Free
Retinal Cell Biology  |   March 2011
Induction of Arginase II mRNA by Nitric Oxide Using an In Vitro Model of Gyrate Atrophy of Choroid and Retina
Author Affiliations & Notes
  • Masayuki Ohnaka
    From the Departments of Ophthalmology and
  • Emiko Okuda-Ashitaka
    Medical Chemistry, Kansai Medical University, Osaka, Japan; and
  • Shiho Kaneko
    From the Departments of Ophthalmology and
  • Akira Ando
    From the Departments of Ophthalmology and
  • Masahide Maeda
    the Department of Regeneration and Advanced Medical Science, Graduate School of Medicine, Gifu University, Gifu, Japan.
  • Kyoji Furuta
    the Department of Regeneration and Advanced Medical Science, Graduate School of Medicine, Gifu University, Gifu, Japan.
  • Masaaki Suzuki
    the Department of Regeneration and Advanced Medical Science, Graduate School of Medicine, Gifu University, Gifu, Japan.
  • Kanji Takahashi
    From the Departments of Ophthalmology and
  • Seiji Ito
    Medical Chemistry, Kansai Medical University, Osaka, Japan; and
  • Corresponding author: Seiji Ito, Department of Medical Chemistry, Kansai Medical University, 10-15 Fumizono, Moriguchi, Osaka 570-8506, Japan; ito@takii.kmu.ac.jp
Investigative Ophthalmology & Visual Science March 2011, Vol.52, 1493-1500. doi:10.1167/iovs.10-5516
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Masayuki Ohnaka, Emiko Okuda-Ashitaka, Shiho Kaneko, Akira Ando, Masahide Maeda, Kyoji Furuta, Masaaki Suzuki, Kanji Takahashi, Seiji Ito; Induction of Arginase II mRNA by Nitric Oxide Using an In Vitro Model of Gyrate Atrophy of Choroid and Retina. Invest. Ophthalmol. Vis. Sci. 2011;52(3):1493-1500. doi: 10.1167/iovs.10-5516.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: The authors previously reported ornithine cytotoxicity in ornithine-δ-aminotransferase (OAT)-deficient human retinal pigment epithelial (RPE) cells as an in vitro model of gyrate atrophy of the choroid and retina (GA). Given that RPE cells are severely damaged by arginine combined with ornithine, they investigated the role of arginine metabolism using that in vitro model.

Methods.: Human telomerase reverse transcriptase (hTERT)-RPE cells were incubated with ornithine or other agents in the presence of 5-fluoromethylornithine (5-FMO), an OAT-specific inhibitor. mRNA expression was determined by quantitative real-time polymerase chain reaction, and the concentration of nitric oxide (NO) was quantified using a Griess assay. Furthermore, cytotoxicity was examined by morphologic observations and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assays, with the effect of arginase II examined using short interfering (si) RNA for arginase II and S-(2-boronoethyl)-L-cysteine (BEC), an arginase inhibitor.

Results.: NO production in 5-FMO–treated hTERT-RPE cells was increased by ornithine, and the NO donors S-nitroso-N-acetyl-DL-penicillamine (SNAP) and S-nitrosoglutathione induced cytotoxicity. Ornithine increased the expression of arginase II mRNA in 5-FMO–treated cells. Arginase II upregulation was partially inhibited by an NO synthase inhibitor, N G-nitro-L-arginine methyl ester, which was mimicked by SNAP. Arginase II siRNA and BEC enhanced ornithine cytotoxicity, and arginase II silencing resulted in a further increase in NO production.

Conclusions.: These results demonstrate that NO is produced in our in vitro GA model, which induced cytotoxicity of RPE cells and upregulation of arginase II. NO may be involved in RPE degeneration in GA through the regulation of arginase II mRNA expression.

Gyrate atrophy of the choroid and retina (GA) is a rare autosomal recessive disease characterized by progressive chorioretinal degeneration that leads to blindness. The pathophysiology of GA is caused by a deficiency of the mitochondrial matrix enzyme ornithine-δ-amino transferase (OAT), which converts ornithine to glutamic-γ-semialdehyde. 1,2 As for biochemical abnormalities associated with this disorder, the plasma ornithine concentration in GA patients is 10- to 15-fold greater than normal, which leads to hyperornithinemia and ornithinuria. 3 Ornithine is produced entirely from arginase; thus, an arginine-restricted diet consumed by GA patients causes a progressive reduction in plasma ornithine to a normal level, along with the disappearance of ornithinuria. 4 Chronic reduction of ornithine levels in plasma with an arginine-restricted diet has been reported to slow the progression of chorioretinal degeneration in GA patients 5,6 and OAT-deficient mice. 7 The retinal pigment epithelium is a monolayer of cells situated between the neuro-retina and choroid and is the primary site of insult in GA, 2 whereas high OAT activity has been documented in retinal pigment epithelia. 8,9  
We recently established an in vitro model of GA using 5-fluoromethylornithine (5-FMO), a specific irreversible inhibitor of OAT, because inactivation of OAT in human retinal pigment epithelial (RPE) cells by 5-FMO makes them susceptible to ornithine, leading to cell death. 10 Ornithine is transported primarily by cationic amino acid transporter (CAT)-1 in the human RPE cell line hTERT-RPE, 11 whereas the gene expression of CAT-1 is induced by spermine, one of the metabolites of ornithine by ornithine decarboxylase (ODC), and exhibits ornithine cytotoxicity. 12 CAT-1 can transport arginine as well as ornithine, 13,14 and hTERT-RPE cells are more severely damaged when arginine is combined with ornithine. 15 Thus, arginine and its metabolites are thought to be involved in the cytotoxicity of RPE cells in addition to the accumulation of ornithine. 
Arginine is one of the most versatile amino acids because of its multiple metabolic pathways, and it serves as a precursor for the synthesis of protein, nitric oxide (NO), creatine, polyamines, agmatine, urea, and amino acids that are interconvertible with proline and glutamate. 16 18 NO plays important roles in many diverse processes, including vasodilation, immune responses, neurotransmission, and adhesion of platelets and leukocytes, 16 and NO synthase (NOS) catalyzes the hydrolysis of arginine to NO and citrulline. There are three isoforms of NOS, neuronal NOS (nNOS), inducible NOS (iNOS), and endothelial NOS (eNOS). Only iNOS expression is strongly regulated by various stimuli; nNOS and eNOS are expressed constitutively. RPE cells have been shown to produce NO through iNOS in response to several cytokines. 19 21 On the other hand, arginine is hydrolyzed by arginase into urea and ornithine, the latter of which can serve as a precursor of polyamine, proline, and glutamate. Two forms of arginase, known as arginase I and arginase II, are localized in the cytoplasm and mitochondria, respectively, and are encoded by different genes. 18 Although arginase I is highly expressed in the liver as a component of the urea cycle, arginase II has been found at lower levels in the kidneys, brain, small intestines, mammary glands, and macrophages, with little or no expression in the liver. Furthermore, arginase II is expressed in RPE cells colocalized with OAT, whereas arginase I is not. 22  
In the present study, we examined the role of the arginine metabolite pathway components NOS and arginase using our previously established in vitro model of GA. We found that NO was increased by ornithine in 5-FMO–treated hTERT-RPE cells and that it also induced cytotoxicity and transcriptional activation of arginase II and CAT-1 in hTERT-RPE cells. 
Materials and Methods
Cell Cultures
The human RPE cell line hTERT-RPE, 23 previously established by gene transfer of human telomerase reverse transcriptase cDNA, was kindly provided by Donald J. Zack (Wilmer Eye Institute, Johns Hopkins University, Baltimore, MD). hTERT-RPE cells were maintained in Dulbecco's modified Eagle's (DME)/Ham F-12 medium (1:1; Sigma-Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin in 5% CO2 at 37°C. The human hepatoma cell line HepG2 was maintained in DME medium (Invitrogen, Carlsbad, CA) supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin in 5% CO2 at 37°C. Porcine RPE cells were prepared from porcine eyes obtained from a local abattoir. Each eye was dissected, and the anterior segment and vitreous and neural retina were removed. The eye cups were washed with PBS(-) (pH 7.4) and incubated with 0.05% trypsin at 37°C for 5 minutes. After the incubation, the RPE cells were collected from the eye cup and were cultured in DME/Ham F-12 medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells at passages 2 to 4 were used in the experiments. 
Reverse Transcription-Polymerase Chain Reaction
Total RNA was isolated from hTERT-RPE cells (TRIzol; Invitrogen, Carlsbad, CA) and reverse transcribed into cDNA. First-strand cDNA was amplified in a buffer containing DNA polymerase (Ex Taq; Takara Bio, Ohtsu, Japan) and anti-Taq antibody (anti-Taq high; Toyobo, Osaka, Japan), with oligonucleotide primers (Table 1). RT-PCR was performed under the following conditions: 1 cycle at 94°C for 1 minute followed by 10 cycles at 94°C for 1 minute and at 72°C for 3 minutes, 15 cycles at 94°C for 1 minute and 65°C for 2 minutes and at 72°C for 30 seconds, and 20 cycles at 94°C for 1 minute and 62°C for 2 minutes and at 72°C for 30 seconds, then finally 1 cycle at 72°C for 2 minutes. mRNA expression levels were measured by quantitative real-time PCR (Opticon 2 System; Bio-Rad, Hercules, CA). Reagent (SYBR Green I; Roche Diagnostics, Mannheim, Germany) was included in the reaction mixture, and the following touchdown protocol was applied: 1 cycle at 94°C for 1 minute and 40 cycles at 94°C for 30 seconds, then at (72 − 0.3 × n)°C for 1 minute, where n is the number of cycles, and finally at 72°C for 30 seconds. mRNA amounts were normalized to the amount of GAPDH expression. 
Table 1.
 
