Cytokine-Dependent ELAM-1 Induction and Concomitant Intraocular Pressure Regulation in Porcine Anterior Eye Perfusion Culture

Abstract

Purpose.: To demonstrate the capacity of interleukin (IL)-1 to simultaneously lower intraocular pressure (IOP) and induce trabecular ELAM-1 expression in one experiment and to test for IL-6 accordingly and evaluate the role of transforming growth factor (TGF)-β2 as an IL-1 antagonist.

Methods.: Forty-two porcine eyes were subjected to trabecular meshwork (TM) perfusion with IL-1α, -1β, or -6 for 48 hours. Twelve of the IL-1α-treated eyes also received TGF-β2 for the final 24-hour period. Polymerase chain reaction and Western blot analyses of ELAM-1 expression were then performed on harvested TM samples. mRNA regulation of IL-1α, IL-1β, IL-6, TGF-β2, and P-selectin (SELP) was determined.

Results.: IL-1α and -1β treatment augmented outflow facility approximately threefold while inducing ELAM-1. IL-6 perfusion neither changed IOP nor induced ELAM-1. IL-1α/TGF-β2 double treatment significantly counteracted the IL-1–induced IOP decrease and markedly reduced the degree of ELAM-1 mRNA upregulation from 22.3- to 3.1-fold, and ELAM-1 protein from 1.9- to 1.2-fold. IL-1α mRNA was upregulated 5.3-, 3.3-, and 5.5-fold after perfusion with IL-1α, -1β, and -1α/TGF-β2, respectively. The respective values for IL-6 mRNA were 2.0-, 2.1- and 2.4-fold. Expression of IL-1β and TGF-β2 mRNA remained unchanged. IL-6 perfusion had no discernible regulatory effect.

Conclusions.: Simultaneous demonstration of IL-1's lowering of IOP and inducing trabecular ELAM-1 was achieved for the first time in one experiment, and its possible implications in the pathogenesis of glaucoma was further emphasized. The involvement of an autocrine feedback loop was confirmed in the porcine system. TGF-β2 constitutes a potent IL-1 antagonist for IOP and ELAM-1 regulation.

The endothelial leukocyte adhesion molecule (ELAM)-1 (also known as E-selectin, SELE, and CD62E) has long been known to be expressed by activated vascular endothelial cells. ¹ This protein mediates the first steps of inflammation by initializing leukocyte capture before diapedesis. ^1,2 ELAM-1 has been the focus of glaucoma research since 2001, when Wang et al. ³ detected the molecule on trabecular meshwork (TM) samples taken from glaucoma patients during trabeculectomy. As they demonstrated trabecular ELAM-1 expression in specimens from various kinds of glaucoma, but not in nonglaucomatous specimens, this protein has been considered a marker for the disease. ELAM-1 expression can be provoked in the aqueous humor outflow system of porcine eyes after episcleral vein cauterization and subsequent IOP elevation. ⁴ Intriguingly, trabecular ELAM-1 was shown to be inducible through interleukin (IL)-1, ³ an inflammatory cytokine that had been reported as lowering IOP in a rat model. ⁵ Later on, these findings were confirmed in a rabbit model ⁶ and by human anterior eye perfusion. ⁷ In human perfusion, IL-1α was administered to induce trabecular formation of matrix metalloproteinase (MMP)-3 (stromelysin) and MMP-9 (gelatinase B) and hence, to lower IOP. 

This line of evidence tempted scientists to speculate about the functional role of the IL-1/ELAM-1 pathway with regard to the pathogenesis of glaucoma. An IL-1/ELAM-1–associated stress response, mounted by TM cells after having been subjected to sublethal damage—perhaps in the form of ocular hypertension—has been proposed. ^3,8,9 Nevertheless, the simultaneous demonstration of ELAM-1 induction and a decrease in IOP, both being due to IL-1, has not been achieved up to the present day in the same species in one experiment. In this study, we provide essential data supporting the dual potential of IL-1 in a porcine TM cell culture and anterior eye organ culture and by use of a porcine anterior eye perfusion system. We were also interested in the effects of IL-6 in this respect, as this cytokine has been thought to constitute a potential upregulator of ELAM-1. ³ The role of TGF-β2 is a matter of extraordinary relevance in this context, as it has been shown to be significantly elevated within the aqueous humor of a large percentage of primary open-angle glaucoma (POAG) patients. ^{10 –13} Because of its well-known anti-inflammatory ^14,15 and IOP-increasing ^{16 –18} capacities, we pursued the question of whether this cytokine interferes with IL-1/ELAM-1–associated intraocular effects and to what extent it can be considered an IL-1 antagonist in IOP elevation and ELAM-1 suppression. 

