CNP. 
In the same study samples, we assessed the mRNA levels of NPRB. Consistent with prior findings that the inner retina expresses CNP and NPRB, 21,26,27,56,57 we demonstrated the presence of NPRB in the rat retina by qRT-PCR, which was subsequently confirmed by Western blot analysis (Ma et al., unpublished observations, 2009). All treatments tested did not generate significant changes in the levels of mRNA or protein of NPRB, indicating that CNP or NMDA did not up- or downregulate the receptor. 
In summary, we confirmed previous findings that glutamate, TNFα, and withdrawal of trophic factors reduce survival of adult rat RGCs in culture. 35 We also confirmed that intravitreal injection of NDMA induces time-dependent changes in the inner retina, such as loss of neurons in the GCL; an increase in TUNEL-positive nuclei; an increased expression of apoptosis-related genes including Bcl-xL, BAX, and μ-calpain, and thinning of the IPL. 4346 Most important, we demonstrated that CNP, but not ANP, dose-dependently protected against glutamate- and trophic factor withdrawal–induced cytotoxicity in cultured adult rat RGCs. We further showed that intravitreal injection of CNP ameliorated excitotoxic amino acid-induced damage in the retina. These in vitro and in vivo neuroprotective effects of CNP against excitotoxicity in RGC are intriguing. Moreover, CNP is known to lower IOP. It is likely that CNP holds a potential to be used as an antiglaucoma medication. Unfortunately, being a peptide, CNP is not efficacious after topical administration. Currently, the most efficient method of delivering CNP is by intraocular injection, but this approach in glaucoma treatment is not clinically practical. However, the gene therapy that is under development in our and other laboratories may resolve this problem. 
Footnotes
 Supported by NNSF (National Natural Science Foundation of China) Grants 30872830 and 30872839; and the National High-tech R&D Program of China, 863 Program, 2006AA02A117.
Footnotes
 Disclosure: J. Ma, None; W. Yu, None; Y. Wang, None; G. Cao, None; S. Cai, None; X. Chen, None; N. Yan, None; Y. Yuan, None; H. Zeng, None; D.L. Fleenor, None; X. Liu, None; I.-H. Pang, None
References
Resnikoff S Pascolini D Etya'ale D . Global data on visual impairment in the year 2002. Bull World Health Organ. 2004;82:844–851. [PubMed]
Quigley HA Broman AT . The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 2006;90:262–267. [CrossRef] [PubMed]
Whitson JT . Glaucoma: a review of adjunctive therapy and new management strategies. Expert Opin Pharmacother. 2007;8:3237–3249. [CrossRef] [PubMed]
Bautista RD . Glaucomatous neurodegeneration and the concept of neuroprotection. Int Ophthalmol Clin. 1999;39:57–70. [CrossRef] [PubMed]
Schumer RA Podos SM . The nerve of glaucoma! Arch Ophthalmol. 1994;112:37–44. [CrossRef] [PubMed]
Chidlow G Wood JP Casson RJ . Pharmacological neuroprotection for glaucoma. Drugs. 2007;67:725–759. [CrossRef] [PubMed]
Lipton SA . Pathologically-activated therapeutics for neuroprotection: mechanism of NMDA receptor block by memantine and S-nitrosylation. Curr Drug Targets. 2007;8:621–632. [CrossRef] [PubMed]
Osborne NN Wood JP Chidlow G . Ganglion cell death in glaucoma: what do we really know? Br J Ophthalmol. 1999;83:980–986. [CrossRef] [PubMed]
Pang IH Li B Clark AF . The pathogenesis of retinal ganglia cell apoptosis induced by glaucoma (in Chinese). Zhong hua Yan Ke Za Zhi. 2004;40:495–499.
Pang IH Li B Clark AF . The strategies for optic never protection in glaucoma patients (in Chinese). Zhong hua Yan Ke Za Zhi. 2004;40:783–787.
Sudoh T Minamino N Kangawa K Matsuo H . C-type natriuretic peptide (CNP): a new member of natriuretic peptide family identified in porcine brain. Biochem Biophys Res Commun. 1990;168:863–870. [CrossRef] [PubMed]
Potter LR Abbey-Hosch S Dickey DM . Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocr Rev. 2006;27:47–72. [CrossRef] [PubMed]
de Bold AJ . Atrial natriuretic factor: a hormone produced by the heart. Science. 1985;230:767–770. [CrossRef] [PubMed]
Sudoh T Kangawa K Minamino N Matsuo H . A new natriuretic peptide in porcine brain. Nature. 1988;332:78–81. [CrossRef] [PubMed]
Suga S Nakao K Hosoda K . Receptor selectivity of natriuretic peptide family, atrial natriuretic peptide, brain natriuretic peptide, and C-type natriuretic peptide. Endocrinology. 1992;130:229–239. [PubMed]
Levin ER Gardner DG Samson WK . Natriuretic peptides. N Engl J Med. 1998;339:321–328. [CrossRef] [PubMed]
Pandey KN . Biology of natriuretic peptides and their receptors. Peptides. 2005;26:901–932. [CrossRef] [PubMed]
Fernandez-Durango R Nunez DJ Brown M J Messenger RN . As encoding the natriuretic peptides and their receptors are expressed in the eye. Exp Eye Res. 1995;61:723–729. [CrossRef] [PubMed]
Zhong L Chu E Chu J Chu TC . CNP-induced changes in pHi, cGMP/cAMP and mRNA expression of natriuretic peptide receptors in human trabecular meshwork cells. J Ocul Pharmacol Ther. 2003;19:425–436. [CrossRef] [PubMed]
Fidzinski P Salvador-Silva M Choritz L Geibel J Coca-Prados M . Inhibition of NHE-1 Na+/H+ exchanger by natriuretic peptides in ocular nonpigmented ciliary epithelium. Am J Physiol Cell Physiol. 2004;287:C655–C663. [CrossRef] [PubMed]
Wolfensberger TJ Singer DR Freegard T . Evidence for a new role of natriuretic peptides: control of intraocular pressure. Br J Ophthalmol. 1994;78:446–448. [CrossRef] [PubMed]
Crook RB Chang AT . Differential regulation of natriuretic peptide receptors on ciliary body epithelial cells. Biochem J. 1997;324:49–55. [PubMed]
Fernandez-Durango R Moya FJ Ripodas A . Type B and type C natriuretic peptide receptors modulate intraocular pressure in the rabbit eye. Eur J Pharmacol. 1999;364:107–113. [CrossRef] [PubMed]