Primer Sequences Used for RT-PCR Analysis
Table 1.
 
Primer Sequences Used for RT-PCR Analysis
Gene Primer
Arginase I 5′- GGCGGAGACCACAGTTTGGC -3′
5′- GATGGGTCCAGTCCGTCAAC -3′
Arginase II 5′- TCTGCTGATTGGCAAGAGAC -3′
5′- CTGCCAGGTTAGCTGTAGTC -3′
CAT-1 5′- TGCGCTCTTTCCGCCAGTCT -3′
5′- GGTGCTTGCCAATTCATTTT -3′
ODC 5′- GACTGTGCTAGCAAGACTGA -3′
5′- TTCTGAGCGTGGCACCGAAT -3′
iNOS 5′- TCTTGGTCAAAGCTGTGCTC -3′
5′- CATTGCCAAACGTACTGGTC -3′
eNOS 5′- GGAGATCACCGAGCTCTGCA -3′
5′- GATGTTGTAGCGGTGAGGGT -3′
nNOS 5′- GCCTTTGATGCCAAGGTGAT -3′
5′- AAAGTGAGGGTATGCTCGTGA -3′
GAPDH 5′- GAAGGTCGGAGTCAACGGAT -3′
5′- GTGAAGACGCCAGTGGACTC -3′
RNA Interference
Gene-silencing experiments were performed with double-strand short interfering (si) RNAs directed against arginase II (sense 5′-GGGGACUAACCUAUCGAGAAG-3′ and antisense 5′-UCUCGAUAGGUUAGUCCCCCG-3′) and ODC (sense 5′-AAAAGAGACCUAAACCAGAUGAGAAAG-3′ and antisense 5′-UUCUCAUCUGGUUUAGGUCUCUUUUAU-3′). A scrambled control siRNA (sense 5-AUCCGCGCGAUAGUACGUAUU-3′ and antisense 5′-UACGUACUAUCGCGCGGAUUU-3′) that had no sequence homology to any known human gene was used as the control. hTERT-RPE cells were transfected with siRNA using reagent (Lipofectamine 2000; Invitrogen) according to the manufacturer's instructions. 
Determination of Cytotoxicity
Cytotoxicity was evaluated morphologically using micrographs obtained with a digital camera (SPOT; Diagnostic Instruments, Sterling Heights, MI) through an inverted confocal microscope (IX70; Olympus, Tokyo, Japan). Cytotoxicity was quantitatively determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay, as described previously. 15  
Measurement of [14C]Ornithine Uptake
The uptake of ornithine after treatment with 0.5 mM 5-FMO and 10 mM ornithine in hTERT-RPE cells was determined using L-[U-14C]ornithine (9.25 GBq/mmol; GE Healthcare, Little Chalfont, UK), as described previously. 12  
Griess Method
NO levels were determined as the amount of nitrite (NO2 ) accumulated in culture media using Griess reagent (1% sulfanilamide, 0.1% N-(1-naphthyl)ethylenediamine dihydrochloride, 5% H3PO4). 24 Culture media were collected after the cells were treated with 5-FMO and ornithine. Protein contents in the cells were determined using an assay kit (DC Protein Assay; Bio-Rad), with bovine serum albumin as the standard. 
Statistical Analysis
For single comparison between two groups, an unpaired Student's t-test was used. Data are expressed as the mean ± SD of at least three separate experiments. Levels of P < 0.05 were considered to be statistically significant. 
Results
NO Production
It has been reported that arginine facilitates ornithine cytotoxicity in OAT-deficient hTERT-RPE cells. 15 In the present study, hTERT-RPE cells treated with arginine (10 mM) alone for 48 hours showed morphologic changes and reduced cell density (Fig. 1). Furthermore, morphologic changes and cell death were evident in cells treated with arginine and 0.5 mM 5-FMO, as they were in cells treated with 10 mM ornithine and 0.5 mM 5-FMO. In addition to the accumulation of ornithine caused by OAT deficiency, we speculated that arginine and its metabolites such as NO, in addition to ornithine, are involved in the cytotoxicity of RPE cells in GA. 
Figure 1.
 
Cytotoxicity of arginine in hTERT-RPE cells. Cells were treated with the indicated combinations of 10 mM arginine, 10 mM ornithine, and 0.5 mM 5-FMO for 48 hours. Morphologic changes were examined with an inverted confocal microscope. Scale bar, 100 μm.
Figure 1.
 