Methods

Perfusion Studies

Forty-two pairs of pig eyes were subjected to anterior chamber perfusion culture. The eyes were obtained from the local abattoir and processed within 2 hours after enucleation. The preparation was performed according to a detailed description given elsewhere. ¹⁶ The anterior eye perfusion culture system that we used had already been applied successfully in human and porcine eyes ^16,18 and constitutes a modification of the one originally described by Johnson and Tschumper. ^19,20 The eyes were perfused with DMEM at a constant flow rate of 4.5 μL/min for at least 45 hours until they reached a steady state of IOP, which was constantly monitored and recorded. Then, the culture medium was changed. After exchange of medium, 12 eyes were treated with 30 ng/mL of recombinant porcine IL-1α for 48 hours, 12 eyes received recombinant porcine IL-1β (30 ng/mL, 48 hours), and 6 eyes were exposed to recombinant porcine IL-6 (30 ng/mL, 48 hours). The remaining 12 eyes were treated with IL-1α (30 ng/mL) for 24 hours, before a second medium exchange. After that, the eyes were subjected to a 24-hour simultaneous treatment with IL-1α (30 ng/mL) and TGF-β2 (10 ng/mL). The contralateral eyes served as untreated controls and received DMEM only. 

Facility Analysis

In every experimental category (IL-1α, -1β, -6, and -1α/TGF-β2), IOP data derived from treated and control eyes were analyzed and compared. The first step was the conversion of IOP data into outflow facility data. Then, the individual outflow facility curves were normalized by division of each data point by the mean value taken from the 10-hour interval just before medium exchange. After normalization, the mean facility values obtained from the 10-hour period before medium exchange and those derived from the 35- to 45-hour interval after medium exchange were pooled and averaged separately in the IL-1α, -1β, and -6 trials before comparison. As for the IL-1α/TGF-β2 trial, the pre-exchange value was compared to the value derived from the 10-hour period before the second medium exchange (representing IL-1α treatment only) and to the value calculated from the 10- to 20-hour interval after the second medium exchange (representing simultaneous IL-1α/TGF-β2 treatment). The influence of the mentioned agents on IOP within the eye was thus evaluated for the porcine system. 

Tissue Processing after Perfusion Culture

A 3- to 4-mm wide chamber angle specimen containing the TM was dissected from the nasal and temporal quadrants, respectively, and immersed in Ito's fixative ²¹ for histologic and ultrastructural investigation. The entire remainder of the TM was harvested as described elsewhere, ¹⁶ frozen in liquid nitrogen, and stored at −80°C for mRNA and protein analysis. From every experimental category, six pairs of the harvested TM tissue samples underwent mRNA analysis by semiquantitative and quantitative polymerase chain reaction (PCR). Control samples and treated samples were pooled separately, and total RNA was extracted. After cDNA synthesis, semiquantitative PCRs for ELAM-1, IL-1α, IL-1β, IL-6, TGF-β2, and P-selectin (SELP) mRNAs were performed to identify regulatory effects. In addition, quantitative real-time PCR was conducted to get more accurate insight into ELAM-1 mRNA expression levels after IL-1α and -1α/TGF-β2 perfusion culture. For the IL-1α, -1β, and -1α/TGF-β2 perfusion trials, the remaining six pairs of frozen TM specimens were thawed and subjected to ELAM-1 Western blot analysis. 

Cell Culture Experiments

The porcine TM cell explants were prepared in sterile conditions as described elsewhere for organ culture. ¹⁶ The TM specimens were transferred to a laminin-coated Petri dish and coverslipped in DMEM/F12 (Invitrogen, Karlsruhe, Germany). The coverslip, together with adhering TM cells, was transferred to a culture dish as soon as pronounced cell proliferation was discernible. The medium was changed every second day, and the cells were kept in a monolayer. Cell passage was conducted in a split ratio of 1:2 using 0.1% trypsin and 0.02% EDTA in phosphate-buffered 0.15 M NaCl (pH 7.2; Invitrogen). The cells were subjected to experiment after having reached passage 3. Three batches of TM cells were used in every experiment, each stemming from a different porcine individual. The respective control batches were derived from the same eye. 

In trial 1, the experimental batch received IL-1α (10 ng/mL in DMEM) for 48 hours. During the second half of this period, the cells were also subjected to TGF-β2 (3.3 ng/mL), resulting in a 24-hour IL-1α/TGF-β2 double treatment after 24 hours' exposure to IL-1α alone. The control batch received 24 hours of IL-1α-treatment only. The cells were then harvested and subjected to semiquantitative PCR analysis of ELAM-1 and SELP expression. Trial 2 was devised the other way around, with the experimental batch being subjected to 24 hours of IL-1α/TGF-β2 double treatment after a 24-hour exposure to TGF-β2 alone. In this case, the controls received TGF-β2 for 24 hours. At this point, expression levels of ELAM-1, IL-1α, IL-1β, IL-6, TGF-β2, and SELP mRNA were evaluated. 

