TRPC6 Channel Protects Retinal Ganglion Cells in a Rat Model of Retinal Ischemia/Reperfusion-Induced Cell Death

Abstract

Purpose.: To examine the potential role of transient receptor potential canonical 6 (TRPC6) in the survival of retinal ganglion cells (RGCs) in the rat retinal ischemia/reperfusion (IR) model.

Methods.: TRPC6 expression in normal rat retina was analyzed by RT-PCR, Western blot analysis, in situ hybridization, and immunohistochemistry. The rat retinal IR model was established, and then the time course of TRPC6 expression was evaluated. Pharmacologic experiments were conducted. The expression of brain-derived neurotrophic factor (BDNF) was measured in the retinal IR model. Densities of surviving RGCs were estimated by counting fluorogold-labeled cells in 12 standard retinal areas.

Results.: TRPC6 mRNA and protein are selectively enriched in the RGC layer of the retina. A 60-minute interval of retinal ischemia could induce the elevation of TRPC6 mRNA and protein, both of which peaked 24 hours after reperfusion. TRPC6 protein expression decreased dramatically 1 week later, accompanied by substantial RGC loss. The TRPC channel's agonist significantly increased RGC survival, and the antagonist reduced cell density. The transcription level of the bdnf gene was enhanced at 24 hours; this paralleled the increase of TRPC6. When TRPC6 was blocked, the BDNF precursor (proBDNF), rather than its mature form (mBDNF), increased at 24 hours.

Conclusions.: This study documents the pattern of TRPC6 expression in the retinal IR model and provides evidence that activating TRPC channels before ischemia has early neuroprotective effects on RGCs in vivo. The protection of TRPC6 is BDNF mediated, and proBDNF-p75^NTR signaling may contribute to the death of RGCs in retinal ischemia injury.

Retinal ganglion cells (RGCs) are considered an attractive reciprocal model for studying neural degeneration diseases in the central nervous system (CNS). ^{1 –3} Progressive loss of RGCs occurs in some ocular degenerative diseases, including glaucoma, diabetic retinopathy, and vascular occlusion. ^{4 –6} Retinal ischemia is postulated to be a risk factor. ^4,5 Thus far, there is no completely effective treatment for this condition, in part because its underlying mechanisms are not well understood. 

The pattern of RGC loss that follows transient ischemia of the retina induced by selective ligature of the ophthalmic vessels has been demonstrated in the rat retinal ischemia/reperfusion (IR) model. ^7,8 RGC death relates to the duration of the ischemia ^5,7,8 and is accompanied by the upregulation of apoptotic and early-immediate genes. ⁹ We recently confirmed that the time course of cell loss after 60 minutes of retinal ischemia was consistent with previous studies. ^7,8  

The transient receptor potential (TRP) channels are Ca²⁺-permeable, nonselective cation channels that are broadly expressed in the CNS. ^10,11 Among the mammalian TRP superfamily, the classical or canonical receptor subfamily (TRPC1–7) is expressed in a variety of organisms and exhibits multiple physiological functions. ^{10 –13} Recent studies have revealed that TRPC3 and TRPC6 participate in brain-derived neurotrophic factor (BDNF)-mediated neuron survival and that overexpression of TRPC3 and TRPC6 protects cerebellar granule neurons against serum deprivation–induced cell death. ¹⁴  

The TRPC subfamily has been identified in retinal cells, including Müller cells, ^15,16 the retinal pigment epithelium (RPE), ¹⁷ rods, ¹⁸ and RGCs. ^{19 –21} TRPC6 mRNA was even detected at significant levels in mammalian retina, and TRPC6 protein has been located in the RGC layer in rats by immunohistochemistry. ¹⁹  

In the present study, we explored the potential role of TRPC6 in the progressive loss of RGCs in response to retinal IR injury. After examining the expression change pattern of TRPC6 in the retinal IR model, we found that activating the TRPC6 channel can protect against ischemia-induced RGC death in vivo. Furthermore, we demonstrated that the protection of TRPC6 takes place through BDNF-dependent pathways and that the signaling of the precursor of BDNF-p75^NTR (proBDNF-p75^NTR) may regulate the death of RGCs. 