Cytotoxicity of arginine in hTERT-RPE cells. Cells were treated with the indicated combinations of 10 mM arginine, 10 mM ornithine, and 0.5 mM 5-FMO for 48 hours. Morphologic changes were examined with an inverted confocal microscope. Scale bar, 100 μm.
We also examined the production of NO in hTERT-RPE cells pretreated with both 10 mM ornithine and 0.5 mM 5-FMO (Fig. 2A). NO production, determined by nitrite levels, was linearly increased in hTERT-RPE cells in a time-dependent manner and was significantly enhanced by ornithine in 5-FMO–treated cells after 48 hours. The amount of NO production by 5-FMO and ornithine was similar to that by 1 nM IL-6 (Supplementary Fig. S1). In addition, RT-PCR analysis revealed that eNOS, but not nNOS, mRNA was expressed in hTERT-RPE cells, whereas the expression of iNOS mRNA was obviously upregulated by ornithine in 5-FMO–treated hTERT-RPE cells at 1, 6, and 24 hours after treatment (Fig. 2B). To examine the effect of NO on the cytotoxicity of hTERT-RPE cells, we used the NO donors S-nitroso-N-acetyl-DL-penicillamine (SNAP) and S-nitrosoglutathione (GSNO). MTT colorimetric assay results showed that 1 mM SNAP and GSNO increased the cytotoxicity of hTERT-RPE cells to 30.0% and 15.9%, respectively, after 24 hours (Fig. 2C). Thus, the cytotoxic effects induced by NO donors were evidently increased in a time-dependent manner. Furthermore, an NOS inhibitor, N G-nitro-L-arginine methyl ester (L-NAME, 0.5 mM), significantly suppressed cytotoxicity by 9.1% at 5 mM ornithine, 16.4% at 7 mM ornithine, and 17.9% at 10 mM ornithine (Fig. 2D). These results suggest that NO produced in our in vitro GA model is involved in the cytotoxicity of hTRET-RPE cells. 
Figure 2.
 
NO production in our in vitro GA model. (A) NO production in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. (B) Induction of iNOS, eNOS, nNOS, and GAPDH mRNA by 10 mM ornithine in hTERT-RPE cells treated with 0.5 mM 5-FMO, as shown by RT-PCR. (C) Cytotoxicity of hTERT-RPE cells caused by the NO donors SNAP and GSNO. (D) Suppression of ornithine-induced cytotoxicity in 5-FMO–treated hTERT-RPE cells by 0.5 mM L-NAME. Cytotoxicity was determined using an MTT colorimetric assay. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Figure 2.
 
NO production in our in vitro GA model. (A) NO production in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. (B) Induction of iNOS, eNOS, nNOS, and GAPDH mRNA by 10 mM ornithine in hTERT-RPE cells treated with 0.5 mM 5-FMO, as shown by RT-PCR. (C) Cytotoxicity of hTERT-RPE cells caused by the NO donors SNAP and GSNO. (D) Suppression of ornithine-induced cytotoxicity in 5-FMO–treated hTERT-RPE cells by 0.5 mM L-NAME. Cytotoxicity was determined using an MTT colorimetric assay. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Next, we determined whether NO production was also observed in freshly prepared porcine RPE cells. As shown in Figure 3, NO production was linearly increased in the cells, and it was enhanced by the treatment with ornithine and 5-FMO. Although iNOS, eNOS, and nNOS were expressed in porcine RPE cells, the expression of iNOS mRNA was slightly increased at 48 hours after treatment with ornithine and 5-FMO. 
Figure 3.
 
NO production in porcine RPE cells. (A) NO production in porcine RPE cells treated with 12.5 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. Data shown represent the mean ± SD of three separate experiments. **P < 0.01 versus untreated cells. (B) Expression of iNOS, eNOS, nNOS, and GAPDH mRNA by 12.5 mM ornithine in the cells treated with 0.5 mM 5-FMO, as shown by RT-PCR.
Figure 3.
 
NO production in porcine RPE cells. (A) NO production in porcine RPE cells treated with 12.5 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. Data shown represent the mean ± SD of three separate experiments. **P < 0.01 versus untreated cells. (B) Expression of iNOS, eNOS, nNOS, and GAPDH mRNA by 12.5 mM ornithine in the cells treated with 0.5 mM 5-FMO, as shown by RT-PCR.
Induction of Arginase II mRNA
Given that arginine is hydrolyzed to ornithine by arginase, we next examined the mRNA expression of arginase in hTERT-RPE cells using RT-PCR. Arginase II was exclusively expressed in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours, whereas both arginase I and arginase II were detected in a human hepatoma cell line HepG2 cells (Fig. 4A). Quantitative real-time PCR showed that arginase II mRNA was slightly detected before treatment with ornithine and 5-FMO and then was increased from 3 to 48 hours after treatment in a time-dependent manner to 18.3-fold greater than untreated cells (Fig. 4B). There was no effect on the expression of arginase I by treatment with 5-FMO and ornithine (data not shown). Furthermore, the expression of CAT-1 mRNA was increased from 6 to 24 hours after treatment with 5-FMO and ornithine and gradually decreased for the next 24 hours (Fig. 4B). The levels of CAT-1 mRNA at 12 and 24 hours were 16.3- and 17.3-fold, respectively, greater than untreated cells. There were also significant increases in ODC mRNA at 12, 24, and 48 hours after treatment with 5-FMO and ornithine. 
Figure 4.
 
Expression of arginase II mRNA in our in vitro GA model. Total RNA was extracted from HepG2 or hTERT-RPE cells treated with 0.5 mM 5-FMO and 10 mM ornithine for 24 hours, then analyzed by (A) RT-PCR and (B) quantitative real-time PCR. mRNA abundance is presented relative to that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Figure 4.
 
Expression of arginase II mRNA in our in vitro GA model. Total RNA was extracted from HepG2 or hTERT-RPE cells treated with 0.5 mM 5-FMO and 10 mM ornithine for 24 hours, then analyzed by (A) RT-PCR and (B) quantitative real-time PCR. mRNA abundance is presented relative to that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Upregulation of Arginase II mRNA by Ornithine
Ornithine alone at 5 and 10 mM significantly increased arginase II mRNA levels in hTERT-RPE cells after 24 hours (Fig. 5A). Furthermore, the upregulation of arginase II by ornithine was markedly enhanced in cells treated with 0.5 mM 5-FMO. We also examined the involvement of ODC in arginase II mRNA expression using an ODC inhibitor, α-difluoromethylornithine (DFMO), and ODC siRNA because ornithine is metabolized to polyamines by ODC. DFMO at 5 mM dissolved in PBS(−) enhanced the expression of arginase II evoked by treatment with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours compared with vehicle-treated cells (Fig. 5B). The transfection of ODC siRNA (30 nM) markedly reduced the expression of ODC mRNA regardless of treatment with ornithine and 5-FMO (Fig. 5C). However, the upregulation of arginase II mRNA induced by ornithine and 5-FMO was not decreased by ODC siRNA, and it was partially increased (Fig. 5D). These results suggest that the increase in arginase II mRNA was mediated by ornithine, but not by ornithine metabolites, through ODC. 
Figure 5.
 
