The Retinal Clock Drives the Expression of Kcnv2, a Channel Essential for Visual Function and Cone Survival

Abstract

Purpose.: The gene Kcnv2 codes for the voltage-gated potassium channel subunit Kv8.2, which can coassemble with Kv2.1 subfamily members to constitute functional voltage-gated potassium channels. Mutations in the Kcnv2 gene result in a retinal disorder designated “cone dystrophy with supernormal rod response (CDSRR),” revealing that Kcnv2 is essential for visual processing and cone survival. The aim of this study was to determine whether expression of Kcnv2 and Kv2.1 is under circadian regulation and may thus contribute to the clock-driven adjustment of photoreceptor function.

Methods.: Expression of the genes was recorded in preparations of the whole retina and microdissected retinal neurons by using quantitative polymerase chain reaction and Western blot.

Results.: The transcript levels of Kcnv2 and Kv2.1 in preparations of whole retina and photoreceptor cells were found to display daily rhythms, with elevated values during the night. For Kcnv2 this rhythm was shown to evoke a corresponding rhythm in Kv8.2, the protein product of this gene. The daily changes in retinal Kcnv2 and Kv2.1 mRNA levels persisted under constant darkness and are therefore driven by the endogenous retinal clock system, which itself is entrained by light.

Conclusions.: The present data provide evidence that the transcriptional regulation of Kcnv2 and Kv2.1 is a way through which the retinal clock system drives the functional adaptation of visual function to the marked daily changes in environmental lighting conditions.

Introduction

The Kcnv2 gene encodes the voltage-gated potassium channel subunit Kv8.2. Kv8.2 itself does not form functional potassium channels, but coassembles with members of the Kv2.1 (Shab) subfamily to constitute functional channels. ¹ These underlie the neuronal delayed rectifier potassium current, which is important for limiting membrane excitability. ^2,3 Kv8.2 and Kv2.1 are coexpressed in the inner segment of rods and cones of the mouse ² and human ⁴ retina, where they are involved in the exceptional electrical response system of photoreceptor cells ⁵ and, in this way, contribute to photoreception and visual function. In particular, Kv8.2/Kv2.1 channels appear to underlie the voltage-dependent potassium current ² that is responsible for the transient over-hyperpolarization in response to rapid onset illumination. ⁶  

The functional contribution of Kv8.2 to photoreception is the reason that mutations in the Kcnv2 gene ^4,7–10 cause a retinal disorder denoted as “cone dystrophy with supernormal rod response” (CDSRR). ¹¹ CDSRR shows an autosomal recessive pattern of inheritance and is characterized by photoaversion, night blindness, reduced visual acuity, and abnormal color vision. ^12,13 Affected individuals are often myopic and have a normal peripheral retinal appearance and a range of macular abnormalities. Early diagnosis is possible due to the unique electrophysiologic characteristics. Light-adapted electroretinogram (ERG) responses are usually delayed and reduced in keeping with a generalized cone system dysfunction, whereas dark-adapted ERGs show delayed and reduced responses to dim flashes, although with increasing flash intensity there is a disproportionate enlargement of the responses. Together, the disease pattern of CDSRR suggests that Kcnv2 is essential for the survival of cones and for equalizing photoreception of rods in response to different light intensities. 

The mammalian retina has the ability to adapt to the marked daily changes in ambient illumination. ^14,15 This enables the retina to adjust its function to the environmental lighting conditions. Daily adaptation of the retina involves fundamental retinal processes including photoreception and visual processing, ¹⁵ which are manifested in daily changes in the retinal electrical responses to light, which can be measured using the ERG. ^16,17 Daily adaptation of the retina is driven by the retina's own circadian clock system, ^18–20 which consists of component clocks localized in various types of retinal cells, ^21,22 including photoreceptor cells. ^23–25 Little is known about the way in which the retinal clock system promotes the adaptation of visual function, except that clock-dependent formation of melatonin ^26–28 and dopamine ^29,30 would appear to play a role. With respect to melatonin formation, the clock system promotes a nocturnal increase in the formation of the hormone via the transcriptional activation of the gene arylalkylamine N-acetyltransferase (Aanat). ^31–34  

In the present study, the retina's own circadian clock system has been found to drive the daily rhythms in Kcnv2 and Kv2 gene expression. Considering the significance of the Kcnv2 gene for visual function, revealed by the pathology of the retinal disorder CDSRR, the clock-dependent regulation of Kcnv2 appears to present a way through which the retinal clock system promotes the daily adaptation of visual function. 

