August 2010
Volume 51, Issue 8
Free
Retina  |   August 2010
Characterization of Retinal and Blood Mitochondrial DNA from Age-Related Macular Degeneration Patients
Author Affiliations & Notes
  • M. Cristina Kenney
    From the Departments of Ophthalmology,
  • Shari R. Atilano
    From the Departments of Ophthalmology,
  • David Boyer
    the Retina-Vitreous Associates Medical Group, Beverly Hills, California; and
  • Marilyn Chwa
    From the Departments of Ophthalmology,
  • Garrick Chak
    From the Departments of Ophthalmology,
  • Sahmon Chinichian
    From the Departments of Ophthalmology,
  • Pinar Coskun
    Biological Chemistry,
    Ecology and Evolutionary Biology, and
    Pediatrics and
    the Center for Molecular and Mitochondrial Medicine and Genetics, University of California, Irvine, Irvine, California;
  • Douglas C. Wallace
    Biological Chemistry,
    Ecology and Evolutionary Biology, and
    Pediatrics and
    the Center for Molecular and Mitochondrial Medicine and Genetics, University of California, Irvine, Irvine, California;
  • Anthony B. Nesburn
    From the Departments of Ophthalmology,
    American Eye Institute, Cedars-Sinai Medical Center, Los Angeles, California.
  • Nitin S. Udar
    From the Departments of Ophthalmology,
  • Corresponding author: M. Cristina Kenney, Department of Ophthalmology, University of California Irvine, Medical Center, 101 The City Drive, Orange, CA 92868; mkenney@uci.edu
Investigative Ophthalmology & Visual Science August 2010, Vol.51, 4289-4297. doi:10.1167/iovs.09-4778
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      M. Cristina Kenney, Shari R. Atilano, David Boyer, Marilyn Chwa, Garrick Chak, Sahmon Chinichian, Pinar Coskun, Douglas C. Wallace, Anthony B. Nesburn, Nitin S. Udar; Characterization of Retinal and Blood Mitochondrial DNA from Age-Related Macular Degeneration Patients. Invest. Ophthalmol. Vis. Sci. 2010;51(8):4289-4297. doi: 10.1167/iovs.09-4778.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To determine mitochondrial (mt)DNA variants in AMD and age-matched normal retinas.

Methods.: Total DNA was isolated from retinas (AMD, n = 13; age-matched normal, n = 13), choroid (AMD, n = 3), and blood (AMD, n = 138; normal, n = 133). Long-extension–polymerase chain reaction amplified the full-length (∼16.2 kb) mtDNA genome. Retinal mtDNA was sequenced for nucleotide variants and length heteroplasmy. Pyrosequencing was performed on heteroplasmic mtDNA. PCR amplification and enzyme digestions were used to analyze for nucleotide changes.

Results.: Retinal mtDNA had a greater number of rearrangements and deletions than did blood mtDNA in normal samples (9.3 ± 1.78 vs. 3 ± 1.18, P = 0.019), and AMD samples (14.33 ± 1.96 vs. 5.2 ± 0.80, P = 0.0031. Five (55%) of 9 AMD patients had unreported SNPs, and 2 (16.6%) of 12 of the normal group did. The mtDNA coding region had 20 SNPs that produced amino acid changes. The noncoding MT-Dloop region had nucleotide heteroplasmy and length heteroplasmy. There were more SNPs per person in the AMD population than in the older (P = 0.003) and younger (P = 0.05) normal subjects. The C12557T (T-I) in the MT-ND5 gene was present in two AMD subjects (2/138) but was absent in the normal (0/133). Common mutations for Leber's hereditary optic neuropathy (LHON: G11778A; T14484C; and G3460A) were not present in AMD samples.

Conclusions.: AMD subjects have high levels of large mtDNA deletions/rearrangements in the retinas, unreported and amino acid–changing SNPs in the coding genome, and a greater number of SNPs per person in the noncoding MT-Dloop region. These mtDNA variants could diminish energy production efficiency, alter the mtDNA copy numbers and/or impact transcription in AMD retinas.