Light and Electron Microscopy

After fixation, the tissue samples destined for histology and electron microscopy were rinsed several times in cacodylate buffer. After postfixation in 1% OsO₄ for 2 hours, the tissues were dehydrated in an ascending series of alcohols. Then, the specimens were embedded in Epon (Glycidether 100; Roth, Karlsruhe, Germany) via acetone and a 1:1 mixture of acetone and Epon. At first, 1-μm sagittal semithin sections were produced and stained with toluidine blue. After histologic determination of the region of interest, 50 nm ultrathin sections were cut on an ultramicrotome (Ultracut E; Reichert Jung, Vienna, Austria) and mounted on pioloform-covered slotgrids (Plano, Marburg, Germany). The ensuing contrast enhancement with 10% uranyl acetate (10 minutes) and 5% lead citrate (5 minutes) was performed in the dark. For the ultrastructural analysis of the ultrathin sections, a transmission-electron microscope (EM 109; Carl Zeiss Meditec, Oberkochen, Germany) was used. 

RNA Extraction and PCR Analysis

Phenol-chloroform extraction (TRIzol reagent; Invitrogen) of total RNA was performed, according to the manufacturer's recommendations. Structural integrity of the RNA samples was confirmed by Tris-acetate-EDTA (TAE) agarose gel electrophoresis. Yield and purity were determined photometrically. 

cDNA was synthesized with a kit (SuperScript II Reverse Transcriptase; Invitrogen) using 2.5 ng of RNA per assay. 

Semiquantitative reverse transcriptase-polymerase chain reactions (RT-PCRs) were performed with Taq-DNA polymerase (Invitrogen, Karlsruhe, Germany) and a temperature profile as follows: 30 seconds of denaturation at 94°C, annealing at primer-specific temperatures and durations (Table 1), and 60 seconds of primer extension at 72°C. Semiquantitative PCR specifications are depicted in Table 1. Subsequent electrophoresis was performed in a Tris base-boric acid-EDTA (TBE) buffer by utilization of 1% (wt/vol) TBE/agarose gels containing ethidium bromide. Ensuing semiquantitative analysis was performed by use of two computer programs (ImageJ, ver. 1.33u, developed by Wayne Rasband, National Institutes of Health, Bethesda, MD; available at http://rsb.info.nih.gov/ij/index.html; and Excel, Microsoft, Redmond, WA). Band intensity values were divided by the corresponding GAPDH values, and the resultant ratios were compared between the control and treatment samples. 

Table 1.

 

Primers and Specifications for Semiquantitative RT-PCR

Primer Name	Sequence (5′–3′)	Accession No.	Annealing Temp. (°C)	Annealing Time (s)	Cycles (n)	Product Length (bp)
por-ELAM-1-fwd	ggtacatggacatggatagg	NM_214268	60	30	40	310
por-ELAM-1rev	catcacactcaaccacttgc
por-IL-1α-fwd	gtcaggtcaatacctcatgg	NM_214029	58	30	28	266
por-IL-1α-rev	cggctgatttgaagtagtcc
por-IL-1β-fwd	gttctgcatgagctttgtgc	NM_001005149	58	30	40	257
por-IL-1β-rev	cttgagaggtgctgatgtac
por-IL-6-fwd	cctgcttgatgagaatcacc	NM_214399	58	30	26	233
por-IL-6-rev	cttcatccactcgttctgtg
por-TGF-β2-fwd	ccaatttggtgaaggcagag	L08375.1	58	45	28	459
por-TGF-β2-rev	gttgtgactcaagtccgtag
por-PAI-1-fwd	gtcaactgtacaaggagctc	Y11347	58	45	28	447
por-PAI-1-rev	ccaggatgtcgtagtaatgg
por-SELP-fwd	cagctgcaacttcagttgtg	NM_214078	58	45	32	398
por-SELP-rev	cttcatcacaggtgaagctg
por-GAPDH-fwd	cacagtcaaggctgagaatg	AF017079	58	50	28	709
por-GAPDH-rev	ggtagaagagtgagtgtcac

