PAX6 Mutations Identified in 4 of 35 Families with Microcornea

Abstract

Purpose.: Mutations in paired box gene 6 (PAX6) are the major cause of aniridia that may associate with several other developmental anomalies of the eye, including microcornea in rare cases. However, systemic evaluation of PAX6 in patients with microcornea as the major sign has not been reported. This study aims to detect PAX6 mutations in patients with microcornea.

Methods.: Genomic DNA of probands was prepared from 35 families with microcornea. The coding regions of PAX6 were screened by Sanger sequencing and novel variations were further evaluated in 192 normal individuals. Bioinformatics analysis was used to evaluate the structural consequences related to the pathology of the mutations.

Results.: The average corneal horizontal diameter of the 35 probands is 8.03 ± 1.27 mm (the median value is 8 mm). Among them, eight patients presented with normal iris, one had aniridia, and different severities of iris hypoplasia were detected in the rest. In four probands, three heterozygous variations in PAX6 were identified: a novel c.83_85delAGA (p.Lys28del) in two families; a novel c.337G>C (p.Ala113Pro) in one family; and a known c.399_399+5del6 in one family. None of the variations were detected in 192 normal individuals. Two of the four probands had partial iris while the other two presented with full iris.

Conclusions.: We identified two novel and a known mutation of PAX6 in four probands with microcornea, accounting for 11.4% of microcorneas in this cohort. The findings not only expand the spectrum of PAX6 mutations, but also suggest that PAX6 mutations may be a common cause of microcornea.

Introduction

Microcornea, a rare congenital cornea dysgenesis with the prevalence of 0.001%, ¹ implies a corneal diameter of less than or equal to 10 mm in horizontal diameter. ² The normal cornea size of a newborn is approximately 10 mm in horizontal diameter, and it will reach a mature size measuring 12 mm by 2 years of age. ³ Microcornea can happen either unilaterally or bilaterally, and is thought to occur secondary to an arrest in corneal growth after the fifth month of fetal development when differentiation is complete. ² Another hypothesis attributes the condition to an overgrowth of the anterior edges of the optic cup, thereby leaving less space for the cornea. ⁴ The microcornea mainly occurred in autosomal dominant or recessive traits with rare sporadic cases, and the eye may be otherwise normal; but the condition is often accompanied with other ocular dysgenesis, such as cataract, coloboma, and anterior microphthalmos. ^{5– 7} Genes or loci were identified in some eye syndromes associated with microcornea, such as gap junction protein, alpha 8 (MIM 600897) in cataract-microcornea, ⁸ bestrophin 1 (MIM 607854) in vitreoretinochoroidopathy, ⁹ and macrophthalmia, colobomatous, with microcornea (MIM 602499) in colobomatous macrophthalmia with microcornea syndrome. ¹⁰ However, systemic evaluation of genes in patients with microcornea as the major sign has not been reported. 

Paired box gene 6 (PAX6 [MIM 607108]) is a member of the paired box family and encodes a transcriptional regulator playing a key role in development processes including ocular genesis. This gene is located in 11p13 and consists of 11 coding exons and an extra exon named 5a, which is involved in alternative splicing. The mutations in PAX6 are the major case for aniridia and account for the other eye malformations, including cataract with late-onset corneal dystrophy, coloboma of optic nerve, ocular coloboma, foveal hypoplasia, Gillespie syndrome, keratitis, morning glory disc anomaly, optic nerve hypoplasia, and Peters' anomaly. The total number of unique DNA variations found in PAX6, published by the Leiden Open Variation Database (LOVD, http://pax6.hgu.mrc.ac.uk/, provided in the public domain by the Leiden University Medical Center, Leiden, The Netherlands), is 335. In two papers, mutations of PAX6 were separately identified in one patient with aniridia and one family with ocular dysgenesis accompanied by microcornea. ^11,12 In our previous study, we also detected a PAX6 mutation in an isolated family with microphthalmia, aniridia, and microcornea. ¹³ Furthermore, microcornea phenotype was observed in transgenic mouse overexpressing PAX6 (PAX77), which supports requirement of precise dosage of PAX6 in the corneal growth and development. ¹⁴ However, there were also some reports that excluded PAX6 as the causative gene for microcornea in pedigrees. ¹⁵ Considering the critical role of PAX6 in ocular development and the possible affect of mutations of PAX6 on normal corneal growth, the relationship between PAX6 and microcornea needs further studies in a larger cohort. 