Age-related macular degeneration (AMD) causes visual impairment in a large number of our elderly population. The dry or atrophic form of AMD (stage 4) has extensive loss of retinal pigment epithelial (RPE) cells and overlying retinal photoreceptors. Wet, or neovascular, AMD (stage 5) is characterized by severe vision loss due to choroidal neovascularization. 
The mtDNA genome comprises 16,569 nucleotides (nt) and encodes for 37 genes, 13 protein subunits essential for oxidative phosphorylation (OXPHOS), and 2 ribosomal (r)RNAs and 22 transfer (t)RNAs. 1,2 mtDNA differs from human nuclear DNA in that it is circular and lacks 5′ or 3′ noncoding sequences and introns. 3 The 13 mtDNA encoded proteins include seven structural subunits of complex I, one subunit of complex III, three subunits of complex IV, and two subunits of complex V. Mutations and rearrangements within the mtDNA coding region are associated with diseases of the kidney, the skeletal and cardiac muscles, the brain, the eye, and the endocrine system. mtDNA has a noncoding 1121nt control region (MT-Dloop) that is critical for mtDNA replication and transcription. Mutations in the mtDNA control region have been described in patients with Alzheimer's disease and disorders associated with oxidative stress. 4  
Photoreceptor cells contain numerous mitochondria responsible for generating sufficient energy for the metabolically active retina. The combination of high levels of reactive oxygen species (ROS) and poor repair mechanisms make the mtDNA very susceptible to oxidative damage, apoptosis, and cell death. The human aging retina has mitochondria with significant degeneration of cristae and disruption of membranes. 5 In a rat model of the degenerating retina, deletions in the mtDNA have been reported, 6 and in human RPE cultures, oxidative stress leads to preferential damage of mtDNA compared with nuclear DNA. 7 Although the involvement of mitochondria in metabolically active tissues has been discussed, few studies have been conducted to examine the mtDNA variations in retinal tissues from AMD patients and age-matched normal individuals. 
In this study, AMD tissues had high levels of SNPs in the MT-Dloop region that affect replication and transcription. In addition, the retinal mtDNA had evidence of low copy heteroplasmy, which is usually associated with a disease state. Finally, there were numerous unreported and nonsynonymous SNPs associated with AMD. These variants could diminish the functional efficiency leading to insufficient energy for the highly metabolic retina. 
Materials and Methods
Collection of Blood Specimens from Patients
The study was approved by the institutional review boards of the University of California Irvine (HS 2003-3131) and Cedars-Sinai Medical Center (IRB 1708). Informed consent was obtained from the participants, and the study was performed according to the tenets of the Declaration of Helsinki for research involving human subjects. A total of 271 individuals—133 normal subjects (average age 74 years, range 60–93) and 138 AMD patients (average age 79 years, range 60–95)—were studied. 
Classification of AMD
The subjects underwent a complete dilated ophthalmic examination by board-certified ophthalmologists (DSB, ABN, MCK) including both slit lamp examination and an indirect ophthalmic examination with a 90-D lens or a fundus contact lens. Fundus photos, fluorescence, and/or indocyanine green angiography were performed. The photos and angiograms were read by masked graders who are board certified retina specialists. 
Collection of Retinas
Globes from 13 normal (mean age, 77.38 years; range, 56–97) and 13 AMD subjects (mean age 83.58 years, range, 69–93; P = 0.16) were collected from the National Disease Research Interchange (Philadelphia, PA) and/or the San Diego Eye Bank (Table 1). The diseased specimens had a clinical diagnosis and medical history of AMD that had significantly impaired vision. A board-certified ophthalmologist verified disease in the macular region by using the Minnesota Grading System of Eye Bank Eyes (Table 1). 8 In this article, retina refers to the neural retina and choroid refers to the RPE and choroid. The sclera was removed and not analyzed. In three AMD individuals, we extracted DNA from both the retina and the choroid and/or the blood. 
Table 1.
 
Tissue Demographics
Table 1.
 
Tissue Demographics
Normal Retinas AMD Retinas Blood
Age Sex Race Age Sex Race AMD Level* Age Sex Race
N1 79 M NA A1 64 F C 4 B1 63 F NA
N2 73 F C A2 88 M C 3d B2 74 F NA
N3 76 M C A3 78 F C 4 B3 85 F NA
N4 79 F C A4 78 F C 3d B4 75 F NA
N5 79 M C A5 82 M C 4 B5 90 M NA
N6 88 F C A6 78 F C 4 B6 80 M NA
N7 91 M C A7 93 F C 4 B7 82 F NA
N8 97 F C A8 88 F C 3d B8 73 M NA
N9 60 M B A9 90 M C 4 B9 62 F NA
N10 56 F C A10 83 F C 4 B10 88 M NA
N11 59 M C A11 89 F C 3d
N12 84 F C A12 71 F C 3
N13 85 F C A13 NA M C 4
Extraction of Total DNA from Blood, Retinal, and Choroidal Tissues
We used a kit to isolate DNA from venous blood samples (10 mL) of the age-matched subjects (Puregene; Gentra, Minneapolis, MN). DNA was extracted from frozen retinal tissue by methods published elsewhere. 9 For the extraction of choroidal DNA, no centrifugation steps were performed because of the coprecipitation of DNA with melanin, a known inhibitor of PCR. 10 Instead, after the precipitation of DNA in ammonium acetate, the DNA precipitate was removed by hand and dip washed in 70% and 100% ethanol. The DNA was then dried and resuspended in Tris-EDTA (TE). 
Long-Extension—Polymerase Chain Reaction (LX-PCR) Analyses
The total DNA isolated from normal and AMD retinas was used for LX-PCR amplification by modification of the method described by Atilano et al. 11 Briefly, LX-PCR was performed with 10 ng of DNA, a high-fidelity PCR system (FailSafe; Epicenter Biotechnologies, Madison, WI), and primers that specifically amplify 16,262 bp of the mtDNA. 11  
RFLP Analyses of mtDNA Variants
Restriction enzyme digestion of various PCR products (Table 2) was used to screen for the C12557T variant (BseYI) and the common LHON mutations: G11778A (LweI), G3460A (HgaI), and T14484C (BsaBI), according to the manufacturer's protocol (NEB, Ipswich, MA). 
Table 2.
 
Primers Used in This Study
Table 2.
 