Quantitative (q)RT-PCR was performed for porcine ELAM-1 on a thermocycler (LightCycler1.5, using the LightCyclerRun5.32 software; Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. Primers and universal probes were selected from the Roche Probe Library (ProbeFinder program, ver. 2.45; Roche Diagnostics). ELAM-1 primer sequences were 5′-ctgagcacctgcaatgtacc-3′ for the forward primer and 5′-gctttacacgttggcttcttg-3′ for the reverse primer. Quantification was performed with integrated software (LightCycler Relative Quantification Software; ver. 1.0; Roche Diagnostics). The relative ELAM-1 mRNA expression levels were determined through division of the ELAM-1 qPCR yields by the corresponding GAPDH values (forward primer: 5′-ccccgcgatctaatgttct-3′, reverse primer: 5′-cttcaccatcgtgtctcagg-3′) derived from the same samples. For visualization of the ELAM-1 amplicons, probe 24 (ProbeFinder, cat. no. 04686985001, 5′-gggagctg-3′; Roche Diagnostics) was applied, and probe 6 (ProbeFinder, cat. no. 04685032001, 5′-ttcctctg-3′) for the GAPDH amplicons. After preincubation for 10 minutes at 95°C, amplification ensued with 50 cycles of denaturation (95°C, 15 seconds), annealing (58°C, 25 seconds), and extension (72°C, 5 seconds). The subsequent melting curve was produced with an annealing step at 53°C for 30 seconds; the final cooling was conducted at 40°C for 30 seconds. 

Protein Extraction and Western Blot Analysis

The TM tissue samples were lysed in 180 μL RIPA lysis buffer (150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 50 mM Tris [pH 8.0], 4 mM DTT, 0.5 mM Na₃VO₄, 2 mM NaF, and 2 mM phenylmethylsulfonyl fluoride (PMSF), freshly supplemented with 4 μL/mL of a protease inhibitor mix [0.5 mg/mL aprotinin, 1.25 mg/mL leupeptin, and 2.5 mg/mL pepstatin A in 50% glycerol]). After gentle homogenization, cell debris was removed by centrifugation for 5 minutes at 4°C at maximum rpm (Eppendorf, Hamburg, Germany). The supernatant was supplemented with one fourth (60 μL) 4× protein loading buffer (Roti-Load-1; art. No. K929.1; Roth), boiled for 5 minutes, and stored on ice or at −20°C. The protein content of the samples was separated in a 5% separation gel during sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) at a constant 25 mA and transferred onto a nitrocellulose membrane (Protran BA 83, 0.2 μm; Schleicher & Schüll, Dassel, Germany) by tank blot at a constant 70 V for 60 minutes in transfer buffer (10 mM CAPS [pH 11], 20% MeOH, and 0.1% SDS). The membrane was cut in two at approximately 60 kDa, and the halves were blocked in 5% (wt/vol) TBST/dry milk for 30 minutes at room temperature under constant agitation. After a short rinse in TBST (0.1% vol/vol;) Tween 20/TBS, [pH 7.4]), the upper half, containing the larger proteins, was incubated with an ELAM-1-specific primary antibody (goat anti-human E-selectin; R&D Systems, Wiesbaden, Germany) at a dilution of 1:1000 in 1.5% (wt/vol) TBST/dry milk, whereas the lower half was exposed to a primary antibody against β-actin (mouse anti-β-actin; Santa Cruz, Heidelberg, Germany), also diluted 1:1000 in 1.5% (wt/vol) TBST/dry milk. β-Actin staining was performed to assess comparability of the samples in terms of equal loading of compared probes. After overnight incubation at 4°C under constant agitation, the membranes were rinsed with TBST for 5 minutes and exposed to the respective alkaline phosphatase–conjugated secondary antibodies (rabbit anti-goat-IgG and goat anti-mouse-IgG, Sigma, St. Louis, MO) for 1 hour at room temperature, both at a dilution of 1:10,000 in 1.5% (wt/vol) TBST/dry milk. After three thorough rinses in TBST for 5 minutes each, the membranes were equilibrated in detection buffer (100 mM Tris-HCl, 100 mM NaCl [pH 9.5]) for another 5 minutes and subsequently exposed to alkaline phosphatase substrate (CDP-Star Ready-to-Use; Roche) for 5 minutes at room temperature. Chemiluminescent signals were visualized by exposure to autoradiography film (Amersham Hyperfilm ECL; GE Healthcare Ltd., Munich, Germany) and subsequently analyzed. 

Results

Morphology of Perfused Anterior Segments

Morphologic evaluation of the corneoscleral organ culture specimens showed that the TM was intact and the TM cells still in place and viable after nearly 100 hours of perfusion (data not shown). Overall, the specimens exhibited the typical appearance of porcine TM after perfusion culture when compared with previous studies. ¹⁶ There were no histologically or ultrastructurally evident alterations found after anterior eye perfusion with IL-1α, -1β, -6 or -1α/TGF-β2 when compared with the untreated contralateral control eyes (data not shown). 

Perfusion Culture Data

IL-1α Perfusion.

