July 2010
Volume 51, Issue 7
Free
Immunology and Microbiology  |   July 2010
μ-Crystallin, New Candidate Protein in Endotoxin-Induced Uveitis
Author Affiliations & Notes
  • Hiroki Imai
    From the Departments of Ophthalmology,
  • Kouichi Ohta
    From the Departments of Ophthalmology,
    the Department of Ophthalmology, Matsumoto Dental University, Nagano, Japan.
  • Akiko Yoshida
    From the Departments of Ophthalmology,
  • Satoru Suzuki
    Aging Medicine and Geriatrics, Institute on Aging and Adaptation,
  • Kiyoshi Hashizume
    Aging Medicine and Geriatrics, Institute on Aging and Adaptation,
  • Shinichi Usami
    Otorhinolaryngology, and
  • Takanobu Kikuchi
    Instrumental Analysis, Research Center for Human and Environmental Science, Shinshu University School of Medicine, Matsumoto, Japan; and
  • Corresponding author: Kouichi Ohta, Department of Ophthalmology, Matsumoto Dental University, 1780 Gobara, Hirooka, Shiojiri, Nagano, 399-0781, Japan; ohta@po.mdu.ac.jp
Investigative Ophthalmology & Visual Science July 2010, Vol.51, 3554-3559. doi:10.1167/iovs.09-3728
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Hiroki Imai, Kouichi Ohta, Akiko Yoshida, Satoru Suzuki, Kiyoshi Hashizume, Shinichi Usami, Takanobu Kikuchi; μ-Crystallin, New Candidate Protein in Endotoxin-Induced Uveitis. Invest. Ophthalmol. Vis. Sci. 2010;51(7):3554-3559. doi: 10.1167/iovs.09-3728.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: μ-Crystallin (CRYM) is a major taxon-specific lens protein. The purpose of this study was to investigate the function of CRYM in eyes of mice with endotoxin-induced uveitis (EIU).

Methods.: EIU was induced by an injection of a lipopolysaccharide (LPS) into the footpad of male C57BL/6J, CRYM knockout (CRYM−/−), and wild-type (CRYM+/+) mice. The expression of CRYM in the iris-ciliary body (ICB) was investigated by Western blot analyses and real-time RT-PCR at 12 hours and 1, 3, and 5 days after the LPS injection. The number of cells that had infiltrated the anterior chamber (AC) of the CRYM+/+ mice was compared to that in the CRYM−/− mice at 1, 3, 5, and 7 days. The expressions of the mRNA of interleukin (IL)-1α, IL-6, tumor necrosis factor (TNF)-α, and granulocyte macrophage–colony stimulating factor (GM-CSF) in the ICB of the two groups of mice were compared.

Results.: The mRNA of CRYM was upregulated at 12 hours after LPS injection, and CRYM protein increased at 3 days. The number of inflammatory cells in the AC of the CRYM−/− mice was not significantly different on day 1 from that in the CRYM+/+ mice, but was significantly lower (17.9 ± 1.6 vs. 27.1 ± 2.4 cells/section) on day 5. Expression of the mRNA of IL-1α and -6 in the CRYM−/− mice was significantly lower than that in the CRYM+/+ mice on day 5.

Conclusions.: CRYM plays an important role in the development of the second peak of murine EIU.