Takashima Y Taniguchi T Yoshida M . Ocular hypotension induced by intravitreally injected C-type natriuretic peptide. Exp Eye Res. 1998;66:89–96. [CrossRef] [PubMed]
Mittag TW Tormay A Ortega M Severin C . Atrial natriuretic peptide (ANP), guanylate cyclase, and intraocular pressure in the rabbit eye. Curr Eye Res. 1987;6:1189–1196. [CrossRef] [PubMed]
Rollin R Mediero A Roldan-Pallares M Fernandez-Cruz A Fernandez-Durango R . Natriuretic peptide system in the human retina. Mol Vis. 2004;10:15–22. [PubMed]
Cao LH Yu YC Zhao JW Yang XL . Expression of natriuretic peptides in rat Muller cells. Neurosci Lett. 2004;365:176–179. [CrossRef] [PubMed]
Palm DE Keil LC Sassani JW Severs WB . Immunoreactive atrial natriuretic peptide in the retina of rats and rabbits. Brain Res. 1989;504:142–144. [CrossRef] [PubMed]
Kutty RK Fletcher RT Chader GJ Krishna G . Expression of guanylate cyclase-A mRNA in the rat retina: detection using polymerase chain reaction. Biochem Biophys Res Commun. 1992;182:851–857. [CrossRef] [PubMed]
Ahmad I Barnstable CJ . Differential laminar expression of particulate and soluble guanylate cyclase genes in rat retina. Exp Eye Res. 1993;56:51–62. [CrossRef] [PubMed]
Duda T Goraczniak RM Sitaramayya A Sharma RK . Cloning and expression of an ATP-regulated human retina C-type natriuretic factor receptor guanylate cyclase. Biochemistry. 1993;32:1391–1395. [CrossRef] [PubMed]
Kuribayashi K Kitaoka Y Kumai T . Neuroprotective effect of atrial natriuretic peptide against NMDA-induced neurotoxicity in the rat retina. Brain Res. 2006;1071:34–41. [CrossRef] [PubMed]
Wiggins AK Shen PJ Gundlach AL . Atrial natriuretic peptide expression is increased in rat cerebral cortex following spreading depression: possible contribution to sd-induced neuroprotection. Neuroscience. 2003;118:715–726. [CrossRef] [PubMed]
Fiscus RR Tu AW Chew SB . Natriuretic peptides inhibit apoptosis and prolong the survival of serum-deprived PC12 cells. Neuroreport. 2001;12:185–189. [CrossRef] [PubMed]
Pang IH Zeng H Fleenor DL Clark AF . Pigment epithelium-derived factor protects retinal ganglion cells. BMC Neurosci. 2007;8:11. [CrossRef] [PubMed]
Fuchs C Forster V Balse E Sahel JA Picaud S Tessier LH . Retinal-cell-conditioned medium prevents TNF-alpha-induced apoptosis of purified ganglion cells. Invest Ophthalmol Vis Sci. 2005;46:2983–2991. [CrossRef] [PubMed]
Lam TT Abler AS Kwong JM Tso MO . N-methyl-d-aspartate (NMDA)–induced apoptosis in rat retina. Invest Ophthalmol Vis Sci. 1999;40:2391–2397. [PubMed]
Louzada-Junior P Dias JJ Santos WF . Glutamate release in experimental ischaemia of the retina: an approach using microdialysis. J Neurochem. 1992;59:358–363. [CrossRef] [PubMed]
Kowluru RA Engerman RL Case GL Kern TS . Retinal glutamate in diabetes and effect of antioxidants. Neurochem Int. 2001;38:385–390. [CrossRef] [PubMed]
Kim TW Kang KB Choung HK Park KH Kim DM . Elevated glutamate levels in the vitreous body of an in vivo model of optic nerve ischemia. Arch Ophthalmol. 2000;118:533–536. [CrossRef] [PubMed]
Lipton SA Rosenberg PA . Excitatory amino acids as a final common pathway for neurologic disorders. N Engl J Med. 1994;330:613–622. [CrossRef] [PubMed]
Pang IH Clark AF . Rodent models for glaucoma retinopathy and optic neuropathy. J Glaucoma. 2007;16:483–505. [CrossRef] [PubMed]
Levin LA Peeples P . History of neuroprotection and rationale as a therapy for glaucoma. Am J Manag Care. 2008;14:S11–S14. [PubMed]
Sucher NJ Lipton SA Dreyer EB . Molecular basis of glutamate toxicity in retinal ganglion cells. Vision Res. 1997;37:3483–3493. [CrossRef] [PubMed]
Chiu K Lam TT Ying Li WW Caprioli J Kwong Kwong JM . calpain and N-methyl-d-aspartate (NMDA)-induced excitotoxicity in rat retinas. Brain Res. 2005;1046:207–215. [CrossRef] [PubMed]
Siliprandi R Canella R Carmignoto G . N-methyl-D-aspartate-induced neurotoxicity in the adult rat retina. Vis Neurosci. 1992;8:567–573. [CrossRef] [PubMed]
Inomata Y Hirata A Yonemura N . Neuroprotective effects of interleukin-6 on NMDA-induced rat retinal damage. Biochem Biophys Res Commun. 2003;302:226–232. [CrossRef] [PubMed]
Laabich A Li G Cooper NG . Characterization of apoptosis-genes associated with NMDA mediated cell death in the adult rat retina. Brain Res Mol Brain Res. 2001;91:34–42. [CrossRef] [PubMed]
Shi J Jiang Y Liu X . Neuroprotective effect of erigeron breviscapus (vant) hand-mazz on NMDA-induced retinal neuron injury in the rats (in Chinese). Yan Ke Xue Bao. 2004;20:113–117. [PubMed]
Kwong JM Lam TT Caprioli J . Hyperthermic pre-conditioning protects retinal neurons from N-methyl-D-aspartate (NMDA)-induced apoptosis in rat. Brain Res. 2003;970:119–130. [CrossRef] [PubMed]
Goll DE Thompson VF Li H Wei W Cong J . The calpain system. Physiol Rev. 2003;83:731–801. [CrossRef] [PubMed]
Azuma M Shearer TR . The role of calcium-activated protease calpain in experimental retinal pathology. Surv Ophthalmol. 2008;53:150–163. [CrossRef] [PubMed]
McKernan DP Guerin MB O'Brien CJ Cotter TG . A key role for calpains in retinal ganglion cell death. Invest Ophthalmol Vis Sci. 2007;48:5420–5430. [CrossRef] [PubMed]
Levin LA Schlamp CL Spieldoch RL Geszvain KM Nickells RW . Identification of the bcl-2 family of genes in the rat retina. Invest Ophthalmol Vis Sci. 1997;38:2545–2553. [PubMed]
Adamus G Webb S Shiraga S Duvoisin RM . Anti-recoverin antibodies induce an increase in intracellular calcium, leading to apoptosis in retinal cells. J Autoimmun. 2006;26:146–153. [CrossRef] [PubMed]
Jin Y Zhong YM Yang XL . Natriuretic peptides are localized to rat retinal amacrine cells. Neurosci Lett. 2007;421:106–109. [CrossRef] [PubMed]
Cao LH Yang XL . Natriuretic peptides and their receptors in the central nervous system. Prog Neurobiol. 2008;84:234–248. [CrossRef] [PubMed]
Figure 1.
 