Induction of arginase II mRNA expression by ornithine and arginine. (A) Dose dependency of ornithine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (B) Effect of an ODC inhibitor, DFMO (5 mM), on arginase II mRNA expression in hTERT-RPE cells with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (C, D) Effects of ODC siRNA (30 nM) on expression of ODC (C) and arginase II (D) mRNA. (E) Dose dependency of arginine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (F) Effect of an arginase inhibitor, BEC (20 μM), on arginase II mRNA expression in cells treated with 10 mM arginine and 0.5 mM 5-FMO. mRNA abundance is presented relative to that of the untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (C, D). Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (D). ##P < 0.01 versus DFMO-untreated cells (B) and control siRNA-transfected treated cells (D). ††P < 0.01 versus ODC siRNA-transfected untreated cells.
Figure 5.
 
Induction of arginase II mRNA expression by ornithine and arginine. (A) Dose dependency of ornithine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (B) Effect of an ODC inhibitor, DFMO (5 mM), on arginase II mRNA expression in hTERT-RPE cells with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (C, D) Effects of ODC siRNA (30 nM) on expression of ODC (C) and arginase II (D) mRNA. (E) Dose dependency of arginine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (F) Effect of an arginase inhibitor, BEC (20 μM), on arginase II mRNA expression in cells treated with 10 mM arginine and 0.5 mM 5-FMO. mRNA abundance is presented relative to that of the untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (C, D). Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (D). ##P < 0.01 versus DFMO-untreated cells (B) and control siRNA-transfected treated cells (D). ††P < 0.01 versus ODC siRNA-transfected untreated cells.
Upregulation of Arginase II mRNA by NO
Arginine (5 and 10 mM) also increased arginase II mRNA levels in hTERT-RPE cells after 24 hours (Fig. 5E), whereas treatment with 5-FMO enhanced the upregulation of arginase II by arginine. The same increased level of arginase II after treatment with 10 mM arginine and 0.5 mM 5-FMO was observed after treatment with 20 μM of S-2-boronoethyl-L-cysteine (BEC), an arginase inhibitor (Fig. 5F), suggesting that arginine itself and its metabolite NO are involved in the induction of arginase II. An NOS inhibitor, L-NAME (1 mM), partially inhibited the upregulation of arginase II mRNA expression induced by 10 mM ornithine and 0.5 mM 5-FMO (Fig. 6A). In addition, SNAP (500 μM) significantly increased the expression of arginase II mRNA by 1.8-fold greater than the control hTERT-RPE cells after 48 hours (Fig. 6B). Similarly, the induction of CAT-1 mRNA expression, but not that of ODC, was enhanced by SNAP. These results indicate that NO regulates arginase II and CAT-1 in hTERT-RPE cells in a transcriptional manner. 
Figure 6.
 
Effects of NO on arginase II mRNA expression. (A) Effect of an NOS inhibitor, L-NAME (1 mM), on arginase II mRNA expression in cells treated with 10 mM ornithine and 0.5 mM 5-FMO. (B) Induction of arginase II and CAT-1 mRNA expression by SNAP. The cells were treated with 500 μM SNAP for 48 hours. mRNA abundance is presented compared with that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. ##P < 0.01 versus the cells treated with ornithine and 5-FMO; **P < 0.01 versus untreated cells.
Figure 6.
 
Effects of NO on arginase II mRNA expression. (A) Effect of an NOS inhibitor, L-NAME (1 mM), on arginase II mRNA expression in cells treated with 10 mM ornithine and 0.5 mM 5-FMO. (B) Induction of arginase II and CAT-1 mRNA expression by SNAP. The cells were treated with 500 μM SNAP for 48 hours. mRNA abundance is presented compared with that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. ##P < 0.01 versus the cells treated with ornithine and 5-FMO; **P < 0.01 versus untreated cells.
Effect of Arginase II on hTERT-RPE Cell Viability
Because arginase I was found lacking in hTERT-RPE cells (Fig. 4A), we concluded that arginase II is preferentially directed to ornithine in mitochondria. To investigate the role of arginase II in hTERT-RPE cell viability, we used arginase II siRNA and an arginase inhibitor, BEC. Transfection of arginase II siRNA (240 nM) markedly reduced the expression of arginase II mRNA regardless of treatment with 10 mM ornithine and 0.5 mM 5-FMO (Fig. 7A). Cells transfected with the control siRNA showed shrinkage and reduced cell density after treatment with ornithine and 5-FMO, whereas cytotoxicity was enhanced by transfection of arginase II siRNA (Fig. 7B). MTT colorimetric assays for mitochondria activity revealed a significant increase of cytotoxicity in cells transfected with arginase II siRNA (control siRNA, 41.3%; arginase II siRNA, 49.0%), whereas no effect of arginase II siRNA with regard to cytotoxicity was seen in the untreated cells. Similar results for ornithine cytotoxicity were observed in cells treated with BEC at 20 μM (Fig. 7C; vehicle, 48.9%; BEC, 62.0%). These findings suggest that arginase II silencing leads to enhancement of ornithine cytotoxicity in hTERT-RPE cells. 
Figure 7.
 
Cytotoxicity caused by arginase II siRNA and its inhibitor in our in vitro GA model. (A) Effect of arginase II siRNA (240 nM) on expression of arginase II mRNA in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (B) Effect of arginase II siRNA on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours, as shown by morphologic changes and MTT colorimetric assay results. (C) Effect of an arginase inhibitor, BEC (20 μM), on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours. Data shown represent the mean ± SD of three independent experiments. ##P < 0.01 versus control siRNA (B) and without inhibitor (C). Scale bars, 100 μm.
Figure 7.
 
Cytotoxicity caused by arginase II siRNA and its inhibitor in our in vitro GA model. (A) Effect of arginase II siRNA (240 nM) on expression of arginase II mRNA in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (B) Effect of arginase II siRNA on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours, as shown by morphologic changes and MTT colorimetric assay results. (C) Effect of an arginase inhibitor, BEC (20 μM), on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours. Data shown represent the mean ± SD of three independent experiments. ##P < 0.01 versus control siRNA (B) and without inhibitor (C). Scale bars, 100 μm.
Cytotoxicity of Arginase II Silencing via NO
Recently, we reported that the upregulation of CAT-1 exhibited ornithine cytotoxicity. 12 As shown in Figure 8A, the present results showed increased upregulation of CAT-1 mRNA by treatment with 10 mM ornithine and 0.5 mM 5-FMO in both control and arginase II siRNA–transfected cells to 16.5- and 13.2-fold, respectively, after 24 hours compared with the control siRNA-transfected untreated cells. There was no significant difference in [14C]ornithine uptake between the control cells and those transfected with arginase II siRNAs (Fig. 8B). These results suggest that arginase II silencing is reduces to 20% in the induction of CAT-1 mRNA, but it has no significant effect on ornithine transport in hTERT-RPE cells. 
Figure 8.
 