Endotoxin-induced uveitis (EIU) is an animal model of acute ocular inflammation 1 and is characterized by the leakage of proteins and infiltration of the anterior chamber (AC) by many polymorphonuclear cells (PMNs). EIU can be induced by an injection of lipopolysaccharide (LPS). The inflammation in rats peaks at 24 hours after the LPS injection and subsides within 48 hours. 2,3  
In contrast to rats, mice with EIU exhibit prominent posterior vitritis instead of iridocyclitis. 4 In addition, the overall severity of the ocular inflammation is weaker in mice than in rats. A more detailed investigation in C3H/HeN mice showed that the inflammation had a biphasic time course: It peaked at 24 hours and subsided within 48 hours as in rats; however, a second higher peak of intraocular inflammation developed ∼5 days after the LPS injection. 5,6  
It has been reported that many different kinds of cytokines, such as interleukin (IL)-1α, IL-6, and tumor necrosis factor (TNF)-α; chemokines; adhesion molecules (for recruitment of leukocytes); and nitric oxide are involved in the development of intraocular inflammations. 2,3,710 In a DNA microarray analyses of rat eyes, we found that the expression of the μ-crystallin (CRYM) gene was greatly increased in the iris-ciliary body (ICB) at 6 and 12 hours after LPS injection. 11 Crystallins are the predominant structural proteins of the lens, and CRYM was first identified as a major structural lens protein in Australian marsupials. 12 The gene for CRYM is conserved in other species and is also expressed in nonlenticular tissues. The sequence of CRYM was found to be similar to that of ornithine cyclodeaminases, enzymes of prokaryotes. 13,14 In addition, it has been reported that the CRYM protein is expressed in the brain and retina and has a presumably nonstructural, enzymatic function. 15,16 Whether CRYM is present in inflamed eyes has not been examined, except in our preliminary study. 
We questioned whether CRYM plays a role in the intraocular inflammatory process of EIU, because of our finding that the CRYM was the only gene among the different crystallin family members that was upregulated in rats with EIU. Fortunately, CRYM knockout mice are available, 17 and we investigated the role played by CRYM in the development of EIU in normal and CRYM knockout mice. We also investigated how the EIU in mice differs from that in rats. 
Methods
Animals
Male C57BL/6J mice, 8 to 10 weeks of age, were purchased from CLEA Japan (Tokyo, Japan) and kept under specific-pathogen–free (SPF) conditions at Shinshu University. All experiments were conducted in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The study was approved by the Institutional Review Board of Shinshu University, School of Medicine. When we examined the time course of the infiltration of the anterior chamber (AC) of C57BL/6J mice by inflammatory cells, we found that the number of cells peaked at 24 hours and again at 5 days. Therefore, heterozygous CRYM-knockout (CRYM+/−) mice on a 129/Sv background 17 were bred with the C57BL/6J mice more than eight times. Homozygous male CRYM-knockout (CRYM−/−) mice on a C57BL/6J background were used in the experiments to evaluate the role of CRYM in the development of EIU. A total of 253 mice were used. 
The genotype of the mouse was determined from genomic DNA isolated from tail tissues. The wild-type CRYM allele was identified by PCR with primer 1, 5′-TGCATCCCTGAAGTAAGTGGGGTA-3′, and primer 2, 5′-GAATGAGCGCAAACGGAATG-3′, which amplified an 800-base product. 
The allele that was knocked out was identified by PCR with primer 1 and with primer 3, 5′-AGGCAGAGGCCATCTTGTGTAG-3′, which amplified a 500-base product containing a fragment of the neomycin-resistant cassette. 
Induction of EIU
The mice were injected in one footpad with 140 μg of LPS (Salmonella typhimurium, Sigma-Aldrich, St. Louis, MO) in 0.05 mL of sterile pyrogen-free saline. 
RNA Preparation
An RNA isolation kit (Invitrogen, Carlsbad, CA) was used to extract total RNA from the ICB of the mouse eyes. The ICBs from EIU eyes were dissected at 12 hours or 1, 2, 3, or 5 days after the LPS injection. RNA pellets obtained from four eyes of two mice were combined, resuspended in RNase-free water, and processed together to obtain a value for each time point. 
Quantitative Real-Time RT-PCR
cDNA was synthesized from 5 μg of total RNA with Moloney murine leukemia virus transcriptase with random hexamers (GE Health Care, Buckinghamshire, UK) in a total volume of 66 μL. The probe (TaqMan) was purchased from Applied Biosystems, Inc. (ABI, Foster City, CA) and was labeled with the reporter dye FAM on the 5′ end and the quencher MGB on the 3′ end. The PCR primer and probe for CRYM were designed on computer (Primer Express; ABI; Table 1). 
Table 1.
 
Primer and Probe Sequences Used for the Real-Time PCR Analysis
Table 1.
 