Materials and Methods

Animal and Tissue Preparation

All procedures using animals were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Adult male Sprague-Dawley rats (weight range, 200–250 g; Sino-British Sippr/BK Lab Animal Ltd., Shanghai, China) used in the experiment were maintained in a 12-hour light/12-hour dark illumination cycle with unrestricted food and water supplies. For histology, the rats were deeply anesthetized with chloral hydrate (800 mg/kg) and perfused with saline (0.9% NaCl) followed by 4% paraformaldehyde. The eyes were immediately enucleated, and the retinas were removed for whole-mounting preparations or embedded in OCT for cross-sectioning (20-μm thick). 

In Situ Hybridization

Riboprobes were prepared from a trpc6 cDNA insert cloned in a vector system (T Easy Vector; Promega, Madison, WI). Hybridization was performed on 20-μm sections of fresh tissues. Sections were incubated with 0.5- to 1-μg/mL probes in hybridization solution. After hybridization, the sections were sequentially washed in SSC. RNase A (0.1 μg/mL) was used to remove mismatched cRNA hybrids. The sections were then blocked with 20% heat-inactivated sheep serum in PBT. The digoxigenin (DIG) label was detected with an alkaline phosphatase-conjugated anti-DIG antibody (1:2000; Roche, Nutley, NJ) visualized with nitroblue tetrazolium (NBT; Roche) and 5-bromo-5-chloro-3-indolyl phosphate (BCIP; Roche) (1 μL NBT and 3.5 μL BCIP in 1 mL AP buffer). 

Immunohistochemistry

Frozen retinal sections were processed for immunohistochemical assay. The first antibody was rabbit anti-TRPC6 (1:100; Alomone Laboratories Ltd., Jerusalem, Israel), the second was AlexaFluor 488–conjugated goat anti-rabbit antibody (1:2000; Molecular Probes, Eugene, OR). Tissue sections were mounted with Hoechst 33342 for nuclear staining and viewed using a two-photon laser confocal scanning system (LSM 510; Zeiss, Thornwood, NY). 

RT-PCR and Real-time PCR

Rat retinal tissues were extracted and homogenized in reagent (Trizol; Invitrogen, Carlsbad, CA) at 4°C. Total RNA was extracted according to the manufacturer's instructions. Reverse transcription (RT) was carried out using a kit from Promega (Madison, WI). Approximately one-twentieth of the RT products was used for PCR reagents (PCR Premix Perfect-shot Ex-Taq; Takara, Biotechnology Co. Ltd., Dalian, P.R. China). Real-time PCR was also performed (SYBR Premix Ex-Taq; Takara Biotechnology Co. Ltd.). Primer sequences are given in Table 1. Successful amplification of both trpc6 and trpc3 was performed at 95°C for 5 minutes, 94°C for 45 seconds, 59°C for 45 seconds, and 72°C for 45 seconds for 38 cycles, followed by extension at 72°C for 10 minutes. For bdnf it was performed at 95°C for 5 minutes, 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 30 seconds for 32 cycles, followed by extension at 72°C for 10 minutes. All real-time PCR was performed in duplicate using a sequence detection system (Prism 7000; Applied Biosystems, Foster City, CA). Data analyses of gene expression levels were determined by the 2-^ΔΔCt method using gapdh as a reference. 

Table 1.