In this study, we screened the coding sequences of PAX6 among 35 Chinese patients with microcornea. Most of them had normal iris or mild iris dysgenesis. Two novel and one reported heterozygous mutations were identified in four patients (4/35, 11.4%). Contrary to aniridia, two of them had full iris and the rest had partial iris. 

Materials and Methods

Patients and Clinical Data

The study was approved by the Institutional Review Board of Zhongshan Ophthalmic Center, Guangzhou, China. Patients with microcornea (the corneal horizontal diameter of the worse eye ≤10.0 mm) were selected from our Hereditary Eye Disease Genomic DNA Repository according to the retrospective review of the clinical record of each patient. Written informed consent that complied with the tenets of the Declaration of Helsinki was obtained from every patient before they were enrolled into the repository. Patients with Peters' anomaly were ruled out. Besides the parameters of the cornea, the morphology of the eyes was also carefully documented, including the degree of iris absence, transparent of lens, funduscopy, axial length, and orthoptic examination. 

Mutations Detection

Referring to previous studies, ^16,17 10 pairs of primers were used (Table 1) to amplify the 11 coding exons (exon 4 to exon 14 of PAX6) and adjacent intronic sequence of PAX6 (NCBI human genome build 37.3, NG_008679.1 for gNDA, NM_001604.5 for mRNA, CCDS31452.1 for cDNA, and NP_001595.2 for protein of PAX6). The PCR products were sequenced with a cycle sequencing kit (BigDye Terminator v3.1; Applied Biosystem, Foster City, CA) by a 3130 XL sequencer according to the manufacturer's recommendations. The sequencing results were aligned with consensus sequences (NG_008679.1) to identify variations with a sequencing program (Lasergene SeqMan II; DNAStar, Inc., Madison, WI). Variations were named according to the nomenclature recommended by the Human Genomic Variation Society (HGVS). Novel variations were further evaluated in 192 normal control individuals through sequencing. Cosegregation analysis was carried out in available family members. The possible effects of variations were predicted by Polymorphism Phenotyping (PolyPhen-2, http://genetics.bwh.harvard.edu/pph2/, provided in the public domain by the Harvard Medical School, Boston, MA) ¹⁸ and Sorting Intolerant Form Tolerant (SIFT, http://sift.jcvi.org/ provided in the public domain by the J. Craig Venter Institute, CA) ¹⁹ at the protein level. 

Table 1. 

 

Primers Used for Amplification and Sequencing of PAX6

Primer Name	Primer Sequence (5′-3′)	Annealing Temperature (°C)	Product Length (bp)
PAX6-EX1F	TGATGCAGCTGCCCGAGGATTA	68	411
PAX6-EX1R	GGGGCGAGAGGGGGTGTGAGTTA
PAX6-EX2F	TTCCCCTTCCTCCTCTCCTTTCT	66	360
PAX6-EX2R	GGGGGTCCATAATTAGCATCGTT
PAX6-EX3F	GCAAGGTCAGCACAAAAATAAAT	67	432
PAX6-EX3R	TGCCCTGGGTCTGATGGA
PAX6-EX4F	TGCAGATGCAAAAGTCCAAG	65	486
PAX6-EX4R	CCCCAGGTACAAAGGAGACA
PAX6-EX5F	TTCCATGCCCAAAGTGATAG	60	548
PAX6-EX5R	TTCCCAGGCCAACAAAAT
PAX6-EX6F	AAAATGGTGGTCAGGTAACTAAC	62	496
PAX6-EX6R	TGAAAAGATGCCCAGAGAAATAA
PAX6-EX7F	TTGGTTGGAGGTAATGGGAGTG	66	420
PAX6-EX7R	GGAAATCAGGTGGGACAGGTTAG
PAX6-EX8-9F	GGCTCGACGTAGACACAGT	67	501
PAX6-EX8-9R	TGCAGACACAGCCAATGAGG
PAX6-EX10F	GACTAGCTCGAGGCCCAATCTTA	68	464
PAX6-EX10R	TTCCCTTTTCAATCCCCATCC
PAX6-EX11F	CATGTCTGTTTCTCAAAGGG	65	202
PAX6-EX11R	CCATAGTCACTGACTGAATTAACAC