Materials and Methods

Animals

Animal experimentation was carried out in accordance with the European Communities Council Directive (86/609/EEC). Adult male and female Sprague–Dawley rats (body weight: 150–180 g) were housed under standard laboratory conditions (illumination with fluorescent strip lights, 200 lux at cage level during the day, and dim red light during the night; 20 ± 1°C; water and food accessible without restriction) under 12-hour/12-hour light/dark (LD 12:12) for 3 weeks. When indicated, the rats were then kept for one cycle under dim red light and euthanized during the next cycle. Animals were euthanized at the indicated time points by decapitation following anesthesia with carbon dioxide. All dissections during the dark phase were carried out under dim red light. The retinas and pineal glands were carefully removed. Retinas were immediately processed as described in the following text. Pineal glands and hippocampi were immediately frozen in liquid N₂. 

Retina Preparation

The HOPE technique (HOPE = Hepes-glutamic acid buffer–mediated organic solvent protection effect; DCS Innovative Diagnostik-Systeme GmbH, Hamburg, Germany) was applied for the fixation of the retinas. ^24,35 Briefly, fixation started with the incubation of fresh retinas in an aqueous protection solution HOPE I (DCS) for 48 hours at 0 to 4°C. Retinas were then dehydrated in a mixture of HOPE II solution (DCS) and acetone for 2 hours at 0 to 4°C, followed by dehydration in pure acetone for 2 hours at 0 to 4°C (repeated twice). Tissues were then embedded with low-melting-point paraffin (T_m = 52 to 54°C). Tissue sections (10 μm) from HOPE-fixed and paraffin-embedded retinas were prepared on membrane-mounted slides (DNase/RNase-free PALM Membrane Slides; P.A.L.M. MicroLaser Technologies, Bernried, Germany) and three sections placed onto each slide. The sections were deparaffinized with isopropanol (2 × 10 minutes each, at 60°C). All sections were stained with cresyl violet (1% w/v cresyl violet acetate in 100% ethanol) for 1 minute at room temperature, washed briefly in 70% and 100% ethanol, and then air-dried. 

Laser Microdissection and Pressure Catapulting

As described previously for photoreceptor cells, ²⁴ retinal cells were isolated from the stained sections in a contact- and contamination-free manner by using the laser microdissection and pressure catapulting (LMPC) technique. LMPC was performed by using a system of membrane-mounted slides (PALM MicroBeam System; Zeiss MicroImaging, Munich, Germany, with PALM RoboSoftware; P.A.L.M.). Under the ×10 objective, photoreceptor cells and ganglion cell layers (including ganglion cells and amacrine cells) were selected, cut, and catapulted into the caps of 0.5 mL microfuge tubes with an adhesive filling (PALM AdhesiveCaps; P.A.L.M.) by using a pulsed UV-A nitrogen laser. Smaller areas of the sections were pooled to reach total average sample sizes of 4 million μm² per tube. Alternatively, the whole retina was excised with a scalpel and collected in a 0.5 mL microfuge tube. Cell lysis for RNA preparation was carried out immediately after sample collection. 

RNA Extraction, Reverse Transcription (RT), and Quantitative Polymerase Chain Reaction (qPCR)

RNA was isolated and reverse transcribed as described previously (retina ²⁴ ; pineal gland and hippocampus ³⁶ ). Quantitative PCR was carried out in a total volume of 25 μL containing 12.5 μL fluorescein mix (ABsolute QPCR SYBR Green Fluorescein Mix; ABgene UK Ltd., Epsom KT19 9AP, UK), 0.75 μL of each primer (10 μM), 6 μL RNase-free water, and 5 μL sample. Primer sequences are listed in the Table. PCR amplification and quantification were performed in a real-time PCR detection system (iCycler iQ; Bio-Rad Laboratories, Munich, Germany) according to the following protocol: denaturation for 3 minutes at 95°C, followed by 40 cycles of 30 seconds at 95°C, 20 seconds at 60°C, and 20 seconds at 72°C. All amplifications were carried out in duplicate. By using agarose gel electrophoresis, the generated amplicons for all genes under examination were shown to possess the predicted sizes (Table). The amount of RNA was calculated from the measured threshold cycles (C_t) using an internal standard curve with 10-fold serial dilutions (10¹–10⁸ copies/μL). The values were normalized with respect to the amount of glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA present. 