Porcine anterior eye perfusion with DMEM containing IL-1α (30 ng/mL) resulted in a significant increase in outflow facility (Figs. 1A, 1B). The corresponding decline in IOP was already discernible after 2 hours in all treated eyes and remained stable for the duration of the experiment (48 hours). After a short artificial IOP decrease due to medium exchange, the contralateral control eyes adapted quickly and returned to baseline level (Fig. 1A). The IOP decrease in the treated cohort, together with the corresponding facility elevation, was significant (Student's t-test: P < 0.001; n = 12) when compared with the respective pretreatment baseline levels and with the values from the contralateral control cohort after medium exchange (Fig. 1B). IOP averaged 22.0 ± 6.1 mm Hg (mean ± SD) in the experimental eyes before treatment, then declined to approximately 7.5 ± 1.5 mm Hg during IL-1α administration. This corresponded with a threefold augmentation of outflow facility (Table 2, Fig. 1B). Semiquantitative PCR disclosed the induction of ELAM-1 mRNA in the IL-1α-treated TM samples, while the control specimens did not show any detectable signal (Fig. 1C). qRT-PCR analysis yielded a 22.3 ± 3.0-fold (n = 3) upregulation of ELAM-1 mRNA in the porcine TM after IL-1α administration in perfusion culture (Fig. 1D). Semiquantitative evaluation of the respective Western blot data resulted in a 1.9 ± 0.1-fold (n = 2) upregulation of ELAM-1 on the protein level (Fig. 1E). 

Figure 1.

 

IL-1α perfusion data. (A) Facility curves illustrate that IL-1α significantly increased outflow facility. (B) Evaluation of all 12 perfused pairs of eyes yielded a mean threefold increase in outflow facility due to administration of IL-1α. (C) Semiquantitative RT-PCR evaluation of trabecular ELAM-1 mRNA induction after IL-1α perfusion of porcine TM (n = 2). (D) Quantitative real-time PCR analysis of trabecular ELAM-1 expression yielded a 22.3 ± 3.0-fold (n = 3) upregulation of ELAM-1 mRNA. (E) Western blot analysis showed a 1.9 ± 0.1-fold (n = 2) induction of ELAM-1 (***P < 0.001).

Table 2.

 

Development of IOP and Outflow Facility during Anterior Eye Perfusion

	Experimental Eye		Control Eye
	IOP (mm Hg)	Normal Facility (μL/min/mm Hg)	IOP (mm Hg)	Normal Facility (μL/min/mm Hg)
IL-1α
Before medium exchange	22.0 ± 6.1	1.0	21.0 ± 4.9	1.0
After medium exchange	7.5 ± 1.5	3.0 ± 0.9	21.5 ± 4.9	1.0 ± 0.2
IL-1β
Before medium exchange	24.3 ± 6.8	1.0	22.4 ± 6.4	1.0
After medium exchange	8.6 ± 1.7	2.8 ± 0.8	23.6 ± 7.0	1.0 ± 0.3
IL-6
Before medium exchange	21.3 ± 6.4	1.0	17.5 ± 4.4	1.0
After medium exchange	25.4 ± 6.6	0.9 ± 0.2	21.7 ± 3.2	0.8 ± 0.1
Il-1α+TGF-β2
After first medium exchange	25.4 ± 7.1	1.0	24.5 ± 6.5	1.0
After second medium exchange	9.3 ± 2.9	3.0 ± 1.3	23.0 ± 6.6	1.1 ± 0.2
	17.2 ± 3.6	1.5 ± 0.5	20.8 ± 5.1	1.2 ± 0.3

 Data are expressed as the mean ± SD.

IL-1β Perfusion.

The general pattern of IOP and outflow development before and after perfusion with IL-1β (30 ng/mL) was the same as already observed in the IL-1α trial (Fig. 2A). Again, IOP decline and outflow elevation during treatment were significant (Student's t-test: P < 0.001; n = 12) when compared with the contralateral controls after medium exchange and with the pretreatment baseline level of the treated eye (Fig. 2B). IOP data were similar to those obtained from the IL-1α experiment, with an average of 24.3 ± 6.8 mm Hg in the experimental eyes before medium exchange and 8.6 ± 1.7 mm Hg after IL-1β application (Table 2, Fig. 2B, n = 12). This went along with a 2.8-fold increase in outflow facility. Semiquantitative PCR revealed the potential of IL-1β to induce ELAM-1 mRNA in porcine TM tissue samples after organ culture (Fig. 2C; n = 2). Western blot analysis yielded a slight (1.5 ± 0.02-fold; n = 2) upregulation of ELAM-1 in the porcine TM after IL-1β perfusion (Fig. 2D). 

Figure 2.