Results

Thirty-five unrelated patients were enrolled in this study, consisting of 13 females and 22 males. The eye anomaly was noticed at birth and was nonprogressive. Unilateral corneal dysgenesis occurred in 10 patients and the bilateral form occurred in 25 patients. The corneal horizontal diameter of the worse eye ranged from 5 to 10 mm with an average of 8.03 ± 1.37 mm (the median value was 8 mm). Eight patients presented with normal iris, one had aniridia, and different severities of iris hyperplasia were detected in the rest. Besides microcornea, a range of developmental ocular anomalies like corneal dystrophy, congenital cataract, coloboma, foveal hypoplasia, and posterior staphyloma were observed by ophthalmic examinations. 

Three kinds of heterozygous PAX6 mutations (missense, deletion, and splice site change) were identified in four microcornea patients with full or partial iris (Table 2, Fig. 1), including two novel mutations, c.83_85delAGA (p.Lys28del) in the proband 71158 as well as 71987 (III:2), and c.337G >C (p.Ala113Pro) in proband 71438, and a reported mutation c.399_399+5del6 (p.Lys134Ser_fsX12) in proband 71952. None of the variations was detected in 192 normal individuals. All three mutations were located in the paired box domain of PAX6. The c.83_85delAGA mutation was predicted to result in the deletion of codon 28 Lysine, which is in the first α-helix of the N-terminal paired domain. The substitution mutation, c.337G>C, would replace the Alanine with Proline at codon 113. The amino acid change was probably damaging as analyzed by PolyPhen-2 and SIFT. Both of the codons affected by mutations were conserved for PAX6 according to ortholog alignment by UCSC. The mutation c.399_399+5del6 was predicted to alter the strength of a splicing donor (from 0.99–0) and therefore abolish a natural splicing site, resulting in a premature stop at amino acid position 206 within exon 7 (http://www.fruitfly.org/seq_tools-splice.html provided in the public domain by the Berkeley Drosophila Genome Project, Berkeley, CA). The same mutation was first reported in a two-generation aniridia German family. ²⁰  

Figure 1. 

 

Mutations in PAX6 identified in four unrelated families with microcornea. (A) Pedigrees of the four families were shown. Mutations were marked to correspond with the available members in the families. The −/− indicated wild type. (B) Sequence chromatographies of the three mutations identified in this study. The exact mutations were indicated by the black arrow and were named according to the nomenclature recommended by the HGVS.

Table 2. 

 

Summary of Phenotypes in Patients with PAX6 Mutations

ID	Mutation	Exon (Domain)	Protein Change	Sex	Age (y)		Visual Acuity
					Exam	Onset	OD	OS
71158	c.83_85delAGA	Ex5 (PD)	p.Lys28del	F	3	At birth	PL	PL
71987 III:2	c.83_85delAGA	Ex5 (PD)	p.Lys28del	M	2	At birth	PL	PL
71987 III:3	c.83_85delAGA	Ex5 (PD)	p.Lys28del	M	3	No	NA	NA
71438	c.337G>C	Ex6 (PD)	p.Ala113Pro	F	19	At birth	0	0.06
71952	c.399_399+5del6	Ex7 (PD)	Splice site change	F	23	At birth	0.1	0.1

 PL, Pursuit light; NA, not available; PTS, ptosis; SBM, strabismus; NYS, nystagmus.