Table. 

 

Primer Sequences

Gene	Accession Number	Primer Sequence 5′ to 3′	Length of PCR Product, bp
Aanat	U38306	Forward GAAGGGAGACAGCAGTTC	431
		Reverse GTCCTGGTCTTGCCTTTTG
Gapdh	NM017008	Forward ATGACTCTACCCACGGCAAG	89
		Reverse CTGGAAGATGGTGATGGGTT
Kcnv2	NM_00110637	Forward GGACATGCGCTTCTATGGAC	120
		Reverse ACGGAGATGAGGACGAAGAG
Kv2.1	NM_013186	Forward CGCAGAAGCTACAACGAAC	109
		Reverse ACTTGGTGTCGTCCTCATC

Immunoprecipitation and Western Blot

For immunoprecipitation of Kv8.2, three tissue samples (each obtained by pooling two retinas from two rats) were homogenized in 1 mL HEPES–sucrose buffer containing protease inhibitors. Insoluble material was pelleted. For antibody immobilization, protein A–agarose beads (30 μL bead volume; Invitrogen, Carlsbad, CA) were washed four times in phosphate buffered saline (PBS) and then incubated with goat anti-Kv8.2 polyclonal antibody (1:100, sc-168245; Santa Cruz Biotechnology, Santa Cruz, CA) at 4°C. Cell extracts corresponding to approximately 200 μg protein amounts were applied overnight to the antibody-coupled beads at 4°C. Bound proteins were recovered after extensive washes in PBS. For Western blot analysis, samples were loaded on 4–12% commercial precast polyacrylamine gels (NuPAGE Novex Bis-Tris gels; Invitrogen), separated, and blotted onto polyvinylidene difluoride membrane (Westran S; Whatman Specialty Products Inc., Sanford, ME). For immunodetection, membranes were blocked in 5% skimmed milk powder and the anti-Kv8.2 antibody (1:300) was applied overnight at 4°C. The horseradish peroxidase (HRP)–coupled secondary antibodies (donkey anti goat-HRP 1:5000; Santa Cruz Biotechnology) were visualized using an ECL detection system (GE Healthcare Amersham, Freiburg, Germany). The homogenates used for the immunoprecipitation of Kv8.2 showed a similar immunoreactivity for β-actin (anti-β-actin polyclonal antibody, 1:300; Sigma-Aldrich, St. Louis, MO) in Western blotting, illustrating that immunoprecipitation derives from equal amounts of protein. Densitometric measurement was performed using ImageJ 1.46o software (developed by Wayne Rasband, National Institutes of Health, Bethesda, MD; available at http://rsbweb.nih.gov/ij/index.html). 

Statistical Analysis

All qPCR-data are given as the mean with the SEM of four independent retina samples (each obtained by pooling two retinas from two rats) and three pineal gland samples (each obtained by pooling three pineal glands from three rats), respectively. One-way ANOVA and, based on the suggestion that Zeitgeber time (ZT)24 is equal to ZT0, cosinor analysis was used to test differences in the 24-hour profile of each transcript. Invariably, values of P < 0.05 for fluctuations in the 24-hour profiles of transcript amount were evident in both one-way ANOVA and cosinor analysis. All statistical analyses should be regarded as being explorative and P values are given descriptively, with no significance level being fixed. Statistical analysis was performed using a commercial program of advanced statistical analysis (Predictive Analytics SoftWare [PASW] Statistics, version 18.0.2; IBM, Ehningen, Germany), with the exception of cosinor analysis, which was performed using R software (version 2.11.1; provided in the public domain by R Foundation for Statistical Computing, Vienna, Austria; available at www.r-project.org/). 