Primers Used in This Study
Name Forward Primer Reverse Primer Size (bp) PCR Annealing Temp. (°C)
LHON 11778G>A GAAGCTTCACCGGCGCAGTCATTCTCA TGGGTGAGTGAGCCCCATTGTGTTGTG 243 58
LHON 3460G>A TCACAAAGCGCCTTCCCCCGTAAATGA TGTGGCGGGTTTTAGGGGCTCTTTGGT 348 60
LHON 14484T>C GCCATCGCTGTAGTATATCCAAAGATAACCA TGGTCGTGGTTGTAGTCCGTGCGAGAA 250 55
MT-Dloop CTAAGCCAATCACTTTATTG GCTGCGTGCTTGATGCTTGT 1640 55
12557 C>T CCCCCATCCTTACCACCCTCGTTAACCCTAA TTCCTACGCCCTCTCAGCCGATGAACA 396 65
LX-PCR TGAGGCCAAATATCATTCTGAGGGGC TTCATCATGCGGAGATGTTGGATGG 16292 68
MT-ND5A CCCCGACATCATTACCGGGTTTTCCTC TTGTGGATGATGGACCCGGAGCACATA 1275 65
MT-ND5B TCATCCGCTTCCACCCCCTAGCAGAAA TGGAGGTAGGATTGGTGCTGTGGGTGA 1269 66
MT-CYTB CACACCCGACCACACCGCTAACAATCA GGTGAGGGGTGGCTTTGGAGTTGCAGT 1715 65
MT-ATP6 TCTTGCACTCATGAGCTGTC GCCAATAATGACGTGAAGTCC 1739 52
Mismatch-Specific Endonuclease Assay
PCR was performed on retina, choroid, and/or blood samples from three individuals using high fidelity DNA polymerases (PfuUltra II; Stratagene, La Jolla, CA) for MT-ATP6, MT-ND5, and MT-CYB (FailSafe; Epicentre Biotechnologies; Table 2). These samples were examined for mutations with a mismatch-specific endonuclease (Surveyor Nuclease; Transgenomic, Omaha, NE) according to the manufacturer's protocol. Treated products were visualized on 2% agarose gels (NuSieve; Lonza Rockland Inc., Rockland, ME) and imaged on a phosphorimager (FMBIO III; Hitachi, San Francisco, CA). 
Sequencing of the Entire mtDNA Genome
The retinal, choroidal, and blood DNA samples were subjected to PCR with various primers that spanned the entire mtDNA sequence. The PCR products were processed for sequencing by methods previously described. 11  
Pyrosequencing
This technology is a unique method of short-read DNA sequencing, allele quantification, and mutation/SNP analysis. A 400-bp sequence surrounding the heteroplasmy of interest was sent to the UCLA Genotyping and Sequencing Core for primer design. PCR was performed with a biotinylated forward primer (Invitrogen, Carlsbad, CA), and products were analyzed by the UCLA Genotyping and Sequencing Core. 
Statistical Analyses
LX-PCR and semiquantitative PCR data were analyzed by unpaired t-test (two-tailed; GraphPad Software, Inc., San Diego, CA). Odds ratios and P-values were calculated by using Simple Interactive Statistical Analysis (http://www.quantitativeskills.com/sisa/statistics/t-test.htm/ an open-source program for simple statistical computations developed by Daan Uitenbroek, Hilversum, The Netherlands). 
Results
LX-PCR Analyses of Retinal Tissues and Blood mtDNA
The LX-PCR mtDNA bands (<16.2 and >1 kb) from different tissues were quantified and the mean values ± SEM calculated (Fig. 1). There was no significant difference between the number of LX-PCR mtDNA bands per individual in the normal and AMD retinas (9.30 ± 1.78 vs. 14.3 ± 1.96, P = 0.088; Fig. 1A) or the normal and AMD blood samples (3.0 ± 1.18 vs. 5.2 ± 0.80, P = 0.16; Fig. 1B). We then examined the number of LX-PCR mtDNA bands in the retinas (Fig. 1A) versus that in blood (Fig. 1B) and found significantly more rearrangements and mutations in both the normal (9.3 ± 1.78 vs. 3.0 ± 1.18, P = 0.019) and AMD (14.33 ± 1.96 vs. 5.2 ± 0.80, P = 0.0031) samples. Within the same AMD individual, the retina mtDNA showed a significantly higher number of small-sized bands than in the blood (11 ± 1.0 vs. 0.5 ± 0.5, P = 0.011; Fig. 1C), but the choroid values were similar (11 ± 1.0 vs. 5.67 ± 2.6, P = 0.10). Choroidal mtDNA showed the most variability in the LX-PCR mtDNA profile (range, 1–10 small-sized bands), whereas retinas showed the least variability (range, 10–14 bands). This suggests that choroidal mitochondrial mutations may not have a major role in the development of AMD. 
Figure 1.
 
LX-PCR of retinal and blood mtDNA. Representative ethidium bromide–stained gel showing LX-PCR mtDNA from retinas (A) and blood (B) of different AMD and normal subjects. The 16.2-kb product corresponds to the full-length mtDNA genome. The smaller sized LX-PCR products (<16.2 kb and >1.0 kb) represent mtDNA rearrangement/deletions. 18s represents nuclear DNA. (C) A representative gel of the LX-PCR mtDNA of retina, choroid, and blood samples from two AMD individuals (A8 and A9) and retina and choroid samples from one AMD individual (A7). Subject A7: retina R1 and choroid C1; subject A8: retina R2, blood B2, and choroid C2; subject A9: retina R3, blood B3, and choroid (C3). –, the water control; M, marker.
Figure 1.
 