The clinical examination details of the four probands carrying PAX6 mutations are summarized in Table 2. All the probands had microcornea family history. Microcornea and nystagmus were observed in all probands. The mutation c.83_85delAGA was detected in two probands, 71158 and 71987III:2. Besides microcornea (8 mm in both eyes), ptosis, partial iris, and mild optic nerve hypoplasia were also observed in 71158 at 3 years old. Her ERG was normal. In the family 71987, three members (II:2, III:2, and III:3) were available. The proband (III:2) and his affected dizygotic twin (III:3) harbored PAX6 mutation c.83_85delAGA, while the unaffected mother (II:2) did not carry the mutation (Fig. 1A). The cornea horizontal diameter was 9 mm in both eyes of the proband (III:2) but it was 11 mm in both eyes of his dizygotic twin (III:3). In addition, full iris with mild structure abnormality involved contraction furrow and crypt was recorded in the twin brothers but the severity was different between them. Minimal nasally displaced pupil and nystagmus were exclusively observed in the proband (Figs. 2A–D). Bilateral foveal hypoplasia was observed in both of them (Figs. 2E, 2F). The mother of 71987III:2 did not carry the same mutation and her ocular examinations yielded normal findings. The father of 71987III:2 was said to have “small eyes” similar to the proband, but examination and blood sample were not available from him. Segregation of the mutation with ocular abnormality was achieved in the family 71987. Harboring a missense mutation c.337G>C (p.Ala113Pro), the proband 71438 had unilateral keratopathy and the detail of the inner structure behind the cornea was not available in the right eye. Full iris with abnormal structure, small optic disc, partial coloboma of choroid, and posterior staphyloma were detected in the left eye. The patient 71952 had a PAX6 mutation c.399_399+5del affecting the splice site. In addition to partial iris, posterior lamellar lens opacity was observed in both her eyes (Figs. 2G, 2H). B-scan did not reveal obvious abnormalities in the vitreous or retina (Fig. 2I). 

Figure 2. 

 

The clinical examination details of microcornea patients with PAX6 mutations. (A) The corneal diameter of 71987 (III:2) was 9 mm. (B) The corneal diameter of 71987 (III:3) was 11 mm. (C) Full iris with mild structure abnormality was seen in 71987 (III:2) as well as minimal nasally displaced pupil. (D) Similar iris dysgenesis but more subtle could be seen in 71987 (III:3). (E, F) Both 71987 III:2 and III:3 had foveal hypoplasia. (G–I) Partial iris and posterior lamellar opacity of lens were observed in 71952.

Discussion

Microcornea is a common eye dysgenesis that can occur independently or accompany other ocular abnormalities. The genetic reasons for microcornea are not well clarified yet. PAX6 plays a key role in ocular development and PAX6/heterozygotes suffering from keratopathy and corneal dystrophy were noticed in many patients with aniridia. ²¹ Animal model studies revealed the aberrant PAX6 gene dosage effects on mouse corneal pathophysiology and corneal epithelial homeostasis. ^22,23 As a common cornea dysgenesis, however, microcornea was only mentioned in limited sporadic aniridia cases with PAX6 mutations. ^11–13 In this study, we set out to evaluate PAX6 in 35 unrelated probands with microcornea by direct sequencing to reveal the relationship between PAX6 defects and microcornea in a cohort of 35 patients. Of the patients, four probands harbored three heterozygous mutations, including: two novel mutations c.83_85delAGA (p.Lys28del) and c.337G>C (p.Ala113Pro), as well as a known c.399_399+5del6, which accounted for 11.4% of patients with microcornea in this cohort. 