Enhancement of NO production by arginase II silencing. (A, B) Effects of arginase II siRNA on CAT-1 mRNA expression (A) and [14C]ornithine uptake (B) in hTERT-RPE cells caused by treatment with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. mRNA abundance is presented relative to that of control siRNA-transfected untreated cells. (C, D) Effects of arginase II siRNA on NO production by 5-FMO and ornithine (C) and arginine (D) for 48 hours. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus control siRNA-transfected untreated cells; #P < 0.05 and ##P < 0.01 versus control siRNA-transfected treated cells; ††P < 0.01 versus arginase II siRNA-transfected untreated cells.
Figure 8.
 
Enhancement of NO production by arginase II silencing. (A, B) Effects of arginase II siRNA on CAT-1 mRNA expression (A) and [14C]ornithine uptake (B) in hTERT-RPE cells caused by treatment with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. mRNA abundance is presented relative to that of control siRNA-transfected untreated cells. (C, D) Effects of arginase II siRNA on NO production by 5-FMO and ornithine (C) and arginine (D) for 48 hours. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus control siRNA-transfected untreated cells; #P < 0.05 and ##P < 0.01 versus control siRNA-transfected treated cells; ††P < 0.01 versus arginase II siRNA-transfected untreated cells.
On the other hand, NO production induced by treatment with 10 mM ornithine and 0.5 mM 5-FMO was increased significantly in arginase II siRNA–transfected hTERT-RPE cells to 1.3-fold that of the control siRNA-transfected cells after 48 hours (Fig. 8C). Similar results with regard to NO production were observed in cells treated with 10 mM arginine (Fig. 8D). These results suggest that arginase II silencing leads to an increase of NO in hTERT-RPE cells and subsequent cell death. 
Discussion
In the present study, we found a novel mechanism related to the effects of arginine metabolic processes such as NOS and arginase on the cytotoxicity of OAT-deficient RPE cells. NO production was gradually increased by ornithine in OAT-deficient hTERT-RPE cells, and iNOS mRNA expression was transiently induced in the cells (Figs. 2A, 2B). Furthermore, arginine and NO donors evoked the cytotoxicity of RPE (Figs. 1, 2C). We also noted that the expression of arginase II mRNA was increased by ornithine and arginine in OAT-deficient hTERT-RPE cells (Figs. 4, 5), whereas NO transcriptionally upregulated arginase II and CAT-1 (Fig. 6). In addition, arginase II siRNA and an arginase inhibitor enhanced ornithine cytotoxicity (Fig. 7). Finally, arginase II siRNA enhanced NO production induced by ornithine in OAT-deficient hTERT-RPE cells (Fig. 8). 
The molecular mechanism of GA, which requires ornithine accumulation, has been described. 5 7 We previously reported that the expression of CAT-1, an ornithine transporter, was increased in our in vitro GA model, and the induction of CAT-1 was involved in ornithine cytotoxicity of RPE cells. 11,12 On the other hand, OAT-deficient hTERT-RPE cells were severely damaged by ornithine combined with arginine, 15 whereas arginine alone induced cell death in the present study (Fig. 1). In the present experiments, the production of NO, a metabolite of arginine, was detected in our in vitro GA model (Fig. 2A). In addition, iNOS induction was observed at 1 hour after treatment with ornithine and reached a maximum level after 6 hours and was decreased after 24 hours in OAT-deficient hTERT-RPE cells (Fig. 2B). hTERT-RPE cells stably expressed eNOS, and basal NO production increased linearly. The increase of NO production by ornithine in the OAT-deficient cells was due to iNOS induction. Furthermore, the NO donors SNAP and GSNO induced cell death in hTERT-RPE cells (Fig. 2C). Thus, it seems that in addition to ornithine accumulation, NO production in our in vitro GA model is involved in cytotoxicity. 
In addition to NOS, arginine is a substrate for arginase. In the present study, we detected the upregulation of arginase II mRNA in our in vitro GA model (Fig. 4). Arginase II upregulation contributes to several diseases, such as vasoregulatory systemic dysfunction, 25,26 pulmonary artery hypertension, 27 diabetic-associated erectile dysfunction, 28 and atherosclerosis. 29 Previous studies have also shown that arginase II is transcriptionally regulated by lipopolysaccharide in macrophages, 30,31 liver X receptors, which have been implicated in lipid metabolism and inflammation in macrophages, 32 interferon regulatory factor 3 (IRF3) in T lymphocytes, 33 and cAMP in Caco-2 tumor cells. 34 In the present experiments, the upregulation of arginase II in OAT-deficient hTERT-RPE cells was triggered by ornithine but not by ornithine metabolites with ODC. We found that ornithine increased arginase II expression in a dose-dependent manner (Fig. 5A), whereas DFMO and ODC siRNA did not reduce the induction of arginase II, but rather enhanced it (Figs. 5B, 5D). The enhancement of arginase II might have been due to the maintenance of ornithine concentration entailing ODC deficiency. We also noted that the maximal induction of CAT-1 preceded that of arginase II (Fig. 4B). Furthermore, the addition of 5-FMO enhanced the expression of arginase II mRNA induced by ornithine (Fig, 5A), suggesting that the accumulation of ornithine by OAT deficiency is the result of arginase II upregulation. On the other hand, the NOS inhibitor L-NAME partially inhibited the upregulation of arginase II induced by ornithine in OAT-deficient hTERT-RPE cells (Fig. 6A), suggesting that NO takes part in the induction of arginase II in addition to ornithine. This was further supported by our findings showing that arginase II upregulation was detected in cells treated with arginine (Fig. 5E), that the induction by arginine was unaffected by an arginase inhibitor BEC (Fig. 5F), and the NO donor SNAP increased the level of arginase II mRNA (Fig. 6B). Similarly, CAT-1 expression was upregulated by SNAP in hTERT-RPE cells, though CAT-1 mRNA has also been shown to be upregulated by polyamines, which are ornithine metabolites. 12 Because NO has demonstrated abilities to both upregulate and downregulate the expression of genes in mammalian cells, 35,36 another possible mechanism of NO for cytotoxicity in hTERT-RPE cells appears to be the transcriptional regulation of arginase II and CAT-1. Ornithine transiently upregulated iNOS expression after 1 hour in OAT-deficient hTERT-RPE cells (Fig. 2B), whereas the upregulation of arginase II and CAT-1 started at 3 and 6 hours, respectively, after treatment (Fig. 4B). The initial induction of iNOS may be involved in the deterioration associated with progressive cytotoxicity of RPE. There is no report showing the induction of arginase II or iNOS by treatment with ornithine, though the induction of CAT-1 by polyamine is involved in transcription factor c-myc. 12 Some transcription factors, such as liver X receptor, 32 IRF3, 33 and cAMP-response element binding protein (CREB), 34 have been suggested to induce arginase II based on the use of chemical inhibitors. The induction of iNOS expression is regulated by many transcription factors. cAMP enhances iNOS induction in some cell types, including rat RPE-J cells 20 ; therefore, CREB might be used as a common transcription factor for arginase II and iNOS induction. 
Because arginase I is lacking in hTERT-RPE cells (Fig. 4A) and RPE in vivo, 22 arginase II may preferentially direct ornithine to proline and glutamate production in mitochondria and polyamine synthesis in the cytosol. OAT was found to be deficient in our in vitro GA model; thus, we initially speculated that the suppression of arginase II would decrease the concentration of ornithine or polyamine in hTERT-RPE cells, resulting in the prevention of cell death. However, arginase II silencing by siRNA and the inhibitor for arginase, BEC, both aggravated cell death instead of preventing it after treatment with ornithine and 5-FMO (Fig. 7). Although arginase II silencing had no effect on the pathophysiological processes related to ornithine cytotoxicity, such as the induction of CAT-1 mRNA and ornithine transport (Figs. 8A, 8B), it increased NO production after treatment with ornithine and 5-FMO (Fig. 8C). In addition, arginine induced cytotoxicity (Fig. 1) and increased NO production (Fig. 8D), suggesting that the resultant increase of arginine, a substrate of arginase, by arginase II silencing is involved in cytotoxicity. Conversely, the upregulation of arginase II may have implications for NO production by RPE cells, in addition to ornithine production. Both NOS and arginase catalyze arginine, whereas arginase may reciprocally regulate NO production by competing with NOS activity for arginine. 16,37,38 Overexpression of arginase I and arginase II reduces basal NO production in endothelial cells, 39 whereas arginase II upregulated by lipopolysaccharide inhibits NO production in macrophages. 31,32 In our study, arginase II silencing by siRNA enhanced NO production induced by treatment with ornithine and 5-FMO (Fig. 8C). Thus, the upregulation of arginase II in our in vitro GA model might have decreased NO formation and protected against subsequent cell death by NO. 