 

Primers Used in PCR

Primer	Oligonucleotide Sequences (5′→3′)
TRPC1	Forward: TCTTGACAAACGAGGACTACTA
	Reverse: TTACAGGTGGGCTTACGG
TRPC3	Forward: GTCGTGTCAAACTTGCCATTA
	Reverse: AGGTGCGATCCAGTAGCC
TRPC6	Forward: GTCCCTGCTTTATCTCCTATTG
	Reverse: CTTCGTTCACTTCATCACTCTC
BDNF	Forward: AGCTGTGCGGACCCATGG
	Reverse: GAACCGCCAGCCAATTCTC
GAPDH	Forward: CCCCAATGTATCCGTTGTG
	Reverse: CTCAGTGTAGCCCAGGATGC

Western Blot Analysis

Retinal tissues were homogenized in RIPA solution, and protein concentrations were determined by the Bradford assay (Bio-Rad, Hercules, CA). Nine percent of the SDS-PAGE gel was made for TRPC3 and TRPC6 and 15% for BDNF. The blots were probed with antibodies diluted as follows: rabbit anti-TRPC3 (1:200; Alomone Laboratories Ltd.), rabbit anti-TRPC6 (1:200; Alomone Laboratories Ltd.), rabbit anti-BDNF (1:200; sc-546, Santa Cruz Biotechnology, Santa Cruz, CA), horseradish peroxidase (HRP)-conjugated secondary antisera (1:2000; Santa Cruz Biotechnology). Immunoreactive protein bands were visualized with a Western blotting detection system (ECL Plus; Amersham). The intensity of the bands was quantified with software analysis (ImageQuant 5.2; Molecular Dynamics, Eugene, OR). 

Retinal Ischemia/Reperfusion

Retinal ischemia/reperfusion was established according to previous methods. ^7,8 Transient retina ischemia was induced by selective ligature of the ophthalmic vessels of the right eye for 60 minutes. In the present study, only eyes in which complete perfusion recovered within 5 minutes after ligature removal were used for study. 

Retrograde Labeling of RGCs and Cell Counting

Retrograde labeling of RGCs with fluorogold (FG; Biotium Inc., Hayward, CA) was performed as previously described. ^{22 –24} The dissected retina was flat-mounted and fixed for 30 minutes with 4% paraformaldehyde. Regions of the retina used for cell counting were located circumferentially one-sixth, one-half, and five-sixths from the retinal center; these were observed under a fluorescence microscope (Eclipse TE2000-S; Nikon, Tokyo, Japan). ²² The number of labeled RGCs present in the quadrant were estimated, ^8,22 and the data were analyzed with software (Stereo Investigator; MicroBrightField, Inc., Williston, VT). The percentage of cell loss per region was determined by dividing test cell counts for each of the 12 areas by the mean count from the same region of nonischemic control eyes. Cell counting was performed in a masked manner. Selective vascular ligature or intravitreal injections were performed 7 days after retrograde labeling. 

Drug Administration

Drugs were administered by intravitreal injection into the right eye 30 minutes before ischemia. A 2-μL vehicle was injected into the left eye as a control. Intravitreal injection was performed as previously described in detail. ^25,26 Eyes damaged by vitreous injection were excluded. Antibiotic eyedrops of 0.5% loxacin were administrated to avoid infection. SKF96365, an inhibitor known to block TRPC channels (Sigma, St. Louis, MO), was dissolved in 0.2 M sterile phosphate-buffered saline (PBS, pH 7.4) to a final concentration of 20 mM. One-oleoy1–1 acetyl-sn glycerol (OAG), an agonist of TRPC channels, was dissolved in dimethyl sulfoxide to a final concentration of 100 mM. TAT-Pep5 (Calbiochem, Temecula, CA), an inhibitor of p75^NTR signaling, was freshly dissolved in dimethyl sulfoxide at 0.1 mM. 

Statistical Analysis

All preparations, experiments, and measurements were performed in triplicate. Experimental data were analyzed by ANOVA and Student's t-test. Data were presented as mean ± SD. In all cases, P < 0.05 was considered to be significant. 

Results

TRPC6 Was Expressed in Normal Rat Retina and Enriched in RGCs

To explore the role of TRPC6 in the rat retina IR model, we first examined the expression and location of TRPC6 in the normal rat retina. Previous studies have confirmed the expression of TRPC6 in the brain and kidney. ¹⁰ RT-PCR and Western blot analyses showed that both TRPC3 and TRPC6 mRNA and protein were expressed in the rat retina (Figs. 1A, 1B). 