Results

Daily Rhythms of Kcnv2 and Kv2.1 mRNA Levels in Preparations of Whole Retina

To investigate the daily regulation of both genes, their levels of transcript were monitored throughout the 24-hour cycle. Using qPCR, the transcript levels of Kcnv2 and Kv2.1 (Fig. 1, left column) were found to undergo daily rhythms (Kcnv2: P < 0.001 in one-way ANOVA, P < 0.01 in cosinor analysis; Kv2.1: P = 0.029 in one-way ANOVA, P < 0.01 in cosinor analysis). Kcnv2 expression peaked at ZT1.4 (cosinor analysis) and showed an amplitude of 20.7% (cosinor analysis), whereas Kv2.1 expression peaked at ZT17.0 (cosinor analysis), with an amplitude of 19.5% (cosinor analysis). 

Figure 1. 

 

Daily rhythms in the transcript amount of Kcnv2, Kv2.1, and Aanat under LD 12:12 (left column) and DD 12:12 (right column) in preparations of the whole retina. Data (determined by real-time PCR) were normalized to the amount of Gapdh transcript and presented as the percentage of the maximal value. The average number of transcripts per 1000 Gapdh transcripts in preparations of the whole retina was 2.63 for Kcnv2, 3.00 for Kv2.1, and 0.26 for Aanat. Each value represents mean ± SEM (n = 4) and the indicated P values refer to one-way ANOVA. Cosinor analysis confirms cycling of Kcnv2 (P < 0.01; acrophase: ZT1.4; mesophase: ZT7.4; amplitude: 20.7%), Kv2.1 (P < 0.01; acrophase: ZT17.0; mesophase: ZT11.0; amplitude: 19.5%), and Aanat (P < 0.01; acrophase: ZT21.4; mesophase: ZT9.4; amplitude: 38.4%) under LD 12:12 and that of Kcnv2 (P < 0.01; acrophase: CT5.3; mesophase: CT11.3; amplitude: 24.8%), Kv2.1 (P < 0.01; acrophase: CT6.2; mesophase: CT12.2; amplitude: 22.5%), and Aanat (P < 0.01; acrophase: CT23.5; mesophase: CT6.5; amplitude: 26.0%) under DD 12:12. The value of ZT0 was plotted twice at both ZT0 and ZT24. The solid bars indicate the dark period. ZT, Zeitgeber time; CT, circadian time.

Previous studies ³² have indicated that the expression of the Aanat gene, which encodes for a key enzyme in the melatonin biosynthesis pathway, is driven by the retinal clock system. To normalize the experimental system used in previous studies and to compare regulation of Kcnv2 and Kv2.1 with Aanat (as a retinal clock-driven control) in the same transcriptomes as those used for the determination of Kcnv2 and Kv2.1 mRNA, the amount of Aanat transcript was measured (Fig. 1, left column). Consistent with previous studies, the amount of Aanat transcript displayed a marked daily rhythm (P < 0.001 in one-way ANOVA, P < 0.01 in cosinor analysis), with peak expression at ZT21.4 (cosinor analysis) and an amplitude of 38.4% (cosinor analysis). 

The Amount of Kv8.2, the Gene Product of Kcnv2, Displays Daily Changes in the Retina

In the context of a putative role of Kcnv2 in the daily adaptation of retinal visual processing, the question of whether daily regulation of the Kcnv2 gene results in daily changes of the gene product Kv8.2 was addressed using immunoprecipitation and Western blotting (Fig. 2). The anti-Kv8.2 antibody recognizes a band of approximately 58 kDa, a molecular mass in the range of the 61 kDa predicted from the Kcnv2 gene. The intensity of Kv8.2 immunoreactivity displays daily changes (P = 0.01 in one-way ANOVA) with elevated values at ZT15 and ZT21. This suggests that daily changes in Kcnv2 transcript levels result in corresponding changes in Kv8.2 protein amount. 

Figure 2. 

 

Western blot analysis of Kv8.2 conducted at different ZTs (Zeitgeber times) during the 24-hour cycle. The solid bar indicates the dark period in LD 12:12. In the upper Western blot each lane was loaded with Kv8.2 immunoprecipitated from 200 μg homogenate of the retina. The polyclonal anti-Kv8.2 recognizes a band of approximately 58 kDa. In the lower Western blot the similar intensity of β-actin immunoreactivity illustrates that immunoprecipitation of Kv8.2 derives from similar amounts of protein. In the absence of anti-Kv8.2 and anti-β-actin the corresponding bands fail. The diagram shows a quantification of Kv8.2 immunoreactivity in relation to the corresponding β-actin signal. Data were obtained by densitometric measurement and represent percentages of the overall maximal value. Each value is the mean ± SEM (n = 3) and the indicated P value refers to one-way ANOVA. Note that the intensity of Kv8.2 immunoreactivity displays daily changes with stronger staining at night.