Primer and Probe Sequences Used for the Real-Time PCR Analysis
Gene Assay ID Accession Number*
IL-1a Mm00439620_ml NM_010554
IL-6 Mm00446190_ml NM_031168
TNF Mm00443258_ml NM_013693
GM-CSF Mm00438328_ml NM_009969
Gene Primer for Real-Time PCR Sequence (5′–3′) Probe (5′–3′)†
CRYM
    Forward GCATCGGTGCTTCTCTTTGATC FAM-CTGCTGGCGGTCAT
    Reverse CCGCTGCTGTTCTCTTTGC
β-Actin
    Forward CGATGCCCTGAGGCTCTTT FAM-AGCCTTCCTTCTTGGGTAT
    Reverse TTCATGGATGCCACAGGATTC
The probes and primers (TaqMan; ABI) for IL-1α, IL-6, TNF-α, and GM-CSF were labeled with the reporter dye FAM on the 5′ end and the quencher dye TAMPA on the 3′ end. 
No false positives were detected in the control experiments, and the variance between each of the replicates was within 5%. The amplification reactions contained 1 μL of cDNA, 25 μL of 2× PCR master mix (Universal Taqman Master Mix; ABI), and 2.5 μL of each specific primer and probe. The concentrations of the primer and probe were 300 and 100 nM in a final volume of 50 μL, respectively. The PCR reactions were performed in duplicate with a sequence-detection system (Prism 7000; ABI). 
The reaction program was an initial step of 2 minutes at 50°C, denaturation at 95°C for 10 minutes, followed by 45 thermal cycles of denaturation (15 seconds at 95°C) and elongation (1 minute at 60°C). The relative quantification of gene expression with the real-time RT-PCR data was performed by the comparative threshold (Ct) cycle method. The Ct of the targeted genes was normalized to the level of mouse β-actin, which was designed on computer (Primer Express; ABI) as an endogenous control at each time point after the LPS injection (Table 1). The degree of change in each targeted gene was calculated and compared with that in the control eye. The results are expressed as the mean ± SEM. The PCR experiments were repeated at least three times. 
Western Blot Analysis
For the Western blot analyses, eyes of mice were enucleated at 0, 1, 3, and 5 days after the LPS injection (n = 4 for each time point), and the ICBs were immediately removed. The specimens were homogenized in 200 μL of 2% sodium dodecyl sulfate (SDS) and electrophoresed on a 10% polyacrylamide gel. The proteins were transferred to PVDF membranes (GE Health Care), and the membranes were blocked in 5% skim milk and 0.05% sodium azide in 0.05% Tween 20 and Tris-buffered saline (TBST). Rabbit anti-CRYM 18 polyclonal antibody was used as the primary antibody at a dilution of 1:5000. After the membranes were washed, they were incubated with HRP-conjugated anti-rabbit IgG as a secondary antibody, at a dilution of 1:4000, and made visible with 3,3′-diaminobenzidine (DAB). 
Histopathologic Evaluations
The mice were killed by an overdose of pentobarbital on days 1, 3, 5, or 7 after the LPS injection, and the eyes were enucleated, fixed in 4% paraformaldehyde in 0.2 M phosphate buffer for 12 hours, embedded in paraffin, cut in 5-μm-thick sagittal sections near the optic nerve head, and stained with hematoxylin and eosin (H&E). The number of inflammatory cells that infiltrated the AC was counted in five histologic sections per eye by two masked observers. The mean number of cells/sections was used in the statistical analyses. 
Statistical Analyses
The results are expressed as the mean ± SEM. The number of inflammatory cells was analyzed by one-way analysis of variance followed by the Scheffé post hoc test, and the degrees of change in each targeted gene were analyzed by the Mann-Whitney U test. P < 0.05 was considered to be statistically significant. 
Results
Gene Expression of CRYM in the ICB of C57BL/6J Mice with EIU
The expression of the mRNA of the CRYM gene was higher at 12 hours after the LPS injection. It was lower than the peak after 1 day and returned to baseline at 5 days (Fig. 1). 
Figure 1.
 
Real-time RT-PCR for the CRYM gene in the ICB of EIU mice at 0 and 12 hours and 1, 2, 3, and 5 days (n = 4) after the LPS injection. The signal intensity for each spot was calculated and normalized for real-time RT-PCR data. The expression ratios were obtained for each targeted gene and represent the expression levels relative to that of the control eyes.
Figure 1.
 
Real-time RT-PCR for the CRYM gene in the ICB of EIU mice at 0 and 12 hours and 1, 2, 3, and 5 days (n = 4) after the LPS injection. The signal intensity for each spot was calculated and normalized for real-time RT-PCR data. The expression ratios were obtained for each targeted gene and represent the expression levels relative to that of the control eyes.
Protein Expression of CRYM in ICB of C57BL/6J Mice with EIU
The CRYM protein was detected as a 38-kDa band in the ICB of control mice. The expression of the CRYM protein did not change significantly after 1 day, but it increased significantly 3 days later (Fig. 2). 
Figure 2.
 
Western blot analysis for CRYM protein in the ICB of mice with EIU at 0, 1, 3, and 5 days (n = 4) after the LPS injection. Top: exposure to polyclonal rabbit anti-CRYM antibody; bottom: exposure to anti-β-actin antibody. Products were made visible with 3,3′-diaminobenzidine (DAB).
Figure 2.
 
Western blot analysis for CRYM protein in the ICB of mice with EIU at 0, 1, 3, and 5 days (n = 4) after the LPS injection. Top: exposure to polyclonal rabbit anti-CRYM antibody; bottom: exposure to anti-β-actin antibody. Products were made visible with 3,3′-diaminobenzidine (DAB).
Number of Inflammatory Cells Infiltrating the AC of CRYM−/− Mice Compared with That in CRYM+/+ Mice
In our preliminary study, the number of inflammatory cells that had infiltrated the AC of the eyes of the CRYM−/− mice at day 1 after the LPS injection was not significantly different from that in the CRYM+/+ mice. The inflammatory responses have been reported to be biphasic in the C3H/HeN strain of mice. 5,6 However, the time course has not been examined for longer times in other strains of mice, and so we investigated the time course in C57BL/6J mice injected with LPS. The first peak in the number of inflammatory cells in EIU mice was at 1 day, and a second higher peak occurred at 5 days (Fig. 3A). After 5 days, the number of inflammatory cells gradually decreased at 7 and 10 days. Then, we counted the number of inflammatory cells in the CRYM+/+ and CRYM−/− mice injected with LPS at 3, 5, or 7 days (Fig. 3B). In the CRYM+/+ mice, the number of inflammatory cells significantly increased at 5 days, but not in the CRYM−/− mice. 
Figure 3.
 