 

IL-1β perfusion data. (A) Facility curves indicate that IL-1β significantly increased outflow facility. (B) Evaluation of all 12 perfused pairs of eyes yielded a mean 2.8-fold increase in outflow facility due to administration of IL-1β. (C) Semiquantitative RT-PCR evaluation of perfused TM specimens yielded marked induction of ELAM-1 mRNA (n = 2). (D) Western blot analysis resulted in a 1.5 ± 0.02-fold (n = 2) induction of ELAM-1 (***P < 0.001).

IL-6 Perfusion.

IL-6 (30 ng/mL) did not significantly alter the IOP within the porcine anterior chamber (Fig. 3A). The facility curves returned to baseline level after medium exchange in both treated and control eyes (Fig. 3A). Mean pretreatment IOP was 21.3 ± 6.4 mm Hg in the treated eyes and 17.5 ± 4.4 mm Hg in the untreated controls (Table 2). This difference was most likely due to the limited quantity of perfused pairs of eyes in this cohort (n = 6) and was detected after medium exchange as well. The respective average values were 25.4 ± 6.6 mm Hg in the treated eyes and 21.7 ± 3.2 mm Hg in the contralateral controls (Table 2). The outflow facility alteration after treatment averaged a calculated 0.8-fold increase, but was of no statistical significance (Student's t-test: P > 0.5; n = 6). There was no ELAM-1 mRNA expression detectable by standard PCR (Fig. 3C). 

Figure 3.

 

IL-6 perfusion data. (A, B) No significant alterations in outflow facility were recorded after perfusion with IL-6 (n = 6). (C) Semiquantitative analysis of RT-PCR data resulted in no discernible induction of trabecular ELAM-1 mRNA.

IL-1α/TGF-β2 Perfusion.

After the first medium exchange, the IL-1α-treated eyes displayed the expected and significant (Student's t-test: P < 0.001; n = 12) IOP decrease from a mean of 25.4 ± 7.1 to 9.3 ± 2.9 mm Hg (Fig. 4A, Table 2). Comparison of the data from the treated eyes with the corresponding average control IOPs after the first medium exchange (23.0 ± 6.6 mm Hg) yielded a P value of <0.001 (Student's t-test). These data showed a threefold elevation of outflow facility. After the second medium exchange, which provided the treated eyes with IL-1α (30 ng/mL) and TGF-β2 (10 ng/mL) simultaneously, this effect was markedly counteracted (Fig. 4A). The decreased IOP level of 9.3 mm Hg was significantly elevated up to a mean of 17.2 ± 3.6 mm Hg (Student's t-test: P < 0.001), with some cases nearly reaching baseline level again. This went along with a decrease in normalized outflow facility to 1.5 (Fig. 4B, Table 2). Normalized outflow facility after double treatment showed no statistically relevant difference when compared with the contralateral control eyes after the second medium exchange. Semiquantitative PCR analysis showed the IL-1α-mediated induction of ELAM-1 mRNA to be retained in the TM after combined application of IL-1α and TGF-β2 (Fig. 4C). Real-time PCR analysis of ELAM-1 mRNA in the porcine TM after IL-1α/TGF-β2 double treatment resulted in a 3.1 ± 0.9-fold (n = 2) upregulation (Fig. 4D). Semiquantitative evaluation of Western blot data yielded a 1.2 ± 0.06-fold (n = 2) induction of ELAM-1 (Fig. 4E). 

Figure 4.

 

IL-1α/TGF-β2 perfusion data. (A) Curves show that IL-1α/TGF-β2 double treatment markedly reversed the IL-1α-mediated increase in outflow facility. (B) Evaluation of all 12 perfused pairs of eyes yielded a mean 3-fold elevation of outflow facility in response to IL-1α treatment, and ensuing IL-1α/TGF-β2 double treatment reduced this value to 1.5-fold. (C) Semiquantitative RT-PCR evaluation of trabecular ELAM-1 mRNA expression yielded a marked induction after IL-1α/TGF-β2 perfusion of porcine TM (n = 2). (D) Quantitative real-time PCR analysis of perfused TM specimens resulted in 3.1 ± 0.9-fold (n = 2) upregulation of ELAM-1 mRNA after double treatment. (E) Western blot analysis of trabecular ELAM-1 expression yielded a 1.2 ± 0.06-fold (n = 2) upregulation after IL-1α/TGF-β2 double treatment **P < 0.01; ***P < 0.001).

Autocrine Feedback Loop

Semiquantitative RT-PCR screenings after porcine anterior eye perfusion revealed the potential of IL-1α and -1β to markedly augment IL-1α, IL-6, and SELP mRNA expression in the TM after an experimental period of 48 hours (Fig. 5; n = 2 for each). None of the evaluated trabecular mRNAs appeared to be regulated by administration of IL-6. Simultaneous perfusion with IL-1α and TGF-β2 yielded results comparable to those of administration of IL-1α alone, with mRNA expression levels of IL-1α, IL-6, and SELP being conspicuously elevated (Fig. 5, n = 2). 