Figure 1.

 

Expression of TRPC channels in the normal rat retina. (A, B) mRNA and protein of both TRPC3 and TRPC6 were detected using brain and kidney as positive controls. (C) Little staining was seen in the control section by in situ hybridization with a sense trpc6 probe. (D) Strong staining was seen in cell bodies in GCL with the antisense trpc6 probe, and positive staining also was seen in INL. (E) Robust trpc6 expression in RGCs (larger cell body, red arrow) and glial cells (smaller cell body, black arrow) under higher magnification. (F) Immunohistochemistry showed strong signals of TRPC6 in RGCs, with some labeling in PRL and INL. ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; NFL, nerve fiber layer; PRL, photoreceptor layer.

To identify the exact localization of TRPC6 in the retina, we examined its mRNA and protein levels by in situ hybridization and immunohistochemistry. The TRPC6 antibody used in the present study has previously been applied to immunohistology. ²⁷ The results showed that trpc6 mRNA localizes in the retina mainly within the RGC layer and partly in the innermost area of the inner nuclear layer (Figs. 1C–E). TRPC6 protein was expressed in most cells in the RGC layer. There was also punctate staining in the inner nuclear layer and photoreceptor layer (Fig. 1F). No labeling was seen in the control when the TRPC6 antibody was omitted from the second round of staining (data not shown). These results demonstrated that TRPC6 was expressed and located in the rat retina and was especially enriched in the RGC layer. 

TRPC6 Was Upregulated in Retinal IR Injury

We next examined the time course of TRPC6 expression in the retinal IR model (Fig. 2). Because TRPC3 has a structure similar to that of TRPC6, we also examined its expression concurrently. TRPC6 protein transiently increased up to 24 hours after reperfusion and then declined, whereas TRPC3 exhibited no apparent change (Figs. 2A, 2B). TRPC6 expression was further evaluated at 24 hours by immunohistochemical assay; staining of TRPC6 in the RGC layer was stronger than in the control section (Fig. 2C). 

Figure 2.

 

Expression profile of TRPC6 in retinal IR model. (A, B) TRPC6 protein increased and reached a peak at 24 hours, then decreased within 1 week after reperfusion, while there was no change in TRPC3 (**P < 0.05 compared with the control; n = 6). (C) Sections at 24 hours displayed elevated TRPC6 protein expression in RGCs (arrows) compared with control as measured by immunohistochemistry. (D, E) The trpc6 mRNA elevation appeared as early as 12 hours and peaked at 24 hours, whereas both trpc1 and trpc3 mRNA expression exhibited no change (**P < 0.05 compared with control; n = 6).

To study whether the increased TRPC6 protein was caused by enhanced transcription, we determined the mRNA expression of trpc6 by RT-PCR; trpc1 and trpc3 were also detected (Fig. 2D). trpc6 mRNA detected by real-time PCR displayed an elevation as early as 12 hours and peaked 24 hours after reperfusion; however, neither trpc1 nor trpc3 showed any significant change (Fig. 2E). The results indicated that the TRPC6 channel had a potential impact on RGCs in response to retinal ischemia injury. 

Pattern of RGC Loss in the Rat IR Model Was Established

A progressive loss of FG-labeled RGCs took place within the first 7 days in the rat IR model (Fig. 3). In the nonischemic retinas, the mean densities of the RGCs were consistently uniform (Fig. 3A). In ischemic retinas, the survival of RGCs at 24 hours, 48 hours, 72 hours, and 1 week after reperfusion were 91%, 81%, 73%, and 62%, respectively. At 72 hours, microglial cells, identified by their morphology, ²⁸ were also intensely labeled (Figs. 3B, 3C). Statistical analysis showed that the survival of RGCs in the affected eyes at 48 hours, 72 hours, and 1 week was significantly lower than in controls (Fig. 3D). Thus, the time course of RGC loss after 60 minutes of ischemia corresponded to those of previous studies. ^7,8  

Figure 3.