Effects of natriuretic peptides on survival of cultured adult rat RGCs. Cultured adult rat retinal cells were treated with the indicated concentrations of ANP (A, C, E) or CNP (B, D, F) in the presence of various insults: 100 μM of glutamate (A, B), 10 ng/mL TNFα (C, D), or trophic factor withdrawal (E, F). After a 3-day incubation, the cells were fixed and labeled with anti-Thy-1 antibody. Surviving RGCs were counted manually. Vehicle-treated (the no-insult control group in each experiment defined 100%). Symbols represent the mean and SEM (n = 6–9). *P < 0.05, **P < 0.01, ***P < 0.001 versus the respective insult-only group by one-way ANOVA, followed by Bonferroni's test.
Figure 1.
 
Effects of natriuretic peptides on survival of cultured adult rat RGCs. Cultured adult rat retinal cells were treated with the indicated concentrations of ANP (A, C, E) or CNP (B, D, F) in the presence of various insults: 100 μM of glutamate (A, B), 10 ng/mL TNFα (C, D), or trophic factor withdrawal (E, F). After a 3-day incubation, the cells were fixed and labeled with anti-Thy-1 antibody. Surviving RGCs were counted manually. Vehicle-treated (the no-insult control group in each experiment defined 100%). Symbols represent the mean and SEM (n = 6–9). *P < 0.05, **P < 0.01, ***P < 0.001 versus the respective insult-only group by one-way ANOVA, followed by Bonferroni's test.
Figure 2.
 