Time course of the number of inflammatory cells infiltrating the AC of EIU mice. (A) C57BL/6J mice. Data indicate the mean number of inflammatory cells at each time point (n = 6 for days 1, 3, 5; n = 4 for days 0, 7, and 10) after LPS injection. Histologic sections of eyes of EIU mice were stained with HE. Error bars, SEM. (B) CRYM+/+ and CRYM−/− mice injected with LPS. Data indicate the mean number of inflammatory cells at each time point (n = 4 to 6 for each day) after the LPS injection. The mean number in the CRYM+/+ mice on day 5 was significantly more than that on days 3 and 7 (*P < 0.05). On day 5, significant differences in the mean number of inflammatory cells between the CRYM+/+ and CRYM−/− mice are observed (*P < 0.05). Error bars, SEM.
Figure 3.
 
Time course of the number of inflammatory cells infiltrating the AC of EIU mice. (A) C57BL/6J mice. Data indicate the mean number of inflammatory cells at each time point (n = 6 for days 1, 3, 5; n = 4 for days 0, 7, and 10) after LPS injection. Histologic sections of eyes of EIU mice were stained with HE. Error bars, SEM. (B) CRYM+/+ and CRYM−/− mice injected with LPS. Data indicate the mean number of inflammatory cells at each time point (n = 4 to 6 for each day) after the LPS injection. The mean number in the CRYM+/+ mice on day 5 was significantly more than that on days 3 and 7 (*P < 0.05). On day 5, significant differences in the mean number of inflammatory cells between the CRYM+/+ and CRYM−/− mice are observed (*P < 0.05). Error bars, SEM.
Most of the infiltrating cells were PMNs at day 1, although identifying the type of cells was difficult because of some fragile cell bodies. On the other hand, monocytes/macrophages were predominant at day 5 (Fig. 4A). The number of cells infiltrating the AC was slightly fewer in the CYRM−/− mice than in the CRYM+/+ mice (Figs. 4A, 4B). 
Figure 4.
 
Histopathologic examinations of the ICB of CRYM+/+ and CRYM−/− mice. (A) CRYM+/+ mouse eyes at 5 days after LPS injection. Inflammatory cells, mainly macrophages, were present in the AC on day 5. (B) Histopathologic sections of the eyes if CRYM−/− mice at 5 days after LPS injection. (A, B) H&E staining; scale bar, 100 μm. (C) The data indicate the mean number of inflammatory cells that infiltrated the AC of the CRYM+/+ (n = 6 for 24 hours; n = 4 for 5 days) and the CRYM−/− (n = 4 for 24 hours; n = 6 for 5 days) mice after LPS injection. The differences in the mean number of inflammatory cells infiltrating the AC in CRYM+/+ and CRYM−/− mice at 24 hours are not significant (P = 0.26). Significant differences in the mean number of inflammatory cells in the CRYM+/+ and CRYM−/− mice were observed on day 5 (*P < 0.05). Error bars, SEM.
Figure 4.
 
Histopathologic examinations of the ICB of CRYM+/+ and CRYM−/− mice. (A) CRYM+/+ mouse eyes at 5 days after LPS injection. Inflammatory cells, mainly macrophages, were present in the AC on day 5. (B) Histopathologic sections of the eyes if CRYM−/− mice at 5 days after LPS injection. (A, B) H&E staining; scale bar, 100 μm. (C) The data indicate the mean number of inflammatory cells that infiltrated the AC of the CRYM+/+ (n = 6 for 24 hours; n = 4 for 5 days) and the CRYM−/− (n = 4 for 24 hours; n = 6 for 5 days) mice after LPS injection. The differences in the mean number of inflammatory cells infiltrating the AC in CRYM+/+ and CRYM−/− mice at 24 hours are not significant (P = 0.26). Significant differences in the mean number of inflammatory cells in the CRYM+/+ and CRYM−/− mice were observed on day 5 (*P < 0.05). Error bars, SEM.
The mean number (±SEM) of inflammatory cells that infiltrated the AC of the eyes in the CRYM−/− mice at day 5 was significantly lower than in the CRYM+/+ mice (17.9 ± 1.6 vs. 27.1 ± 2.4 cells/section; P = 0.006; Fig. 4C). On the other hand, the number in the CRYM−/− mice at 1 day after the LPS injection was not significantly different from that in the CRYM+/+ mice (9.5 ± 0.7 and 11.3 ± 1.6 cells/section, respectively; P = 0.26; Fig. 4C). 
mRNA Expression of Inflammatory Cytokines in CRYM−/− and CRYM+/+ Mice with EIU
According to the method used in Shen et al., 6 we collected mRNA from the ICB of the mice at 0, 3, and 5 days after the LPS injection. The baseline expression of IL-1α, IL-6, TNF-α, and GM-CSF was minimal and did not differ in both types of mice. The expression of each cytokine increased at day 3. However, there was not a significant difference between the CRYM+/+ and the CRYM−/− mice (data not shown). On the other hand, all these mRNAs had increased in the CRYM+/+ mice at day 5. 
The expression levels of the mRNA of IL-1α and -6 was significantly higher in the CRYM+/+ mice at 5 days than in the CRYM−/− mice (IL-1α; 2.9 ± 0.34-fold vs. 1.9 ± 0.24-fold; P = 0.037, IL-6; 500 ± 460-fold vs. 1 ± 0-fold; P = 0.004, n = 6). Although expression of the mRNA of IL-6 was not detected at day 0, the relative expression, normalized to the level of β-actin, was calculated, and the ratio of the expression of IL-6 in the CRYM+/+ mouse eye to that in the CRYM−/− mouse eye is plotted in Figure 5. The expression levels of the mRNA of TNF-α and GM-CSF was not significantly higher in CRYM+/+ mice than those in CRYM−/− mice at 5 days. (TNF-α; 11.7 ± 2.0-fold vs. 10.6 ± 1.4-fold; P = 0.64, GM-CSF; 3.1 ± 0.8 vs. 1.8 ± 0.3-fold, P = 0.20; Fig. 5). 
Figure 5.
 