Daily Regulation of Kcnv2 and Kv2.1 mRNA Levels Is Driven by the Circadian Clock

The daily regulation of Kcnv2 and Kv2.1 may be mediated by the entrainment of the retinal clockwork. To test this hypothesis, rats adapted to LD 12:12 were kept in constant darkness (DD) for one cycle and monitored during the next cycle. Under these conditions, the 24-hour rhythm in the transcript levels of Kcnv2 and Kv2.1 (Fig. 1, right column) persisted (Kcnv2: P < 0.001 in one-way ANOVA, P < 0.01 in cosinor analysis; Kv2.1: P = 0.01 in one-way ANOVA, P < 0.01 in cosinor analysis), showing that the maintenance of the daily rhythms does not require dark/light transitions but appears to be clock-dependent. Consistent with this is the finding that Aanat transcript levels continued to cycle (P < 0.001 in one-way ANOVA, P < 0.01 in cosinor analysis) in the same transcriptomes as those used for determination of Kcnv2 and Kv2.1 mRNA (Fig. 1, right column). 

Photoreceptor Cells but Not Neurons of the Inner Retina Contribute to Daily Changes of Kcnv2 and Kv2.1 Transcript Levels in the Retina

To investigate the contribution of photoreceptor cells and inner retinal neurons (ganglion cells and amacrine cells) to daily changes in the expression of potassium channel subunits in the retina, the 24-hour course of the transcript levels of Kcnv2 and Kv2.1 (Fig. 3) were recorded in both groups of cells each collected from retina using the LMPC technique. The mRNA levels of both genes exhibited daily rhythms (Kcnv2: P < 0.001 in one-way ANOVA, P < 0.01 in cosinor analysis; Kv2.1: P = 0.001 in one-way ANOVA, P < 0.01 in cosinor analysis) in photoreceptor cells (Fig. 3, left column), which resembled those obtained from preparations of the whole retina (Fig. 1, left column). In contrast, the transcript levels of Kcnv2 (P = 0.559 in one-way ANOVA, P > 0.05 in cosinor analysis) and Kv2.1 (P = 0.952 in one-way ANOVA, P > 0.05 in cosinor analysis) failed to cycle in inner retinal neurons (Fig. 3, right column). These findings indicate that the expression of Kcnv2 and Kv2.1 in photoreceptor cells but not in ganglion cells or amacrine cells contributes to the cyclicity in the expression of the potassium channel subunits in the retina. Consistent with the current concept that Aanat expression is under daily regulation in photoreceptor cells and constitutive in the inner retina, ³⁷ the amount of Aanat transcript cycled with an amplitude of 27.6% (cosinor analysis) in photoreceptor cells (P = 0.004 in one-way ANOVA, P < 0.05 in cosinor analysis) (Fig. 3, left column), but failed to cycle in the ganglion cell layer (P = 0.225 in one-way ANOVA, P > 0.05 in cosinor analysis) (Fig. 3, right column). 

Figure 3. 

 

The transcript levels of Kcnv2, Kv2.1, and Aanat under LD 12:12 in photoreceptor cells (left column) and neurons of the inner retina (right column). Data, determined by real-time PCR, were normalized to the amount of Gapdh transcript and presented as the percentage of the maximal value. The average number of transcripts per 1000 Gapdh transcripts was 1.40 for Kcnv2, 4.09 for Kv2.1, and 0.46 for Aanat in photoreceptor cells and 0.53 for Kcnv2, 0.52 for Kv2.1, and 1.95 for Aanat in ganglion cells. Each value represents mean ± SEM (n = 4) and the indicated P values refer to one-way ANOVA. Cosinor analysis confirms cycling of Kcnv2 (P < 0.01; acrophase: ZT1.1; mesophase: ZT7.1; amplitude: 23.1%), Kv2.1 (P < 0.01; acrophase: ZT21.1; mesophase: ZT6.1; amplitude: 16.3%), and Aanat (P < 0.05; acrophase: ZT23.3; mesophase: ZT5.3; amplitude: 27.6%) in photoreceptor cells. The value of ZT0 was plotted twice, at both ZT0 and ZT24. The solid bars indicate the dark period. ZT, Zeitgeber time.