 

The pattern of RGC loss in the rat IR model. (A) FG-traced RGCs in control retinas. (B) FG-traced RGCs at 72 hours after reperfusion. Some transcellularly traced microglial cells (arrow) were apparent at this time point. (C) FG-traced RGCs at 1 week after reperfusion. The density of RGCs decreased greatly, whereas that of microglial cells increased (arrows). All images in (A–C) were taken from the same retinal area. (D) Progressive loss of RGCs was induced in the retinal IR model. The results were statistically significant at 48 hours, 72 hours, and 1 week after reperfusion (*P < 0.05, **P < 0.01 compared with control; n = 8).

TRPC Channels Promoted RGC Survival in Retinal Ischemia Injury

To test whether the TRPC6 channel can directly protect RGCs against retinal IR-induced death, the TRPC channel's agonist OAG and antagonist SKF96365 were administered by intravitreal injection half an hour before the ischemic injury (Fig. 4). Rats were processed 24 hours, 48 hours, 72 hours, or 1 week later, and the densities of viable RGCs were estimated by counting FG-labeled RGCs. Pretreatment with OAG notably improved RGC density in a time-dependent manner (Fig. 4G). At 48 and 72 hours after reperfusion, the densities of RGCs were considerably higher than in eyes treated with vehicle (Figs. 4D, 4E). When the TRPC antagonist SKF96365 was also applied, the RGC densities were significantly lower than in vehicle-treated eyes at 48 hours after reperfusion (Figs. 4F, 4H), indicating that SKF96365 enhanced the death of RGCs in the IR model. The results indicated that TRPC activation protects RGCs. 

Figure 4.

 

TRPC channels prevented RGC loss. (A–C) FG-traced RGCs in ischemia-injured retinas at 0 (A), 48 (B), or 72 (C) hours after reperfusion treated with intravitreal injection of the vehicle. (D, E) FG-traced RGCs in ischemia-injured retinas treated with a single intravitreal injection of OAG at 48 (D) or 72 (E) hours after reperfusion. (F) FG-traced RGCs in ischemia-injured retinas treated with a single intravitreal injection of SKF96365 at 48 hours after reperfusion. All images were taken from the same retinal area. (G) Survival numbers of RGCs in retinas treated with OAG from 48 to 72 hours were significantly greater than those in vehicle controls (*P < 0.05; n = 5). (H) Survival numbers of RGCs in retinas treated with SKF96356 were significantly lower at 48 hours after reperfusion than were vehicle-treated ones (*P < 0.05; n = 5).

ProBDNF-p75^NTR Signaling Contributed to the Death of RGCs while Inhibiting TRPC Channels

Previous studies have indicated that TRPC6 is required for the neuroprotective effect of BDNF. ¹⁴ It has also been reported that increasing BDNF levels in retinal tissue confers neuroprotective effects on RGCs under ischemia. ^29,30 To explore this connection, we examined bdnf gene expression in the retinal IR model. bdnf transcription was elevated as early as 3 hours after reperfusion, reached a peak at 24 hours, and then declined to the basal level at 1 week (Figs. 5A, 5B). The results imply that the TRPC6 channel may be linked to the BDNF neuroprotective process in retinal IR injury. 

Figure 5.

 

ProBDNF-p75^NTR signaling participates in the death of RGCs while inhibiting TRPC channels. (A, B) Expression of bdnf mRNA in the retinal IR model. bdnf mRNA elevation appeared as early as 3 hours and reached a peak at 24 hours (B; *P < 0.05; n = 6). (C, D) Expression profiles of proBDNF and mBDNF in retinal IR model with treatment of SKF96365. The proBDNF protein level increased at 24 hours after reperfusion (*P < 0.05; n = 6), whereas the mBDNF did not show a significant change (P > 0.05; n = 6). (E) mRNA expression of bdnf at 24 hours with different treatments (sham, IR, IR+PBS, IR+SKF96365; *P < 0.05; n = 5). (F) Survival numbers of RGCs in retinas treated with TAT-pep5 were significantly higher at 48 hours after reperfusion than for vehicle-treated ones (*P < 0.05; n = 6).