The mRNA expression of inflammatory cytokines in CRYM+/+ and CRYM−/− mice with EIU (n = 6 for each day). The signal intensity for each spot was determined and normalized for real-time RT-PCR data. The expression ratios were obtained for IL-1α, TNF-α, and GM-CSF and represent the expression levels relative to that in the control eyes. The expression of IL-1α and -6 was significantly decreased at day 5 (*P = 0.037 and #P = 0.004, respectively), and the level of the mRNA of TNF-α and GM-CSF was also decreased, but not significantly (P = 0.64 and P = 0.20, respectively). Error bars, SEM.
Figure 5.
 
The mRNA expression of inflammatory cytokines in CRYM+/+ and CRYM−/− mice with EIU (n = 6 for each day). The signal intensity for each spot was determined and normalized for real-time RT-PCR data. The expression ratios were obtained for IL-1α, TNF-α, and GM-CSF and represent the expression levels relative to that in the control eyes. The expression of IL-1α and -6 was significantly decreased at day 5 (*P = 0.037 and #P = 0.004, respectively), and the level of the mRNA of TNF-α and GM-CSF was also decreased, but not significantly (P = 0.64 and P = 0.20, respectively). Error bars, SEM.
Discussion
In our earlier microarray analysis of the ICB in Lewis rats, 11 we found an upregulation in the expression of the mRNA of the CRYM gene by approximately12-fold at 6 and 12 hours after the LPS injection, but not the other crystallin genes (data not shown). Real-time RT-PCR analysis confirmed the microarray analysis. Considering these results, we studied CRYM-knockout mice, to try to determine the roles played by CRYM in the intraocular inflammation induced by LPS. 
The intraocular inflammatory response in mice was weaker than that in rats. In mice, the inflammatory response consisted of a strong posterior vitritis instead of iridocyclitis at 24 to 48 hours. In addition to the first wave of inflammation at day 1, a second stronger inflammation was observed at day 5. 5,6 These findings confirmed the earlier observations in the C3H/HeN strain of mice. We found similar kinetics with the neutrophils predominating in the first peak at day 1 and mononuclear leukocytes/macrophages in the second peak at day 5. Although we used C57BL/6J mice interbred to obtain the CRYM-knockout mice, the results were in good agreement with those in the earlier report. 5  
We then examined the expression of the mRNA of CRYM by using real-time RT-PCR and the level of CRYM protein by using Western blot analysis in the C57BL/6J mice. As expected, the expression level of CRYM mRNA increased at 12 hours, and returned to baseline at day 1, and remained at baseline. However, the CRYM protein in the ICB increased only at day 3, and the increase was weak. 
To investigate the function of CRYM in EIU, we compared the levels of inflammation in the CRYM−/− and CRYM+/+ mice. The number of inflammatory cells in the AC of the CRYM−/− mice was not significantly different from those in the CRYM+/+ mice at day 1. However, the number of inflammatory cells in the CRYM−/− mice at 5 days was significantly lower than that in the CRYM+/+ mice. The number of inflammatory cells in the vitreous cavity was less than that in the AC (data not shown). In addition to the decreased number of inflammatory cells in the AC of the CRYM−/− mice, the expression of IL-1α and I-6 was significantly decreased at 5 days. Shen et al. 6 reported that the mRNA of IL-1α, TNF-α, and GM-CSF, but not that of IL-6, increased 5 days after the induction of EIU. Our findings may differ from those of Shen et al. because they extracted mRNA from the whole eye, and most of the mRNA was from the retina. On the other hand, we extract the mRNA from only the ICB. 
In general, macrophages are known to secrete IL-1α, IL-6, TNF-α, and GM-CSF. 1921 Therefore, the upregulation of CRYM at 3 days may induce a delayed second inflammation. Because the predomination of neutrophils at day 1 did not differ between the CRYM−/− and CRYM+/+ mice, we suggest that there is a relationship between CRYM and monocytes/macrophage infiltration. 
Vie et al. 16 reported that CRYM was related to a cytosolic NADP-regulated thyroid hormone–binding protein. Suzuki et al. 17 reported that CRYM was nearly identical with nicotinamide-adenine dinucleotide phosphate (NADPH)–regulated thyroid hormone–binding protein (THBP) of humans. Several studies have reported that CRYM is related to the hair cycles in mouse skin, nonsyndromic deafness, and familial amyotrophic lateral sclerosis. 18,2224 However, the exact mechanism of the change in the CRYM level and the inflammation has not been determined. Shen et al. 6 reported a second peak of EIU in mice. They hypothesized a macrophage-dependent mechanism. Similarly, macrophages/monocytes were the major cells that infiltrated the AC at 5 days in our mice. Thus, we believe that CRYM may be associated with the recruitment or upregulation of these cells. However, there is no evidence supporting this notion, and thus further investigations are needed. 