Daily Regulation of Kcnv2 mRNA Amount Is Also Evident in the Pineal Gland

To investigate the extent to which daily changes in the expression of potassium channel subunits occur outside the retina, the 24-hour courses of the transcript levels of Kcnv2 and Kv2.1 were recorded in a brain area phylogenetically related to the retina (i.e., the pineal gland) and a brain area phylogenetically unrelated to the retina (i.e., the hippocampus; Fig. 4). Consistent with the phylogenetic relationship between photoreceptor cells and pinealocytes, the mRNA level of Kcnv2 was also found to undergo a daily rhythm in the pineal gland (P = 0.003 in one-way ANOVA, P < 0.05 in cosinor analysis), with a peak value at ZT21.5 (cosinor analysis) and an amplitude of 22.9% (cosinor analysis) (Fig. 4, left column). In contrast to Kcnv2, the Kv2.1 transcript amount failed to exhibit a statistically relevant rhythm (P = 0.062 in one-way ANOVA, P > 0.05 in cosinor analysis) in the pineal gland (Fig. 4, left column). The mRNA levels of neither Kcnv2 (P = 0.270 in one-way ANOVA, P > 0.05 in cosinor analysis) nor Kv2.1 (P = 0.349 in one-way ANOVA, P > 0.05 in cosinor analysis) were found to display daily rhythms in the hippocampus (Fig. 4, right column). 

Figure 4. 

 

The transcript levels of Kcnv2, Kv2.1, and Aanat under LD 12:12 in pineal gland (left column) and hippocampus (right column). Data, determined by real-time PCR, were normalized to the amount of Gapdh transcript and presented as the percentage of the maximal value. The average number of transcripts per 1000 Gapdh transcripts is 1.57 for Kcnv2, 1.06 for Kv2.1, and 1316 for Aanat in the pineal gland and 0.48 for Kcnv2, 21.55 for Kv2.1, and 0.09 for Aanat in hippocampus. Cosinor analysis confirms cycling of Kcnv2 (P < 0.05; acrophase: ZT21.5; mesophase: ZT3.5; amplitude: 22.9%) and Aanat (P < 0.05; acrophase: ZT23.5; mesophase: ZT5.5; amplitude: 27.0%) in the pineal gland. Each value represents mean ± SEM (n = 3 in pineal gland, n = 4 in hippocampus) and the indicated P values refer to one-way ANOVA. The value of ZT0 was plotted twice at both ZT0 and ZT24. The solid bars indicate the dark period. ZT, Zeitgeber time.

The Aanat gene is a prime example of a gene whose expression is under daily/circadian regulation in the pineal gland ³² but not in the hippocampus. ³⁸ Consistent with this is the finding that the Aanat mRNA amount displayed a daily rhythm (P = 0.001 in one-way ANOVA, P < 0.05 in cosinor analysis) in the pineal gland (Fig. 4, left column) but not in the hippocampus (P = 0.467 in one-way ANOVA, P > 0.05 in cosinor analysis) (Fig. 4, right column). The daily course of pineal Aanat expression showed peak expression at ZT23.5 (cosinor analysis) and resembles that of Kcnv2, except that for Aanat the amplitude of cycling (cosinor analysis) was even higher (27.0% vs. 22.9%). 

Discussion

Kcnv2 and Kv2.1 are commonly expressed in mammalian photoreceptor cells (mouse ² ; rat: this study). Since Kcnv2 and Kv2.1 code for proteins that coassemble with each other to form functional voltage-gated potassium channels, ¹ this finding is in line with the current concept that Kv8.2/Kv2.1 channels contribute to the generation of the potassium current responsible for the dynamic signal transduction of photoreceptor cells. ² In the present study we demonstrate that the expression of Kcnv2 and Kv2.1 displays a 24-hour rhythm that appears to be specific to photoreceptor cells (rods and cones). This becomes evident from the observation that mRNA levels of both genes display daily changes in preparations of the whole retina and photoreceptor cells but not in neurons of the inner retina or hippocampus. Furthermore, our data show that Kcnv2 is abundant and under daily regulation in the pineal gland, a finding that is consistent with the phylogenetic relationship of photoreceptor cells and pinealocytes. ³⁹  