We further examined the protein expression of BDNF when blocking TRPC channels with SKF96365. Interestingly, there was no detectable change in mature BDNF (mBDNF), whereas proBDNF exhibited a significant increase (Fig. 5C). The peak expression of proBDNF was observed 24 hours after reperfusion (Fig. 5D). Further, the mRNA expression of bdnf at 24 hours after different treatments (sham, IR, IR+PBS, IR+SKF96365) was evaluated by real-time PCR. The results showed that the expression of bdnf treatment with SKF96356 was 2.7-, 1.7-, and 1.4-fold with sham, IR, and IR+PBS, respectively (Fig. 5E). 

Given that studies have suggested that proBDNF-p75^NTR signaling mediates the death of cells in the CNS, ^31,32 we wondered whether it also had a similar effect on ischemia-elicited RGC death. To test this hypothesis, TAT-Pep5, an inhibitor of p75^NTR signaling, was administered. Retinas were whole-mounted and RGCs were counted at 1, 2, 3, or 7 days. The densities of RGCs treated with TAT-PEP5 were significantly higher than those of the control group 48 hours after perfusion (Fig. 5F). This result suggested that RGC death induced by blocking TRPC channels may be mediated by proBDNF-p75^NTR signaling. 

Discussion

The present study demonstrates that TRPC6 channel upregulation protects RGCs against retina IR-induced death in the rat model. Further study indicates that the protection of TRPC6 is likely mediated by a BNDF-dependent pathway that is consistent with previous findings, ¹⁴ and proBDNF-p75^NTR signaling may contribute to the death of RGCs in retinal ischemia injury. 

At present, more than 30 TRP members have been cloned in both vertebrates and invertebrates since TRP channels were first identified in a Drosophila phototransduction mutation. ^33,34 TRPC has the highest structural similarity to Drosophila TRP channels. ^10,12,13 It can be classified terms of homology and can function in four subfamilies: TRPC1, TRPC2, TRPC4/5, and TRPC3/6/7. ^12,13 Accumulating evidence has shown that TRPC has diverse roles in many neurodegenerative disorders in the CNS. ^14,35  

Preliminary studies of selected functions of TRP channels have been carried out in the retina. Wang et al. ^36,37 showed that constitutively activating TRP channels resulted in retinal degeneration from Ca²⁺ overload. TRPC channels may mediate basal Ca²⁺ entry in RPE cells. ¹⁷ TRPC channel blockers can suppress light-evoked currents in photosensitive RGCs in rats. ²⁰ A recent study revealed that the transient receptor potential vanilloid 1 (TRPV1) played an important role in pressure-induced RGC apoptosis. ³⁸  

The retinal IR model can to a large extent simulate the progressive loss of RGCs after ischemic insult. ^7,8 The pattern of TRPC6 expression was first investigated in this study. Our findings suggested that the increased expression represents a part of the retina responding to ischemic insults, and endogenous TRPC6 may contribute to a natural neuroprotective process against retinal ischemia; this was further supported by the pharmacologic results. 

We do consider that OAG, a nonspecific agonist of TRPC that can activate TRPC3/6/7 channels directly, ³⁹ may weaken the pharmacologic effect on TRPC6. However, TRPC6 exhibits a predominant expression over TRPC3 and TRPC7 at the mRNA level in highly purified rat RGC cultures. ²¹ Meanwhile, in our IR model, TRPC3 with a very low expression in retinas was not significantly changed, whereas TRPC6 was selectively enriched in the RGC layer. Therefore, we may assume that the protective effect for the RGCs does not come from a homomeric TRPC3 or TRPC7 channel; rather, it comes primarily from TRPC6 homomeric or TRPC3/6/7 heteromeric channels. 