In conclusion, our results showed that the mRNA and protein of CRYM were upregulated in the ICB after induction of EIU by LPS. The absence of CRYM in the knockout mice suppressed the expression of the mRNA of IL-1α and -6 and a small number of inflammatory cells infiltrated the AC at 5 days after the LPS injection. Thus, CRYM may play a minor role in the development of EIU, but these results suggest that CRYM is involved in the late phase of inflammation in EIU. To investigate new mechanisms of ocular inflammation including human chronic uveitis, further examination of this newly discovered protein is needed. 
Footnotes
 Disclosure: H. Imai, None; K. Ohta, None; A. Yoshida, None; S. Suzuki, None; K. Hashizume, None; S. Usami, None; T. Kikuchi, None
The authors thank Kayo Suzuki for help in the histopathologic studies and Duco Hamasaki for editing the manuscript. 
References
Rosenbaum JT McDevitt HO Guss RB Egbert PR . Endotoxin-induced uveitis in rats as a model for human disease. Nature. 1980;286:611–613. [CrossRef] [PubMed]
de Vos AF van Haren MA Verhagen C Hoekzema R Kijlstra A . Kinetics of intraocular tumor necrosis factor and interleukin-6 in endotoxin-induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994;35:1100–1106. [PubMed]
de Vos AF Klaren VN Kijlstra A . Expression of multiple cytokines and IL-1RA in the uvea and retina during endotoxin-induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994;35:3873–3883. [PubMed]
Li Q Peng B Whitcup SM . Endotoxin induced uveitis in the mouse: susceptibility and genetic control. Exp Eye Res. 1995;61(5):629–632. [CrossRef] [PubMed]
Kozhich AT Chan CC Gery I Whitcup SM . Recurrent intraocular inflammation in endotoxin-induced uveitis. Invest Ophthalmol Vis Sci. 2000;41:1823–1826. [PubMed]
Shen DF Chang MA Matteson DM Buggage R Kozhich AT Chan CC . Biphasic ocular inflammatory response to endotoxin-induced uveitis in the mouse. Arch Ophthalmol. 2000;118:521–527. [CrossRef] [PubMed]
Yoshida M Yoshimura N Hangai M Tanihara H Honda Y . interleukin-1α, interleukin-1β, and tumor necrosis factor gene expression in endotoxin-induced uveitis. Invest Ophthalmol Vis Sci. 1994;35:1107–1113. [PubMed]
Hoekzema R Verhagen C van Haren M Kijlstra A . Endotoxin induced uveitis in the rat: the significance of intraocular interleukin-6. Invest Ophthalmol Vis Sci. 1992;33:532–539. [PubMed]
Kasner L Chan CC Whitcup SM Gery I . The paradoxical effect of tumor necrosis factor-alpha (TNF-α) in endotoxin-induced uveitis. Invest Ophthalmol Vis Sci. 1993;34:2911–2917. [PubMed]
Ohta K Nakayama K Kurokawa T Kikuchi T Yoshimura N . Inhibitory effects of pyrrolidine dithiocarbamate on endotoxin-induced uveitis in Lewis rats. Invest Ophthalmol Vis Sci. 2002;43:744–750. [PubMed]
Ohta K Kikuchi T Miyahara T Yoshimura N . DNA microarray analysis of gene expression in iris and ciliary body of rat eyes with endotoxin-induced uveitis. Exp Eye Res. 2005;80:401–412. [CrossRef] [PubMed]
Wistow G Kim H . Lens protein expression in mammals: taxon-specificity and the recruitment of crystallins. J Mol Evol. 1991;32:262–269. [CrossRef] [PubMed]
Kim RY Gasser R Wistow GJ . mu-crystallin is a mammalian homologue of Agrobacterium ornithine cyclodeaminase and is expressed in human retina. Proc Natl Acad Sci U S A. 1992;89:9292–9296. [CrossRef] [PubMed]
Goodman JL Wang S Alam S Ruzicka FJ Frey PA Wedekind JE . Ornithine cyclodeaminase: structure, mechanism of action, and implications for the mu-crystallin family. Biochemistry. 2004;43:13883–13891. [CrossRef] [PubMed]
Segovia L Horwitz J Gasser R Wistow G . Two roles for μ-crystallin: a lens structural protein in diurnal marsupials and a possible enzyme in mammalian retinas. Mol Vis. 1997;9:3:9.
Vie MP Evrard C Osty J . Purification, molecular cloning, and functional expression of the human nicodinamide-adenine dinucleotide phosphate-regulated thyroid hormone-binding protein. Mol Endocrinol. 1997;11(11):1728–1736. [CrossRef] [PubMed]
Suzuki S Suzuki N Mori J Oshima A Usami S Hashizume K . μ-Crystallin as an intracellular 3,5,3′-triiodothyronine holder in vivo. Mol Endocrinol. 2007;21:885–894. [CrossRef] [PubMed]
Oshima A Suzuki S Takumi Y Hashizume K Abe S Usami S . CRYM mutations cause deafness through thyroid hormone binding properties in the fibrocytes of the cochlea. J Med Genet. 2006;43:e25. [CrossRef] [PubMed]
Schultz RM . Interleukin 1 and interferon-gamma: cytokines that provide reciprocal regulation of macrophage and T cell function. Toxicol Pathol. 1987;15(3):333–337. [CrossRef] [PubMed]
Ruef C Coleman DL . Granulocyte-macrophage colony-stimulating factor: pleiotropic cytokine with potential clinical usefulness. Rev Infect Dis. 1990;12(1):41–62. [CrossRef] [PubMed]
Nacy CA Meierovics AI Belosevic M Green SJ . Tumor necrosis factor-alpha: central regulatory cytokine in the induction of macrophage antimicrobial activities. Pathobiology. 1991;59(3):182–184. [CrossRef] [PubMed]
Aoki N Ito K Ito M . mu-Crystallin, thyroid hormone-binding protein, is expressed abundantly in the murine inner root sheath cells. J Invest Dermatol. 2000;115(3):402–405. [CrossRef] [PubMed]
Abe S Katagiri T Saito-Hisaminato A . Identification of CRYM as a candidate responsible for nonsyndromic deafness, through cDNA microarray analysis of human cochlear and vestibular tissues. Am J Hum Genet. 2003;72(1):73–82. [CrossRef] [PubMed]
Fukada Y Yasui K Kitayama M . Gene expression analysis of the murine model of amyotrophic lateral sclerosis: studies of the Leu126delTT mutation in SOD1. Brain Res. 2007;1160:1–10. [CrossRef] [PubMed]
Figure 1.
 