We previously reported ornithine cytotoxicity, 10 transport of ornithine by CAT-1, 11,15 and upregulation of CAT-1 expression by polyamines after ODC induction 12 in experiments with our in vitro GA model. In addition to CAT-1 and ODC, we demonstrated the induction of iNOS and arginase II by ornithine in OAT-deficient hTERT-RPE cells in the present study. NO was produced by ornithine in OAT-deficient hTERT-RPE cells, which induced the upregulation of arginase II and CAT-1, and cytotoxicity. Arginase II upregulation may protect RPE cells against cytotoxicity induced by NO rather than ornithine. Our findings suggest that NO, a metabolite of arginine, as well as ornithine is involved in the molecular mechanism of GA and may provide further evidence regarding the benefits of an arginine-restricted diet for patients with GA. In addition, regulation of NO production in RPE cells may be an effective target in a novel therapy for chorioretinal degeneration in GA. 
Supplementary Materials
Figure sf1, DOC - Figure sf1, DOC 
Footnotes
 Supported by Grants-in-Aid for Scientific Research on Priority Areas and Scientific Research (S) and (C) from the Ministry of Education, Culture, Sports, and Technology of Japan and by grants from the Science Research Promotion Fund of the Japanese Private School Promotion Foundation.
Footnotes
 Disclosure: M. Ohnaka, None; E. Okuda-Ashitaka, None; S. Kaneko, None; A. Ando, None; M. Maeda, None; K. Furuta, None; M. Suzuki, None; K. Takahashi, None; S. Ito, None
References
Valle D Simell O . The hyperornithinemias. In: Scriver C Beaudet A Sly W Valle D eds. The Metabolic and Molecular Bases of Inherited Disease. 7th ed. New York: McGraw-Hill; 1995:1147–1185.
Wang T Milam AH Steel G Valle D . A mouse model of gyrate atrophy of the choroid and retina: early retinal pigment epithelium damage and progressive retinal degeneration. J Clin Invest. 1996;97:2753–2762. [CrossRef] [PubMed]
Simell O Takki K . Raised plasma-ornithine and gyrate atrophy of the choroid and retina. Lancet. 1973;1:1031–1033. [CrossRef] [PubMed]
Valle D Walser M Brusilow SW Kaiser-Kupfer M . Gyrate atrophy of the choroid and retina: amino acid metabolism and correction of hyperornithinemia with an arginine-deficient diet. J Clin Invest. 1980;65:371–378. [CrossRef] [PubMed]
Kaiser-Kupfer MI de Monasterio FM Valle D Walser M Brusilow S . Gyrate atrophy of the choroid and retina: improved visual function following reduction of plasma ornithine by diet. Science. 1980;210:1128–1131. [CrossRef] [PubMed]
Kaiser-Kupfer MI Caruso RC Valle D . Gyrate atrophy of the choroid and retina: long-term reduction of ornithine slows retinal degeneration. Arch Ophthalmol. 1991;109:1539–1548. [CrossRef] [PubMed]
Wang T Steel G Milam AH Valle D . Correction of ornithine accumulation prevents retinal degeneration in a mouse model of gyrate atrophy of the choroid and retina. Proc Natl Acad Sci USA. 2000;97:1224–1229. [CrossRef] [PubMed]
Hayasaka S Shiono T Takaku Y Mizuno K . Ornithine ketoacid aminotransferase in the bovine eye. Invest Ophthalmol Vis Sci. 1980;19:1457–1460. [PubMed]
Rao GN Cotlier E . Ornithine delta-aminotransferase activity in retina and other tissues. Neurochem Res. 1984;9:555–562. [CrossRef] [PubMed]
Ueda M Masu Y Ando A . Prevention of ornithine cytotoxicity by proline in human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 1998;39:820–827. [PubMed]
Kaneko S Ando A Okuda-Ashitaka E . Ornithine transport via cationic amino acid transporter-1 is involved in ornithine cytotoxicity in retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 2007;48:464–471. [CrossRef] [PubMed]
Kaneko S Okuda-Ashitaka E Ando A . Polyamines upregulate the mRNA expression of cationic amino acid transporter-1 in human retinal pigment epithelial cells. Am J Physiol Cell Physiol. 2007;293:C729–C737. [CrossRef] [PubMed]
Hatzoglou M Fernandez J Yaman I Closs E . Regulation of cationic amino acid transport: the story of the CAT-1 transporter. Annu Rev Nutr. 2004;24:377–399. [CrossRef] [PubMed]
Closs EI Boissel JP Habermeier A Rotmann A . Structure and function of cationic amino acid transporters (CATs). J Membr Biol. 2006;213:67–77. [CrossRef] [PubMed]
Nakauchi T Ando A Ueda-Yamada M . Prevention of ornithine cytotoxicity by nonpolar side chain amino acids in retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:5023–5028. [CrossRef] [PubMed]
Wu G Morris SMJr . Arginine metabolism: nitric oxide and beyond. Biochem J. 1998;336:1–17. [PubMed]
Morris SMJr . Arginine: beyond protein. Am J Clin Nutr. 2006;83:508S–512S. [PubMed]
Morris SMJr . Recent advances in arginine metabolism: roles and regulation of the arginases. Br J Pharmacol. 2009;157:922–930. [CrossRef] [PubMed]
Goureau O Lepoivre M Becquet F Courtois Y . Differential regulation of inducible nitric oxide synthase by fibroblast growth factors and transforming growth factor beta in bovine retinal pigmented epithelial cells: inverse correlation with cellular proliferation. Proc Natl Acad Sci USA. 1993;90:4276–4280. [CrossRef] [PubMed]
Koga T Zhang WY Gotoh T . Induction of citrulline-nitric oxide (NO) cycle enzymes and NO production in immunostimulated rat RPE-J cells. Exp Eye Res. 2003;76:15–21. [CrossRef] [PubMed]
Li R Maminishkis A Banzon T . IFNγ regulates retinal pigment epithelial fluid transport. Am J Physiol Cell Physiol. 2009;297:C1452–C1465. [CrossRef] [PubMed]
Koshiyama Y Gotoh T Miyanaka K . Expression and localization of enzymes of arginine metabolism in the rat eye. Curr Eye Res. 2000;20:313–321. [CrossRef] [PubMed]
Rambhata L Chiu CP Glickman RD Rowe-Rendeleman C . In vitro differentiation capacity of telomerase immortalized human RPE cells. Invest Ophthalmol Vis Sci. 2002;43:1622–1630. [PubMed]
Green LC Wagner DA Glogowski J . Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem. 1982;126:131–138. [CrossRef] [PubMed]
Demougeot C Prigent-Tessier A Bagnost T . Time course of vascular arginase expression and activity in spontaneously hypertensive rats. Life Sci. 2007;80:1128–1134. [CrossRef] [PubMed]
Johnson FK Johnson RA Peyton KJ Durante W . Arginase inhibition restores arteriolar endothelial function in Dahl rats with salt-induced hypertension. Am J Physiol Regul Integr Comp Physiol. 2005;288:R1057–R1062. [CrossRef] [PubMed]
Xu W Kaneko FT Zheng S . Increased arginase II and decreased NO synthesis in endothelial cells of patients with pulmonary arterial hypertension. FASEB J. 2004;18:1746–1748. [PubMed]
Bivalacqua TJ Hellstrom WJ Kadowitz PJ Champion HC . Increased expression of arginase II in human diabetic corpus cavernosum: in diabetic-associated erectile dysfunction. Biochem Biophys Res Commun. 2001;283:923–927. [CrossRef] [PubMed]
Ryoo S Gupta G Benjo A . Endothelial arginase II: a novel target for the treatment of atherosclerosis. Circ Res. 2008;102:923–932. [CrossRef] [PubMed]
Salimuddin Nagasaki A Gotoh T Isobe H Mori M . Regulation of the genes for arginase isoforms and related enzymes in mouse macrophages by lipopolysaccharide. Am J Physiol. 1999;277:E110–E117. [PubMed]
Gotoh T Mori M . Arginase II downregulates nitric oxide (NO) production and prevents NO-mediated apoptosis in murine macrophage-derived RAW 264.7 cells. J Cell Biol. 1999;144:427–434. [CrossRef] [PubMed]
Marathe C Bradley MN Hong C . The arginase II gene is an anti-inflammatory target of liver X receptor in macrophages. J Biol Chem. 2006;281:32197–32206. [CrossRef] [PubMed]
Grandvaux N Gaboriau F Harris J . Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response. FEBS Lett J. 2005;272:3120–3131. [CrossRef]
Wei LH Morris SMJr Cederbaum SD Mori M Ignarro LJ . Induction of arginase II in human Caco-2 tumor cells by cyclic AMP. Arch Biochem Biophys. 2000;374:255–260. [CrossRef] [PubMed]
Bogdan C . Nitric oxide and the regulation of gene expression. Trends Cell Biol. 2001;11:66–75. [CrossRef] [PubMed]
Pfeilschifter J Eberhardt W Beck KF . Regulation of gene expression by nitric oxide. Eur J Physiol. 2001;442:479–486. [CrossRef]
Mori M . Regulation of nitric oxide synthesis and apoptosis by arginase and arginine recycling. J Nutr. 2007;137:1616S–1620S. [PubMed]
Santhanam L Christianson DW Nyhan D Berkowitz DE . Arginase and vascular aging. J Appl Physiol. 2008;105:1632–1642. [CrossRef] [PubMed]
Li H Meininger CJ Hawker JRJr . Regulatory role of arginase I and II in nitric oxide, polyamine, and proline syntheses in endothelial cells. Am J Physiol Endocrinol Metab. 2001;280:E75–E82. [PubMed]
Figure 1.
 