Mutations in the Kcnv2 gene underlie the retinal disorder CDSRR, which is associated with altered ERG responses of cones and rods. ^4,7,8,40 Although the mechanisms of dysfunction that link Kcnv2 mutations with the clinical picture of CDSRR are largely unknown, it is thought that mutations of the Kcnv2 gene may prohibit the formation of any voltage-gated potassium channels or result in pure homomeric Kv2.1 channels that lack the functional tuning of the Kv8.2 subunit for proper native function in photoreceptor cells. ^4,9 However, the phenotype of CDSRR indicates an essential role of the Kcnv2 gene in photoreception and visual function. Therefore, the presently seen daily regulation of the Kcnv2 gene appears to promote 24-hour variations in visual function and thus to contribute to the known daily changes of visual function seen in ERG. ^16,17  

The pathology of CDSRR reveals that Kcnv2 is also essential for the survival of cones. ¹¹ Although the way in which mutations of the Kcnv2 gene induce cone dystrophy is still unknown, the putative function of Kv8.2 in photoreceptors suggests that cone dystrophy in CDSRR may somehow be related to disturbed visual processing. Considering the putative role of Kcnv2 in photoreceptor adaptation, this implies the possibility that cone dystrophy in CDSRR is due to a disturbed adjustment of visual function to changes in the lighting conditions. However, the observation that in mice lacking Bmal1, a gene essential for clock function, photoreceptor cells appeared structurally normal ²⁰ speaks against this hypothesis. 

Depending on the gene, daily regulation of retinal gene expression is directly illumination-dependent or driven by a circadian clock, which itself is entrained by light. ¹⁵ In the present study, the daily cyclicity in Kcnv2 and Kv2.1 expression was found not to require dark/light transitions and thus appears to be under the control of a circadian clock. The clock responsible for the circadian regulation of gene expression in photoreceptor cells and other retinal neurons seems to be localized in the retina itself, whereas the master clock in the suprachiasmatic nucleus (SCN) plays no or only a marginal role in this matter. ^14,23,26 This suggests that the circadian regulation of Kcnv2 and Kv2.1 is also driven by the retina's own clock system. 

Circadian regulation of voltage-gated potassium channels is thought to couple molecular clocks to pacemaker neuron excitability. ⁴¹ This allows the molecular clock to influence synaptic output and ultimately rhythmic behavior. Until now, the circadian regulation of voltage-gated potassium channels has been found in pacemaker neurons of invertebrate retina ^42–44 and vertebrate SCN. ⁴¹ The present study extends previous knowledge by showing that the circadian regulation of voltage-gated potassium channels also occurs in the retina of vertebrates/mammals. Accordingly, the clock-dependent control of retinal neuron excitability and synaptic output appears to be of functional significance not only in invertebrates but also in vertebrates/mammals. Since circadian regulation of voltage-gated potassium channels appears to represent a characteristic of pacemaker neurons, the abundance of this phenomenon in the SCN ⁴¹ and retina (this study) is consistent with the presence of self-cycling clock systems in exactly these tissues. 

In conclusion, the results of the present study suggest that the transcriptional control of the Kcnv2 gene appears to represent a way through which the retinal clock system promotes the daily adaptation of visual function and, possibly, the survival of cones. Therefore, mutation of the Kcnv2 gene may result in a disturbance, not only of visual processing itself, but also of adaptation of visual processing to the sustained 24-hour changes in ambient illumination. Further clinical studies are necessary to explore whether disturbed adaptation may contribute to the pathology of CDSRR. 

Acknowledgments

The authors thank Ute Frederiksen, Kristina Schäfer, Ursula Göringer-Struwe, and Ilse von Graevenitz for their excellent technical assistance and Veronika Weyer for statistical analysis. The data contained in this study are included in the theses of Philip Hölter and Stefanie Kunst as a partial fulfillment of their doctorate degrees at the Johannes Gutenberg University, Mainz. 

Footnotes

 Supported in part by grants from the Naturwissenschaftlich-Medizinischen Forschungszentrum of the University of Mainz.

Footnotes

 Disclosure: P. Hölter, None; S. Kunst, None; T. Wolloscheck, None; D.K. Kelleher, None; C. Sticht, None; U. Wolfrum, None; R. Spessert, None