Real-time RT-PCR for the CRYM gene in the ICB of EIU mice at 0 and 12 hours and 1, 2, 3, and 5 days (n = 4) after the LPS injection. The signal intensity for each spot was calculated and normalized for real-time RT-PCR data. The expression ratios were obtained for each targeted gene and represent the expression levels relative to that of the control eyes.
Figure 1.
 
Real-time RT-PCR for the CRYM gene in the ICB of EIU mice at 0 and 12 hours and 1, 2, 3, and 5 days (n = 4) after the LPS injection. The signal intensity for each spot was calculated and normalized for real-time RT-PCR data. The expression ratios were obtained for each targeted gene and represent the expression levels relative to that of the control eyes.
Figure 2.
 
Western blot analysis for CRYM protein in the ICB of mice with EIU at 0, 1, 3, and 5 days (n = 4) after the LPS injection. Top: exposure to polyclonal rabbit anti-CRYM antibody; bottom: exposure to anti-β-actin antibody. Products were made visible with 3,3′-diaminobenzidine (DAB).
Figure 2.
 
Western blot analysis for CRYM protein in the ICB of mice with EIU at 0, 1, 3, and 5 days (n = 4) after the LPS injection. Top: exposure to polyclonal rabbit anti-CRYM antibody; bottom: exposure to anti-β-actin antibody. Products were made visible with 3,3′-diaminobenzidine (DAB).
Figure 3.
 
Time course of the number of inflammatory cells infiltrating the AC of EIU mice. (A) C57BL/6J mice. Data indicate the mean number of inflammatory cells at each time point (n = 6 for days 1, 3, 5; n = 4 for days 0, 7, and 10) after LPS injection. Histologic sections of eyes of EIU mice were stained with HE. Error bars, SEM. (B) CRYM+/+ and CRYM−/− mice injected with LPS. Data indicate the mean number of inflammatory cells at each time point (n = 4 to 6 for each day) after the LPS injection. The mean number in the CRYM+/+ mice on day 5 was significantly more than that on days 3 and 7 (*P < 0.05). On day 5, significant differences in the mean number of inflammatory cells between the CRYM+/+ and CRYM−/− mice are observed (*P < 0.05). Error bars, SEM.
Figure 3.
 