Cytotoxicity of arginine in hTERT-RPE cells. Cells were treated with the indicated combinations of 10 mM arginine, 10 mM ornithine, and 0.5 mM 5-FMO for 48 hours. Morphologic changes were examined with an inverted confocal microscope. Scale bar, 100 μm.
Figure 1.
 
Cytotoxicity of arginine in hTERT-RPE cells. Cells were treated with the indicated combinations of 10 mM arginine, 10 mM ornithine, and 0.5 mM 5-FMO for 48 hours. Morphologic changes were examined with an inverted confocal microscope. Scale bar, 100 μm.
Figure 2.
 
NO production in our in vitro GA model. (A) NO production in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. (B) Induction of iNOS, eNOS, nNOS, and GAPDH mRNA by 10 mM ornithine in hTERT-RPE cells treated with 0.5 mM 5-FMO, as shown by RT-PCR. (C) Cytotoxicity of hTERT-RPE cells caused by the NO donors SNAP and GSNO. (D) Suppression of ornithine-induced cytotoxicity in 5-FMO–treated hTERT-RPE cells by 0.5 mM L-NAME. Cytotoxicity was determined using an MTT colorimetric assay. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Figure 2.
 
NO production in our in vitro GA model. (A) NO production in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. (B) Induction of iNOS, eNOS, nNOS, and GAPDH mRNA by 10 mM ornithine in hTERT-RPE cells treated with 0.5 mM 5-FMO, as shown by RT-PCR. (C) Cytotoxicity of hTERT-RPE cells caused by the NO donors SNAP and GSNO. (D) Suppression of ornithine-induced cytotoxicity in 5-FMO–treated hTERT-RPE cells by 0.5 mM L-NAME. Cytotoxicity was determined using an MTT colorimetric assay. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Figure 3.
 
NO production in porcine RPE cells. (A) NO production in porcine RPE cells treated with 12.5 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. Data shown represent the mean ± SD of three separate experiments. **P < 0.01 versus untreated cells. (B) Expression of iNOS, eNOS, nNOS, and GAPDH mRNA by 12.5 mM ornithine in the cells treated with 0.5 mM 5-FMO, as shown by RT-PCR.
Figure 3.
 
NO production in porcine RPE cells. (A) NO production in porcine RPE cells treated with 12.5 mM ornithine and 0.5 mM 5-FMO. Accumulation of nitrite in culture media was used to determine NO production. Data shown represent the mean ± SD of three separate experiments. **P < 0.01 versus untreated cells. (B) Expression of iNOS, eNOS, nNOS, and GAPDH mRNA by 12.5 mM ornithine in the cells treated with 0.5 mM 5-FMO, as shown by RT-PCR.
Figure 4.
 
Expression of arginase II mRNA in our in vitro GA model. Total RNA was extracted from HepG2 or hTERT-RPE cells treated with 0.5 mM 5-FMO and 10 mM ornithine for 24 hours, then analyzed by (A) RT-PCR and (B) quantitative real-time PCR. mRNA abundance is presented relative to that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Figure 4.
 