LX-PCR of retinal and blood mtDNA. Representative ethidium bromide–stained gel showing LX-PCR mtDNA from retinas (A) and blood (B) of different AMD and normal subjects. The 16.2-kb product corresponds to the full-length mtDNA genome. The smaller sized LX-PCR products (<16.2 kb and >1.0 kb) represent mtDNA rearrangement/deletions. 18s represents nuclear DNA. (C) A representative gel of the LX-PCR mtDNA of retina, choroid, and blood samples from two AMD individuals (A8 and A9) and retina and choroid samples from one AMD individual (A7). Subject A7: retina R1 and choroid C1; subject A8: retina R2, blood B2, and choroid C2; subject A9: retina R3, blood B3, and choroid (C3). –, the water control; M, marker.
Sequence Analyses of AMD Retina, Choroid, and Blood mtDNA
The entire mtDNA genomes from retinas, choroid, and/or blood of three AMD individuals were sequenced to determine nucleotide variations (Table 3). The nucleotide sequences of the retina, choroid, and blood from one individual were identical with each other but differed among AMD individuals. The noncoding MT-Dloop region contained 41.2% of the total number of SNPs found in the sequence (33/80). The A10420C (MT-tRNA(R)) has not been reported. Five of the SNPs in the coding regions of the mtDNA were associated with nonsynonymous amino acid changes (Table 3): G8616T(L-F, MT-ATP6), A10398G(T-A, MT-ND3), C12557T(T-I, MT-ND5), A13780G(I-V, MT-ND5), and C14766T(T-I, MT-CYB). 
Table 3.
 
Numbers of SNPs in Each mtDNA Gene Found in Retina, Choroid, and Blood
Table 3.
 
Numbers of SNPs in Each mtDNA Gene Found in Retina, Choroid, and Blood
Gene Subject A7 Subject A8 Subject A9 Total SNPs Nonsynonymous Changes
MT-Dloop 14 3 16 33 Noncoding
MT-RNR1 0 0 0 0 Noncoding
MT-RNR2 2 0 2 4 Noncoding
MT-ND1 2 0 2 4 0
MT-ND2 3 1 4 8 0
MT-CO1 2 0 3 5 0
MT-CO2 1 0 0 1 0
MT-ATP8 0 0 1 1 0
MT-ATP6 1a 0 0 1 aG8616T [L-F]
MT-CO3 1 0 0 1 0
MT-ND3 2b 0 0 2 bA10398G [T-A]
MT-TR 0 1c 0 1 cA10420C; unreported
MT-ND4 3 0 3 6 0
MT-TL2 0 0 1 1 Noncoding
MT-ND5 3d 0 4e 7 eC12557T [T-I]
dA13780G [I-V]
MT-ND6 1 0 0 1 0
MT-CYB 2f 0 1f 3 f14766T [T-I]
MT-TT 1 0 0 1 Noncoding
Total 38 4 37 80
The mtDNA from additional AMD (n = 9) and normal (n = 12) retinas were sequenced through the MT-ATP6 (nt8133-9698), MT-ND5 (nt12236-14233), and MT-CYB (nt14659-16126) genes. There were 7.0 SNPs per person in the AMD group and 6.5 per person in the normal group. When examined by decade, there were no significant differences between the AMD and normal populations (Table 4A). There were seven unreported SNPs (Table 4B) that had predicted amino acid changes. In the AMD population, 55% had an unreported SNPs, whereas the normal population had 16.6% (P = 0.07). Table 4C lists 19 known SNPs that lead to amino acid changes (nonsynonymous) in the human retinal mtDNA. There were 2.44 nonsynonymous SNPs per person in the AMD population and 1.66 in the normal population. 
Table 4.
 
SNP Data
Table 4.
 