Time course of the number of inflammatory cells infiltrating the AC of EIU mice. (A) C57BL/6J mice. Data indicate the mean number of inflammatory cells at each time point (n = 6 for days 1, 3, 5; n = 4 for days 0, 7, and 10) after LPS injection. Histologic sections of eyes of EIU mice were stained with HE. Error bars, SEM. (B) CRYM+/+ and CRYM−/− mice injected with LPS. Data indicate the mean number of inflammatory cells at each time point (n = 4 to 6 for each day) after the LPS injection. The mean number in the CRYM+/+ mice on day 5 was significantly more than that on days 3 and 7 (*P < 0.05). On day 5, significant differences in the mean number of inflammatory cells between the CRYM+/+ and CRYM−/− mice are observed (*P < 0.05). Error bars, SEM.
Figure 4.
 
Histopathologic examinations of the ICB of CRYM+/+ and CRYM−/− mice. (A) CRYM+/+ mouse eyes at 5 days after LPS injection. Inflammatory cells, mainly macrophages, were present in the AC on day 5. (B) Histopathologic sections of the eyes if CRYM−/− mice at 5 days after LPS injection. (A, B) H&E staining; scale bar, 100 μm. (C) The data indicate the mean number of inflammatory cells that infiltrated the AC of the CRYM+/+ (n = 6 for 24 hours; n = 4 for 5 days) and the CRYM−/− (n = 4 for 24 hours; n = 6 for 5 days) mice after LPS injection. The differences in the mean number of inflammatory cells infiltrating the AC in CRYM+/+ and CRYM−/− mice at 24 hours are not significant (P = 0.26). Significant differences in the mean number of inflammatory cells in the CRYM+/+ and CRYM−/− mice were observed on day 5 (*P < 0.05). Error bars, SEM.
Figure 4.
 
Histopathologic examinations of the ICB of CRYM+/+ and CRYM−/− mice. (A) CRYM+/+ mouse eyes at 5 days after LPS injection. Inflammatory cells, mainly macrophages, were present in the AC on day 5. (B) Histopathologic sections of the eyes if CRYM−/− mice at 5 days after LPS injection. (A, B) H&E staining; scale bar, 100 μm. (C) The data indicate the mean number of inflammatory cells that infiltrated the AC of the CRYM+/+ (n = 6 for 24 hours; n = 4 for 5 days) and the CRYM−/− (n = 4 for 24 hours; n = 6 for 5 days) mice after LPS injection. The differences in the mean number of inflammatory cells infiltrating the AC in CRYM+/+ and CRYM−/− mice at 24 hours are not significant (P = 0.26). Significant differences in the mean number of inflammatory cells in the CRYM+/+ and CRYM−/− mice were observed on day 5 (*P < 0.05). Error bars, SEM.
Figure 5.
 
The mRNA expression of inflammatory cytokines in CRYM+/+ and CRYM−/− mice with EIU (n = 6 for each day). The signal intensity for each spot was determined and normalized for real-time RT-PCR data. The expression ratios were obtained for IL-1α, TNF-α, and GM-CSF and represent the expression levels relative to that in the control eyes. The expression of IL-1α and -6 was significantly decreased at day 5 (*P = 0.037 and #P = 0.004, respectively), and the level of the mRNA of TNF-α and GM-CSF was also decreased, but not significantly (P = 0.64 and P = 0.20, respectively). Error bars, SEM.
Figure 5.
 
The mRNA expression of inflammatory cytokines in CRYM+/+ and CRYM−/− mice with EIU (n = 6 for each day). The signal intensity for each spot was determined and normalized for real-time RT-PCR data. The expression ratios were obtained for IL-1α, TNF-α, and GM-CSF and represent the expression levels relative to that in the control eyes. The expression of IL-1α and -6 was significantly decreased at day 5 (*P = 0.037 and #P = 0.004, respectively), and the level of the mRNA of TNF-α and GM-CSF was also decreased, but not significantly (P = 0.64 and P = 0.20, respectively). Error bars, SEM.
Table 1.
 
Primer and Probe Sequences Used for the Real-Time PCR Analysis
Table 1.
 
Primer and Probe Sequences Used for the Real-Time PCR Analysis
Gene Assay ID Accession Number*
IL-1a Mm00439620_ml NM_010554
IL-6 Mm00446190_ml NM_031168
TNF Mm00443258_ml NM_013693
GM-CSF Mm00438328_ml NM_009969
Gene Primer for Real-Time PCR Sequence (5′–3′) Probe (5′–3′)†
CRYM
    Forward GCATCGGTGCTTCTCTTTGATC FAM-CTGCTGGCGGTCAT
    Reverse CCGCTGCTGTTCTCTTTGC
β-Actin
    Forward CGATGCCCTGAGGCTCTTT FAM-AGCCTTCCTTCTTGGGTAT
    Reverse TTCATGGATGCCACAGGATTC
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×