Expression of arginase II mRNA in our in vitro GA model. Total RNA was extracted from HepG2 or hTERT-RPE cells treated with 0.5 mM 5-FMO and 10 mM ornithine for 24 hours, then analyzed by (A) RT-PCR and (B) quantitative real-time PCR. mRNA abundance is presented relative to that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells.
Figure 5.
 
Induction of arginase II mRNA expression by ornithine and arginine. (A) Dose dependency of ornithine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (B) Effect of an ODC inhibitor, DFMO (5 mM), on arginase II mRNA expression in hTERT-RPE cells with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (C, D) Effects of ODC siRNA (30 nM) on expression of ODC (C) and arginase II (D) mRNA. (E) Dose dependency of arginine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (F) Effect of an arginase inhibitor, BEC (20 μM), on arginase II mRNA expression in cells treated with 10 mM arginine and 0.5 mM 5-FMO. mRNA abundance is presented relative to that of the untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (C, D). Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (D). ##P < 0.01 versus DFMO-untreated cells (B) and control siRNA-transfected treated cells (D). ††P < 0.01 versus ODC siRNA-transfected untreated cells.
Figure 5.
 
Induction of arginase II mRNA expression by ornithine and arginine. (A) Dose dependency of ornithine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (B) Effect of an ODC inhibitor, DFMO (5 mM), on arginase II mRNA expression in hTERT-RPE cells with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (C, D) Effects of ODC siRNA (30 nM) on expression of ODC (C) and arginase II (D) mRNA. (E) Dose dependency of arginine for arginase II mRNA expression in hTERT-RPE cells with or without 0.5 mM 5-FMO for 24 hours. (F) Effect of an arginase inhibitor, BEC (20 μM), on arginase II mRNA expression in cells treated with 10 mM arginine and 0.5 mM 5-FMO. mRNA abundance is presented relative to that of the untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (C, D). Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus untreated cells (A, B, E, F) and control siRNA-transfected untreated cells (D). ##P < 0.01 versus DFMO-untreated cells (B) and control siRNA-transfected treated cells (D). ††P < 0.01 versus ODC siRNA-transfected untreated cells.
Figure 6.
 
Effects of NO on arginase II mRNA expression. (A) Effect of an NOS inhibitor, L-NAME (1 mM), on arginase II mRNA expression in cells treated with 10 mM ornithine and 0.5 mM 5-FMO. (B) Induction of arginase II and CAT-1 mRNA expression by SNAP. The cells were treated with 500 μM SNAP for 48 hours. mRNA abundance is presented compared with that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. ##P < 0.01 versus the cells treated with ornithine and 5-FMO; **P < 0.01 versus untreated cells.
Figure 6.
 
Effects of NO on arginase II mRNA expression. (A) Effect of an NOS inhibitor, L-NAME (1 mM), on arginase II mRNA expression in cells treated with 10 mM ornithine and 0.5 mM 5-FMO. (B) Induction of arginase II and CAT-1 mRNA expression by SNAP. The cells were treated with 500 μM SNAP for 48 hours. mRNA abundance is presented compared with that of the untreated cells. Data shown represent the mean ± SD of three separate experiments. ##P < 0.01 versus the cells treated with ornithine and 5-FMO; **P < 0.01 versus untreated cells.
Figure 7.
 
Cytotoxicity caused by arginase II siRNA and its inhibitor in our in vitro GA model. (A) Effect of arginase II siRNA (240 nM) on expression of arginase II mRNA in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (B) Effect of arginase II siRNA on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours, as shown by morphologic changes and MTT colorimetric assay results. (C) Effect of an arginase inhibitor, BEC (20 μM), on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours. Data shown represent the mean ± SD of three independent experiments. ##P < 0.01 versus control siRNA (B) and without inhibitor (C). Scale bars, 100 μm.
Figure 7.
 
Cytotoxicity caused by arginase II siRNA and its inhibitor in our in vitro GA model. (A) Effect of arginase II siRNA (240 nM) on expression of arginase II mRNA in hTERT-RPE cells treated with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. (B) Effect of arginase II siRNA on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours, as shown by morphologic changes and MTT colorimetric assay results. (C) Effect of an arginase inhibitor, BEC (20 μM), on cytotoxicity caused by treatment with ornithine and 5-FMO for 48 hours. Data shown represent the mean ± SD of three independent experiments. ##P < 0.01 versus control siRNA (B) and without inhibitor (C). Scale bars, 100 μm.
Figure 8.
 
Enhancement of NO production by arginase II silencing. (A, B) Effects of arginase II siRNA on CAT-1 mRNA expression (A) and [14C]ornithine uptake (B) in hTERT-RPE cells caused by treatment with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. mRNA abundance is presented relative to that of control siRNA-transfected untreated cells. (C, D) Effects of arginase II siRNA on NO production by 5-FMO and ornithine (C) and arginine (D) for 48 hours. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus control siRNA-transfected untreated cells; #P < 0.05 and ##P < 0.01 versus control siRNA-transfected treated cells; ††P < 0.01 versus arginase II siRNA-transfected untreated cells.
Figure 8.
 
Enhancement of NO production by arginase II silencing. (A, B) Effects of arginase II siRNA on CAT-1 mRNA expression (A) and [14C]ornithine uptake (B) in hTERT-RPE cells caused by treatment with 10 mM ornithine and 0.5 mM 5-FMO for 24 hours. mRNA abundance is presented relative to that of control siRNA-transfected untreated cells. (C, D) Effects of arginase II siRNA on NO production by 5-FMO and ornithine (C) and arginine (D) for 48 hours. Data shown represent the mean ± SD of three separate experiments. *P < 0.05 and **P < 0.01 versus control siRNA-transfected untreated cells; #P < 0.05 and ##P < 0.01 versus control siRNA-transfected treated cells; ††P < 0.01 versus arginase II siRNA-transfected untreated cells.
Table 1.
 
Primer Sequences Used for RT-PCR Analysis
Table 1.
 
Primer Sequences Used for RT-PCR Analysis
Gene Primer
Arginase I 5′- GGCGGAGACCACAGTTTGGC -3′
5′- GATGGGTCCAGTCCGTCAAC -3′
Arginase II 5′- TCTGCTGATTGGCAAGAGAC -3′
5′- CTGCCAGGTTAGCTGTAGTC -3′
CAT-1 5′- TGCGCTCTTTCCGCCAGTCT -3′
5′- GGTGCTTGCCAATTCATTTT -3′
ODC 5′- GACTGTGCTAGCAAGACTGA -3′
5′- TTCTGAGCGTGGCACCGAAT -3′
iNOS 5′- TCTTGGTCAAAGCTGTGCTC -3′
5′- CATTGCCAAACGTACTGGTC -3′
eNOS 5′- GGAGATCACCGAGCTCTGCA -3′
5′- GATGTTGTAGCGGTGAGGGT -3′
nNOS 5′- GCCTTTGATGCCAAGGTGAT -3′
5′- AAAGTGAGGGTATGCTCGTGA -3′
GAPDH 5′- GAAGGTCGGAGTCAACGGAT -3′
5′- GTGAAGACGCCAGTGGACTC -3′
Figure sf1, DOC
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×