SNP Data
A. Number of SNPs Per Person in MT-ATP6, MT-CYB, and MT-ND5 Genes
Decade Total
50 60 70 80 90
Normal subjects (n = 3) (n = 1) (n = 5) (n = 2) (n = 2) (n = 13)
    MT-ATP6 1.7 0 2.2 1.5 1.0 1.3
    MT-CYB 5.5 1.0 4.0 5.0 1.5 3.4
    MT-ND5 5.0 1.0 1.3 1.0 0.5 1.8
AMD subjects (n = 0) (n = 1) (n = 3) (n = 3) (n = 2) (n = 9)
    MT-ATP6 n/a 3.0 0.7 0.3 1.5 1.4
    MT-CYB n/a 5.0 3.3 2.7 2.5 3.4
    MT-ND5 n/a 2.0 3.3 1.3 2.0 2.2
Normal + AMD subjects (n = 3) (n = 2) (n = 8) (n = 5) (n = 4) (n = 22)
    MT-ATP6 1.7 3.0 2.9 1.8 2.5 2.4
    MT-CYB 5.5 6.0 7.3 7.7 4.0 6.1
    MT-ND5 5.0 3.0 4.6 2.3 2.5 3.5
B. Unreported SNPs in Various Mitochondrial Genes
Gene Unreported SNPS Predicted Amino Acid Change Incidence
MT-CO2 8133C>T Thr>Ile 1/9 AMD; 0/12 NL
MT-ATP8 8429C>T Leu>Phe 1/9 AMD; 0/12 NL
MT-ND5 12953C>T Ala>Val 1/9 AMD; 0/12 NL
MT-ND5 13926T>C Pro>Pro 0/9 AMD; 1/12 NL
MT-ND6 14659C>T Leu>Leu 0/9 AMD; 1/12 NL
MT-CYB 14845C>T Phe>Phe 1/9 AMD; 0/12 NL
MT-CYB 15852T>C Ile>Thr 1/9 AMD; 0/12 NL
C. Reported Nonsynonymous SNPs in Various Mitochondrial Genes
Gene Reported SNPS Predicted Amino Acid Change Incidence
MT-ATP8 8519G>A Glu>Lys 1/9 AMD; 0/12 NL
MT-ATP6 8616G>T Leu>F 0/9 AMD; 1/12 NL
MT-ATP6 8701A>G Thr>Ala 1/9 AMD; 0/12 NL
MT-ATP6 8794C>T His>Tyr 1/9 AMD; 0/12 NL
MT-ATP6 8869A>G Met>Val 1/9 AMD; 0/12 NL
MT-ATP6 9055G>A Ala>Thr 1/9 AMD; 1/12 NL
MT-CO3 9477G>A Val>Ile 0/9 AMD; 2/12 NL
MT-ND5 13681A>G Thr>Ala 1/9 AMD; 0/12 NL
MT-ND5 13708G>A Ala>Thr 2/9 AMD; 1/12 NL
MT-ND5 13759G>A Ala>Thr 0/9 AMD; 1/12 NL
MT-ND5 13780A>G Ile>Val 1/9 AMD; 1/12 NL
MT-ND5 13928G>C Ser>Thr 0/9 AMD; 1/12 NL
MT-ND5 13958G>C Gly>Ala 0/9 AMD; 1/12 NL
MT-CYB 14766C>T Thr>Ile 8/9 AMD; 5/11 NL
MT-CYB 14798T>C Phe>Leu 2/9 AMD; 1/11 NL
MT-CYB 14861G>A Ala>Thr 0/9 AMD; 1/11 NL
MT-CYB 15110G>A Ala>Thr 0/9 AMD; 1/11 NL
MT-CYB 15452C>A Leu>Ile 3/9 AMD; 2/11 NL
MT-CYB 15849C>T Thr>Ile 0/9 AMD; 1/11 NL
The MT-Dloop region mtDNA was sequenced in AMD (n = 10), age-matched normal subjects (n = 8), and a younger subset of normal subjects (n = 4; Table 5). There was a significantly greater number of SNPs per person in the AMD population (9.75 ± 0.75) compared with either the older (5.90 ± 0.77, P = 0.003) or the younger (6.00 ± 1.91, P = 0.05) normal group. 
Table 5.
 
Number of SNPs per Person in MT-Dloop
Table 5.
 
Number of SNPs per Person in MT-Dloop
n Average Age, y (range) SNPs per Individual, Mean ± SEM P
Younger NL vs. Older NL 4 29.8 (19–43) 6.00 ± 1.91 0.95
10 79.9 (52–79) 5.90 ± 0.77
Younger NL vs. Older AMD 4 29.8 (19–43) 6.00 ± 1.91 0.05
8 80.0 (64–93) 9.75 ± 0.75
Younger NL vs. Older NL + AMD 4 29.8 (19–43) 6.00 ± 1.91 0.36
18 80.0 (64–93) 7.61 ± 0.70
Older NL vs. Older AMD 8 79.0 (52–97) 5.90 ± 0.77 0.003
10 80.0 (64–93) 9.75 ± 0.75
Subject AMD13 had the uncommon C12557T(T-I) variant in the retina, choroid, and blood (Fig. 2). This SNP is uncommon and only reported as an unpublished polymorphism (www.MitoMap.org/ provided in the public domain by the Center for Molecular and Mitochondrial Medicine, University of California, Irvine). We then screened the blood mtDNA from 138 AMD subjects and 133 age-matched normal subjects (Fig. 2) and found this variant in an additional AMD patient (2/138) and in no normal subjects (0/133). This result suggests that the C12557T(T-I) variant found in our two AMD patients and located within the ND5 gene was unique and shows a strong association with AMD. 
Figure 2.
 
Top: the sequence pattern of AMD subject A13 showing the C12577T(T-I) variant found in the retina, choroid, and blood mtDNA. Bottom: results from screening the blood mtDNA from an additional 271 subjects. There was one AMD subject who also had the C12577T variant. None of the normal subjects had this variant.
Figure 2.
 