Figure 5.

 

Semiquantitative RT-PCR data confirming the existence of an IL-1-mediated autocrine feedback loop in porcine TM after anterior eye perfusion. (A) Example PCR band images illustrating the marked upregulation of IL-1α, IL-6, and SELP mRNA due to application of IL-1α, IL-1β (30 ng/mL, 48 hours each), and IL-1α/TGF-β2 double treatment (30 ng/mL of IL-1α for 48 hours; 10 ng/mL of TGF-β2 for the final 24 hours of the experimental period). No conspicuous induction of IL-1β and TGF-β2 mRNA was recorded. (B) Corresponding factors of upregulation (mean ± SD, n = 2).

Porcine TM Cell Culture

Semiquantitative PCR analysis of the porcine TM cell culture trials yielded the following results: Application of TGF-β2 for the final 24 hours of a 48-hour period of IL-1α treatment showed ELAM-1 as well as SELP mRNA expression to be significantly downregulated, by a factor of 0.5 (Student's t-test: P < 0.01, n = 3), when compared with the IL-1α-treated (24 hours) control group (Fig. 6A). Application of IL-1α for the final 24 hours of a 48-hour period of TGF-β2 treatment showed the expected induction of ELAM-1 mRNA (Fig. 6B). When compared to the TGF-β2-treated (24-hour) control group, this cohort showed significant upregulation of IL-1α (4.2-fold), IL-1β (10.0-fold), and IL-6 (1.9-fold) mRNAs. 

Figure 6.

 

Semiquantitative RT-PCR analysis of cultured porcine TM cells. (A) Evaluation of the regulatory effect of TGF-β2 when administered in the final 24-hour interval of a 48-hour culture period of IL-1α treatment (n = 3). ELAM-1 and SELP mRNAs were significantly downregulated. (B) Evaluation of the regulatory effect of IL-1α when administered in the final 24-hour interval of a 48-hour culture period of TGF-β2 treatment (n = 3). There was conspicuous upregulation of IL-1α, -1β, and -6 mRNAs according to the IL-1α–induced autocrine feedback loop (*P < 0.05; **P < 0.01).

Discussion

IL-1 has been found to exert pressure-lowering effects in rat, ⁵ rabbit, ⁶ and human eyes, ⁷ and it has been demonstrated to induce ELAM-1 in human TM cells. ³ Even so, both effects have not been shown simultaneously in one experiment up to now. We remedied this in the present study, in which porcine anterior eye perfusion revealed IL-1α and -1β to significantly decrease IOP while upregulating ELAM-1 expression in the TM at the same time. 

IL-6 has been referred to as another possible candidate for the induction of ELAM-1. ³ Moreover, IL-6, like IL-1, constitutes an inflammatory cytokine that may well elicit extracellular matrix (ECM)–degrading enzymes, which have been shown to partially increase outflow facility. ⁷ Hence, IL-6 was applied to the described perfusion studies to determine its effects. Our data clearly demonstrate that IL-6 neither altered IOP nor induced ELAM-1. 

Trabecular ELAM-1 and IL-1α have been shown to be inducible by a variety of factors like oxidative stress, ⁸ phacoemulsification ultrasound, ⁹ or ocular hypertension. ⁴ This is in accordance with the previously hypothesized IL-1/ELAM-1-associated stress response that TM cells are believed to mount after sublethal damage. ^3,9 Wang et al. ^3,9 have already reported evidence of an autocrine feedback loop by which the putative IL-1/ELAM-1-associated rescue mechanism amplifies and sustains itself. They demonstrated exogenous IL-1 to upregulate IL-1α, -1β, and -6 mRNA expression in cultured human TM cells. ³ These findings were confirmed and partially extended by our data, as perfusion of porcine anterior eye segments with IL-1α and -1β for 48 hours led to conspicuous upregulation of IL-1α and -6 mRNA, which could not be disrupted by TGF-β2, if applied together with IL-1α. This finding was also valid for IL-1β mRNA expression, although to a much lower degree. IL-1α/TGF-β2 double treatment of cultured porcine TM cells yielded results comparable with those of IL-1α, -1β, and -6 mRNA, in that it was significantly augmented compared with that in TM cells subjected to TGF-β2 treatment alone. These findings furthermore suggest that a TGF-β2-bias, which presumably would be expected for a large number of POAG patients, ^{10 –13} does not disrupt the described autocrine feedback loops. 