Representative images of hematoxylin-eosin–stained, paraffin-embedded rat retinal sections obtained 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg, or 4.5 nanomoles), or NMDA+CNP. Scale bar, 50 μm.
Figure 2.
 
Representative images of hematoxylin-eosin–stained, paraffin-embedded rat retinal sections obtained 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg, or 4.5 nanomoles), or NMDA+CNP. Scale bar, 50 μm.
Figure 3.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on IPL thickness. Thickness of the IPL from each rat retina was obtained from hematoxylin/eosin-stained, paraffin-embedded retinal sections 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injection of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or both NMDA and CNP. Four images of each retina were randomly chosen, and each image was measured three times. The mean of the 12 measurements is reported as a single value for each retina. Results are shown as the mean ± SEM (n = 4). Results at each time point were compared by one-way ANOVA, followed by Bonferroni's test. Although all pair-wise comparisons were performed, for the sake of clarify, only comparisons versus the PBS group and between the NMDA and NMDA+CNP groups are indicated. *P < 0.05 versus the PBS group; #P < 0.05 NMDA versus NMDA+CNP group.
Figure 3.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on IPL thickness. Thickness of the IPL from each rat retina was obtained from hematoxylin/eosin-stained, paraffin-embedded retinal sections 1.0 to 1.5 mm from the optic disc at the indicated time points after intravitreal injection of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or both NMDA and CNP. Four images of each retina were randomly chosen, and each image was measured three times. The mean of the 12 measurements is reported as a single value for each retina. Results are shown as the mean ± SEM (n = 4). Results at each time point were compared by one-way ANOVA, followed by Bonferroni's test. Although all pair-wise comparisons were performed, for the sake of clarify, only comparisons versus the PBS group and between the NMDA and NMDA+CNP groups are indicated. *P < 0.05 versus the PBS group; #P < 0.05 NMDA versus NMDA+CNP group.
Figure 4.
 