Top: the sequence pattern of AMD subject A13 showing the C12577T(T-I) variant found in the retina, choroid, and blood mtDNA. Bottom: results from screening the blood mtDNA from an additional 271 subjects. There was one AMD subject who also had the C12577T variant. None of the normal subjects had this variant.
Length Heteroplasmy in the Control Region of Retinal mtDNA
The retinal MT-Dloop was sequenced to analyze the variations of the C insertions at different sites (303-309 and 568-573; Tables 6A, 6C). The most common variation at site 303-309 was C7/T/C6. There were duplicate (C7/T/C6;C8/T/C6 and C8/T/C6;C9/T/C6) and triplicate (C9/T/C6;C10/T/C6;C11/T/C6 and C8/T/C6;C9/T/C6;C10/T/C6) variations within single individuals in the AMD and normal groups. 
Table 6.
 
Description of C Insertions in Retinal mtDNA
Table 6.
 
Description of C Insertions in Retinal mtDNA
A. Sequences 303–309
Reference Sequence CCCCCCCTCCCCC Sequence Variation C7/T/C6
NL
    5/9 CCCCCCCTCCCCC C7/T/C6
    3/9 CCCCCCCCTCCCCCC C8/T/C6
CCCCCCCCCTCCCCC C9/T/C6
    1/9 CCCCCCCCTCCCCCC C8/T/C6
CCCCCCCCCTCCCCCC C9/T/C6
CCCCCCCCCCTCCCCCC C10/T/C6
AMD
    3/7 CCCCCCCTCCCCC C7/T/C6
    2/7 CCCCCCCTCCCCCC C7/T/C6
CCCCCCCCTCCCCCC C8/T/C6
    1/7 CCCCCCCCTCCCCC C8/T/C6
    1/7 CCCCCCCCCTCCCCC C9/T/C6
CCCCCCCCCCTCCCCC C10/T/C6
CCCCCCCCCCCTCCCCC C11/T/C6
B. Sequences 514–523 CA Repeat
Reference Sequence CACACACACA Sequence Variation CA(5)
NL
    2/9 CACACACA CA(4)
    7/9 CACACACACA CA(5)
AMD
    7/7 CACACACACA CA(5)
C. Sequences 568–573 polyC
Reference Sequence CCCCCC Sequence Variation C(6)
NL
    10/10 CCCCCC C(6)
AMD
    6/7 CCCCCC C(6)
    1/7 CCCCCCCC C(8)
CCCCCCCCC C(9)
CCCCCCCCCC C(10)
D. Sequences 16,180–16,195
Reference Sequence AAAACCCCCTCCCCAT Sequence Variation A4/C5/T/C4/AT
NL
    6/12 AAAACCCCCTCCCCAT A4/C5/T/C4/AT
    1/12 AAAACCCCCTCCTCAT A4/C5/T/C2/ T C/AT
    1/12 AAACCCCCCCCCCCAT A3/C11/AT
AAACCCCCCCCCCCCAT A3/C12/AT
AMD
    5/7 AAAACCCCCTCCCCAT A4/C5/T/C4/AT
    1/7 AAAACCCCCCCCCAT A4/C9/AT
AAAACCCCCCCCCCAT A4/C10/AT
AAAACCCCCCCCCCCAT A4/C11/AT
    1/7 AACCCCCCCCCCCCAT A2/C12/AT
AACCCCCCCCCCCCCAT A2/C13/AT
AACCCCCCCCCCCCCCAT A2/C14/AT
At the 514-523 site, which has a polymorphic CA repeat, all but seven of the normal subjects had five CA repeats, and two had the 4CA repeat (Table 6B). At the 568-573 site, all the normal (10/10) and most of the AMD (6/7) had an insertion of six C nucleotides. One AMD subject had a combination of C(8), C(9), and C(10) insertions (Table 6C). At the 16,180-16,195 site, which is a complex repeat, 5 of 7 AMD and 6 of 12 normal subjects had the A4/C5/T/C4/AT variation (Table 6D). There was a combination (heteroplasmy) of A2/C12/AT;A2/C13/A;A2/C14/AT in one AMD subject and A3/C11/AT;A3/C12/AT in one normal subject. One normal individual had a T nucleotide inserted to yield A4/C5/T/C2/TC/AT. One AMD subject had a triplicate A4/C9/AT;A4;C10/AT;A4/C11/AT pattern. 
Single-Nucleotide Heteroplasmy in the Control Region of Retinal mtDNA
Using conventional fluorescent (Sanger) sequencing, we observed heteroplasmy at two positions in the retinal mtDNA: T16092TC and T16093TC. A high ratio of single-nucleotide heteroplasmy, an uncommon feature of mtDNA, can be inherited or somatic. The 16,092 heteroplasmy change was found in the right eye retina, left eye retina, and right eye choroid of individual AMD4 (A4; Fig. 3) indicating that it is most likely inherited. Using both direct sequencing and pyrosequencing techniques, the peaks were quantified to show the C signal to be 65% and the T signal to be 35%. The second heteroplasmy T16093TC was found in a normal retina (N2) and showed a C signal of 73% and the T signal of 27%. Although sequencing techniques (Sanger) recognize high percentages of heteroplasmy change, they miss low-level nucleotide conversions that we suspect may be present in the retinal mtDNA. We used the surveyor nuclease kit to screen the MT-ATP6, MT-ND5, and MT-CYB genes for low level heteroplasmic changes. The MT-ND5 gene was difficult to amplify in a single PCR, and so it was divided into MT-ND5A (1275 nt) and MT-ND5B (1269 nt). Figure 4 shows a representative gel of MT-ND5B after the PCR product was treated with the nuclease assay. Ten bands were observed in the MT-ND5B gene. The MT-ND5A gene had six bands, the MT-ATP6 gene had four bands, and the MT-CYB gene had six bands. This finding suggests that in retinal mtDNA, the level of low copy heteroplasmy is significantly higher than that reported by sequence analyses. 
Figure 3.
 