The neuroprotective effect of TRPC6 on RGCs was transient. Although administration of the activator OAG was able to significantly increase RGC survival at 48 or 72 hours after IR, it dropped back to the original level 1 week later. A short-term effect on RGCs was also seen in the TRPC inhibitor SKF96365, possibly because of the failure of maintaining the drug concentration consistently high enough after aqueous humor clearance by a single intravitreal injection. Repeated intraocular injections might prolong the neuroprotection but could also cause ocular damage. Gene therapy is a promising strategy for long-term neuroprotection. ⁴⁰  

TRPC participation in neuron survival and activity in the CNS was BDNF-mediated. ^12,14,41,42 As a potent neuroprotective agent, BDNF has been proven a good candidate for the therapeutic treatment of some CNS disorders. ⁴³ BDNF-dependent pathways of neuron survival in the CNS may share similarity with RGCs in the retina. As a matter of fact, BDNF has long been known to influence RGC survival, both during retinal development and after lesion formation. ^{44 –51} BDNF-based therapy is of potential use in treating RGC degeneration in humans. ⁵²  

BDNF expression and its potential role in the retinal IR model have long been investigated. ^29,30 Our results were remarkably consistent with those of previous studies. ⁵³ In particular, its increments paralleled the expression of TRPC6. Because TRPC has been identified as the key downstream effector for the neuronal protective effect of BDNF, ¹⁴ it is clear that BDNF has a neuroprotective effect and that its expression is cAMP/Ca²⁺-response element binding protein (CREB)-dependent. ⁵⁴ It is known that CREB is activated in neurons in response to a diverse array of stimuli, ^55,56 such as ischemic insult. Thus, the neuroprotective effect of TRPC6 on RGCs may be mediated at least in part by the BDNF-induced CREB activation in retinal ischemic injury. 

It has been proven that proBDNF induces neuronal apoptosis by the activation of a receptor of p75^NTR, ^31,32 a member of the tumor necrosis factor receptor family. ³¹ Treatment with cleavage-resistant proBDNF (CR-proBDNF) elicited the apoptosis of cultured cerebellar granule neurons, whereas treatment with mBDNF promoted cell survival. ⁵⁷ p75^NTR is expressed mainly in RGCs and Müller glial cells in the mature rodent retina, ^58,59 and Harada et al. ⁶⁰ demonstrated p75^NTR-induced apoptosis during mouse retinal development. Notably, Unsain et al. ³² recently declared that status epilepticus induces a TrkB to p75^NTR switch and increases BDNF interaction with p75^NTR in an initial event in neuronal injury induction. 

Our study found that when blocking TRPC, the expression of proBDNF rather than that of mBDNF was upregulated. However, the transcription of bdnf was increased. This indicated that blocking TRPC could feed back to the pathway of BDNF-initiated protection, which may have an impact on the process of posttranslational modifications and the proteolytic processing of BDNF. Furthermore, when blocking p75^NTR signaling by TAT-Pep5, the densities of RGCs were significantly increased. This suggested that RGC death induced by blocking TRPC channels might be mediated by proBDNF-p75^NTR signaling. 

In conclusion, TRPC6 is essential for RGC survival in ischemic injury. This study increased our understanding of the mechanism of RGC neurodegeneration and might provide a new insight into a therapeutic target for the treatment of optic neuropathy. 

Footnotes

 Supported by National Natural Science Foundation of China Grant 30872831, Guangdong Natural Science Foundation Key Project 7117359, and National Basic Research Project (973 Project) 2007CB512200.

Footnotes

 Disclosure: X. Wang, None; L. Teng, None; A. Li, None; J. Ge, None; A.M. Laties, None; X. Zhang, None

The authors thank Zhiqi Xiong and Yizheng Wang (Institute of Neuroscience and Key Laboratory of Neurobiology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) for their support of the research project and for excellent advice; all experiments in this study were conducted in the laboratory of Zhiqi Xiong.