Representative photomicrographs of cresyl violet–stained rat retina flat-mount midcentral region at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles) or NMDA+CNP.
Figure 4.
 
Representative photomicrographs of cresyl violet–stained rat retina flat-mount midcentral region at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles) or NMDA+CNP.
Figure 5.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on cresyl violet–labeled neurons in retina flat mounts. Cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of cresyl violet–stained neurons in the 12 images was counted, three times in each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 5.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on cresyl violet–labeled neurons in retina flat mounts. Cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of cresyl violet–stained neurons in the 12 images was counted, three times in each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 6.
 
Representative fluorescent images of TUNEL-staining of the midcentral region of rat retina flat mounts at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or NMDA+CNP.
Figure 6.
 
Representative fluorescent images of TUNEL-staining of the midcentral region of rat retina flat mounts at the indicated time points after intravitreal injections of PBS, NMDA (20 nanomoles), CNP (10 μg or 4.5 nanomoles), or NMDA+CNP.
Figure 7.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on TUNEL-labeled cells in retina flat mounts. TUNEL-positive cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area, of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of TUNEL-stained neurons in the 12 images was counted, three times for each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 7.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on TUNEL-labeled cells in retina flat mounts. TUNEL-positive cell counts were obtained in a masked fashion from randomly selected images of the central, midcentral, and peripheral regions, each equivalent to a 4.7 × 10−3-mm2 area, of each of the superior-temporal, inferior-temporal, superior-nasal, and inferior-nasal quadrants. The number of TUNEL-stained neurons in the 12 images was counted, three times for each image. The mean of the 36 counts is reported as a single value for each retina (n = 4). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 8.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on the retinal mRNA levels of NPRB and Bcl-xL, BAX, and μ-calpain. The GAPDH mRNA level was used to normalize the mRNA levels of specific targets for each sample (n = 3). The analyses and probabilities for the results are expressed as described in Figure 3.
Figure 8.
 
Effects of intravitreal injection of PBS, NMDA, CNP, or NMDA+CNP on the retinal mRNA levels of NPRB and Bcl-xL, BAX, and μ-calpain. The GAPDH mRNA level was used to normalize the mRNA levels of specific targets for each sample (n = 3). The analyses and probabilities for the results are expressed as described in Figure 3.
Table 1.
 
The Primers of the Specific Genes for the Real-Time Quantitative PCR
Table 1.
 
The Primers of the Specific Genes for the Real-Time Quantitative PCR
Gene Sequence Primers (5′→3′) Annealing Temperature (°C)
GAPDH (NM_017008) Sense CCTCAAGATTGTCAGCAAT 55
Anti-sense CCATCCACAGTCTTCTGAGT
NPRB (NM_053838) Sense CCAAATTCTACCCCACTCTG 60
Anti-sense TAAGAAGTGTCACCACCTGC
Bcl-xL (NM_031535) Sense CACCTACCTGAATGACCACCT 55
Anti-sense GCAGTTAGGGATCTCCACAG
BAX (NM_017059) Sense TTGTTACAGGGTTTCATCCAGG 55
Anti-sense AGACACTCGCTCAGCTTCTTG
μ-Calpain (NM_019152) Sense ACCCAGGAACTAGATGACCA 55
Anti-sense TACCGTCTCGATCCATGAGG
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×