Sequence pattern of mtDNA in the MT-Dloop shows heteroplasmy at site 16,092 (top) in the right eye retinal tissue, the left eye retinal tissue, and the right eye choroidal tissue of AMD subject A4. Bottom: heteroplasmy site 16,093 in the retinal tissue of normal subject N2.
Figure 3.
 
Sequence pattern of mtDNA in the MT-Dloop shows heteroplasmy at site 16,092 (top) in the right eye retinal tissue, the left eye retinal tissue, and the right eye choroidal tissue of AMD subject A4. Bottom: heteroplasmy site 16,093 in the retinal tissue of normal subject N2.
Figure 4.
 
Low-copy heteroplasmy sites within the MT-ND5B genome. This gel is representative of the genome after nuclease digestion. The 10 bands represent five heteroplasmic sites (top). Bottom: describes the numbers of bands and heteroplasmic sites in the MT-ATP6, MT-ND5A, and MT-CYB genomes.
Figure 4.
 
Low-copy heteroplasmy sites within the MT-ND5B genome. This gel is representative of the genome after nuclease digestion. The 10 bands represent five heteroplasmic sites (top). Bottom: describes the numbers of bands and heteroplasmic sites in the MT-ATP6, MT-ND5A, and MT-CYB genomes.
Screen for the Common LHON Mutations
After PCR amplification and restriction digestion, the three most common LHON mutations, G3460A, G11778A, and T14484C, were screened from AMD and age-matched normal DNA samples (Table 7). All samples exhibited the wild-type alleles with no LHON mutation found in either the AMD or age-matched normal subjects. 
Table 7.
 
Description of LHON Mitochondrial Genes
Table 7.
 