Ocular hypertension, as one of the most acknowledged risk factors for the development of a glaucomatous disorder, has been attributed to factors that may also be causative of enhanced trabecular ECM deposition due to the promotion of ECM synthesis and the inhibition of degradation processes. ^{22 –25} TGF-β2 has been demonstrated to support both, while concomitantly elevating IOP, ^{16 –18} and therefore ranks high among the candidates that constitute a risk factor for the development of glaucoma. The occurrence of elevated TGF-β2 levels in the aqueous humor of a large percentage of POAG patients, ^{10 –13} together with concomitant trabecular ELAM-1 expression, which must be deduced from previous findings, ³ suggests that the proposed IL-1/ELAM-1–associated stress response ^3,8,9 acts in the TM to protect against the noxious effects of TGF-β2. 

Provided that the expression of ELAM-1 is induced by IL-1 in the TM of glaucomatous and hypertensive eyes, the IOP-lowering effect of IL-1 is obviously overwhelmed or outbalanced by TGF-β2 in many hypertensive POAG patients. Our experimental data are in full alignment with this setting, as simultaneous administration of IL-1α and TGF-β2 resulted in partial abolition of the previously elicited and IL-1α-mediated IOP decrease, whereas ELAM-1 expression was sustained. Quantitative PCR analysis of the harvested TM material, however, pointed out that the expression level of ELAM-1 mRNA is markedly reduced after double treatment. This finding was reinforced by semiquantitative PCR evaluation of cultured porcine TM cells after IL-1α/TGF-β2 double treatment, which yielded a significant decrease in ELAM-1 mRNA when compared with the IL-1α-treated controls. This set of evidence promotes the speculation, that TGF-β2 actually diminishes the IL-1α-mediated expression of ELAM-1 in the TM of a subset of POAG patients, while not being able to extinguish the signal altogether. 

As for the mechanistic manifestations involved in this antagonism, considerable evidence has been gathered with regard to trabecular ECM turnover. As described above, TGF-β2 increases ECM formation in the TM and inhibits ECM degradation, partially due to repression of MMP activation via PAI-1. ^26,27 These findings have been thought to account for IOP elevation in POAG. ^26,28,29 In this respect, the antagonistic potential of IL-1 is obvious, as it was demonstrated to lower the IOP in various animal models, after topical ocular application, ^5,6 and in human anterior eye perfusion culture. ⁷ As for the biochemical mechanisms involved, IL-1 was revealed to be a potent inductor of trabecular MMP-3 (stromelysin) and MMP-9 (gelatinase B) in human TM cell culture. ³⁰ These data offer a plausible pathway by which the IOP-lowering effects of IL-1 can be mediated. Nevertheless, our findings, together with the clinical data, indicate the capacity of TGF-β2 to overwhelm and effectively counteract this pathway, as the IL-1α–induced decreases in IOP were reversed by additional TGF-β2 perfusion of porcine anterior eyes. 

From the inflammatory point of view, TGF-β2 may not be potent enough to completely override the proinflammatory effects inherent to IL-1, although ELAM-1 and SELP—another cellular adhesion molecule expressed by vascular endothelial cells during inflammation and sharing considerable sequence homologies with ELAM-1—mRNA levels were significantly decreased in porcine TM cell culture after TGF-β2/IL-1α double treatment and trabecular ELAM-1 expression was markedly downregulated due to simultaneous TGF-β2/IL-1α perfusion. TGF-β2 was demonstrated to exert anti-inflammatory properties within the aqueous humor, which are assumed to be crucial for the maintenance of an immunologically privileged eye. ^14,15 It is therefore intriguing, that, despite all other antagonistic effects toward IL-1, TGF-β2 obviously cannot mediate a complete breakdown of the inflammatory pathway that leads to ELAM-1 expression in the TM, as coherently suggested by our experimental findings and clinical data derived from a subset of POAG patients. 

As far as the functional significance of ELAM-1 itself is concerned in this context, the situation remains unclear. Because of its acknowledged nature as an inflammation-associated cellular adhesion molecule, ELAM-1 is unlikely to play a mechanistic role in decreasing the IOP. If at all, ELAM-1 may exert its properties in tethering inflammatory cells and guiding them through the TM and out of the eye into the vasculature, as has been proposed for other cellular adhesion molecules. ³¹ But, as no evidence has been gathered to date in this respect, this matter remains speculative and open to future investigation. 

Footnotes

 Supported by Grant SFB 539 from Deutsche Forschungsgemeinschaft.

Footnotes

 Disclosure: M.T. Birke, None; K. Birke, None; E. Lütjen-Drecoll, None; U. Schlötzer-Schrehardt, None; C.M. Hammer, None

The thank Heide Wiederschein, Katja Gedova, Hong Thi Nguyen, Anke Fischer, Elke Kretzschmar, and Marco Gösswein for expert technical assistance.