PAX6 is a member of the class of paired-like protein producing genes family involved in oculogenesis and other developmental processes. On chromosome 11p13, PAX6 occupies 14 exons in a 22-kb genomic region and encodes a 422 amino acid transcriptional regulator that recognizes target genes through its two paired-type DNA-binding domains: a bipartite paired box domain (PD) of 128 amino acids and a homeodomain (HD) of 60 amino acids. The PD is composed of two helix-trun-helix motifs, N-terminal subdomain of paired domain (PAI) and C-terminal subdomain of paired domain (RED). ²⁴ The transcriptional activation domain is at the C-terminal. Most PAX6 mutations introduce a premature termination codon (i.e., nonsense mutations, frameshift insertions and deletions, and most splice mutations) on one allele and result in the aniridia phenotype caused by a haploinsufficiency of PAX6. Approximately 22.6% PAX6 mutations are missense resulting in distinctive phenotypes caused by the dominant-negative effect, and only 2% of them related to aniridia. ²⁵ In this study, three heterozygous mutations were detected in patients with microcornea both with/without other ocular abnormalities. All the mutations were located in PD: c.83_85delAGA (p.Lys28del) in PAI and c.337G>C (p.Ala113Pro) as well as c.399_399+5del6 in RED. Mutations c.83_85delAGA (p.Lys28del) and c.337G>C (p.Ala113Pro) might be causative because of the dominant-negative effect while c.399_399+5del6 might cause the abnormality in the patient by haploinsufficiency of the PAX6. Moreover, since microcornea was observed in PAX6 overexpressed transgenic mouse, the effect of the mutations discovered in our microcornea cohort on the expression of PAX6 deserves further study. 

The ocular malformations caused by PAX6 mutations vary considerably in pattern and severity. Iris hypoplasia, nystagmus, and foveal hypoplasia were most common. ^21,26 In our study, we found microcornea related to PAX6 mutations accompanying slight iris hypoplasia, which was not well described in the past. The mutation rate is 11.4%, which was higher than other genes involved in microcornea. Phenotype and genotype heterogeneity were also noticed in this cohort. The PAX6 mutation, c.83_85delAGA, was detected in two unrelated probands: 71158 and 71987. Similar phenotypes were recorded in the two patients, like microcornea, nystagmus, and abnormal iris in different severities. However, different phenotypes caused by the same PAX6 mutation were also observed within family 71987. Unlike the proband, the dizygotic twin brother harboring the same mutation had normal corneal size with very slight iris structure abnormality. The mutation c.399_399+5del was reported before. ²⁰ Aniridia, macular hypoplasia, nystagmus, and strabismus were noticed in the proband. Other family members with the same mutation also presented aniridia. In our study, 71952 with the same mutation had partial iris, severe cataract, and nystagmus for poor vision. Subtle variations in phenotype caused by the same mutation may originate from small differences in PAX6 protein level as well as unclear modulate factors affecting ocular development. 

Table 2. 

 

Extended

ID	Cornea		Iris Anomaly	Lens	Fundus		ERG	AL (mm)		PTS	SBM	NYS
	Diameter (mm)	Transparent			Foveal Hypoplasia	Other Features		OD	OS
71158	8	Yes	Partial iris	Normal	Yes	Small optic disc	Normal	19.0	19.0	Yes	No	Yes
71987 III:2	9	Yes	Full iris, abnormal structure	Normal	Yes	No	NA	19	20	No	No	Yes
71987 III:3	11	Yes	Full iris, abnormal structure	Normal	No	No	NA	22	22	No	No	No
71438	9.5	Opacity, OD	Full iris, abnormal structure	Normal, OS	Yes, OS	Small optic disc; partly coloboma; posterior staphyloma;	NA	29	29	No	OD	Yes
71952	9	Yes	Partial iris	Posterior lamellar opacity, OU	NA	No	NA	24	23	No	No	Yes

Acknowledgments

The authors thank all patients and their family members for their participation. 

Footnotes

¹  These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.

Footnotes

 Supported by the National Natural Science Foundation of China 30971588, Medical Scientific Research Foundation of Guangdong Province, China B2010105, and by the National Science Fund for Distinguished Young Scholars Grant 30725044.

Footnotes

 Disclosure: P. Wang, None; W. Sun, None; S. Li, None; X. Xiao, None; X. Guo, None; Q. Zhang, None