Description of LHON Mitochondrial Genes
Gene Mutation Nucleotide Δ Amino Acid Δ Gene Genotypic Frequency of AMD Subjects (n = 58) Genotypic Frequency of Normal Subjects (n = 44)
LHON 11778A G>A R340H MT-ND4 GG = 58 GG = 44
GA = 0 GA = 0
AA = 0 AA = 0
LHON 14484C T>C M64V MT-ND6 TT = 58 TT = 44
TC = 0 TC = 0
CC = o0 CC = 0
LHON 3460A G>A A52T MT-ND1 GG = 58 GG = 44
GA = 0 GA = 0
AA = 0 AA = 0
Discussion
In our study, the retinal mtDNA had 20 nonsynonymous SNPs that result in amino acid changes. Eight SNPs were found in the aged retinas that are unreported on MitoMap (www.mitomap.org). Five of the SNPs were found in AMD retina and four of those were changes that could lead to amino acid changes (Table 4A). Further studies must be conducted to establish the significance of these new SNPs. If the amino acid substitution correlates with differences in OXPHOS efficiency, ROS formation and ATP production, then in a metabolically active tissue such as the retina, 12,13 there would be a great amount of variability between individuals, with some aging retinas being more susceptible to oxidative damage and cell death. This notion is consistent with reports of increased mtDNA damage in the aging human retina 9 and in aging rodents that exhibit oxidative DNA damage and decreased levels of DNA repair enzymes. 14 The variations in mtDNA SNPs most likely are important in maintaining high bioenergetic capacity and visual function, with some substitution being more resistant to mtDNA damage than other SNP patterns. Surprisingly, the number of synonymous and nonsynonymous SNPs in the coding genes was similar in the AMD and age-matched normal retinas. We have previously reported that the noncoding mtDNA control region (MT-Dloop) has significantly greater numbers of SNPs per individual in the AMD retinas than in the age-matched normal retinas, 9 which suggests that abnormalities in the mitochondrial replication and transcription function play a role in retinal degeneration. 
Sequence analysis of the entire mtDNA genome from human retinas, choroid, and/or blood from single individuals showed similar sequence patterns for each individual but significant variation among the different subjects. We used Sanger sequencing as a detection method; therefore, low level heteroplasmic changes were not scored and cannot be ruled out. The greatest number of SNPs (41.2%) was in the noncoding MT-Dloop, a region important in replication and transcription. The MT-Dloop is highly susceptible to nucleotide variations, and mutations within this region are found in patients with Alzheimer's disease and other disorders associated with oxidative stress. 4 The impact on replication and transcriptional efficiency caused by the MT-Dloop region hot spots is not understood at this time. 
Recent studies show that AMD is associated with specific mtDNA SNPs that define Northern European haplogroups. 9,1517 We have found that the European haplogroups T, J, and U were associated with AMD patients, 9 whereas another study showed that the JT haplogroup defines SNPs in subjects with late AMD. 15 The haplogroup T-associated SNP A4917G is an independent predictor of AMD 16 and the J and U haplogroups are associated with clinically recognized AMD retinal lesions. 17 The nonsynonymous SNPs of different mtDNA haplogroups may lead to changes in OXPHOS efficiencies and increased ROS production that could increase susceptibility to oxidative stress and apoptosis. 18,19 It is likely that some of these nonsynonymous SNPs can influence the mitochondrial energy production efficiency 4 by leading to a partially uncoupled OXPHOS, decreased ATP production per calories consumed, and increased heat production. 
None of the AMD subjects had the three most common mtDNA mutations of LHON. This result was not unexpected, since the clinical onset and symptoms of the LHON and AMD patients are different. The milder LHON mutation on the specific J haplogroup background induces more severe disease, 20 and so perhaps on the J, U, or T haplogroup backgrounds, other SNPs act synergistically to create mitochondrial dysfunction and OXPHOS uncoupling in AMD subjects. 
Length Heteroplasmy in the Control Region of Retinal mtDNA
In the retina mtDNA control regions, there were four sites of C insertions representing length heteroplasmy. One individual can have single, double, or triple C variation copies of the length heteroplasmy. These C variation sites have been reported in MitoMap gene sequences and include large stretches of Cs that may cause decreased efficiency of the control region. The MT-Dloop region has homoplasmic insertions that lead to a stretch of 6 Cs from nt 568 to 573. 21 This stretch of Cs may interact with a 7-bp stretch at region 302-308 to form a 270-nt duplication in the MT-Dloop. 21 Alternatively, there may be increased “slippage” due to loss of the T nucleotide anchor, resulting in large stretches of Cs that may cause erroneous base-pair matching and decreased replication efficiency. 
As a result of a T>C substitution at 16,189, there is a stretch of Cs along with either four or three adenines, the latter representing a single-bp deletion relative to the Cambridge reference sequence (CRS). 22 We found that in addition to 16189T>C there was also a 16182A>C substitution and a deleted A at position 16,183. This results in two adenines rather than the four adenines of the CRS. In subjects with the 16,189 variant, the length heteroplasmy may be created by replication slippage in the homopolymeric C stretch. Furthermore, the 16,189 position needs at least eight consecutive cytosines to show replication slippage while the position 310 needs a minimum of seven consecutive cytosines for slippage to occur. 23 The 16,189 changes are in the hypervariable region 1 (MT-HV1) of the mtDNA control region, and one can speculate that these changes could cause a decreased mitochondrial efficiency. 
Heteroplasmy of Point Mutations in the Control Region of Retinal mtDNA
Using sequencing techniques, we identified two different SNPs with a high ratio of heteroplasmy in the retinal mtDNA. The 16092T>TC heteroplasmy was found consistently in retina and choroid of the same individual. This heteroplasmic consistency has been reported between blood and buccal cells 24 and between blood and muscle. 25 In contrast, there are highly variable levels of heteroplasmy in skin hair roots. 24 A previous multiple-generation study showed that 16,092 had a C in the grandmother, a heteroplasmy of a ratio of ∼0.7T:0.3C in the mother and one child, but a fixed 16092C for five other children. 26 The cause of the rapid change in this 16,092 position is not clear. The 16,092 site may represent a “hot spot” for nucleotide substitutions. The extremely rapid segregation of the 16,092 sequence within the generations is a possible mtDNA bottleneck that occurs in some families. Severe, deleterious mtDNA mutations are eliminated from the female germ line within a relatively short number of generations, whereas the more moderate, yet disease-producing, mtDNA mutations can undergo transmission for many generations. 27 The 16,092 SNP may be associated with a genetically undesirable condition so that rapid change is important, and finding the heteroplasmic condition captures a window of the transformation to the more stable homoplasmic condition. Control region heteroplasmy may impair mitochondrial copies and/or functional efficiency, thereby contributing to decreased energy production and cell death. 
Direct (Sanger) sequencing of the mtDNA control regions is limited, in that heteroplasmic changes that have a high ratio above the threshold can be detected, whereas low-level heteroplasmy changes are not recognized. We analyzed for low-level heteroplasmy changes by using the nuclease assay (Surveyor Nuclease; Transgenomic) which detects heteroplasmy levels as low as 3%. 28 We identified low copy heteroplasmic sites in the MT-ATP6, MT-CYB, and MT-ND5 genes. The heteroplasmic substitutions are usually associated with disease, whereas the homoplasmic changes are usually polymorphisms that are not harmful. Future studies are needed to identify the functional consequences of the nonsynonymous SNPs, their length and heteroplasmy, and their higher levels in the MT-Dloop region. However, it is reasonable to speculate that high levels of somatic mtDNA damage can result in an age-related loss of mitochondrial function. 
Footnotes
 Supported by The Discovery Eye Foundation, the Lincy Foundation, the Henry L. Guenther Foundation, the Iris and B. Gerald Cantor Foundation, the Gilbert Foundation, and Research to Prevent Blindness.
Footnotes
 Disclosure: M.C. Kenney, None; S.R. Atilano, None; D. Boyer, None; M. Chwa, None; G. Chak, None; S. Chinichian, None; P. Coskun, None; D.C. Wallace, None; A.B. Nesburn, None; N.S. Udar, None
References
Wallace DC . Diseases of the mitochondrial DNA. Annu Rev Biochem. 1992;61:1175–1212. [CrossRef] [PubMed]
Wallace DC . Mitochondrial DNA mutations in diseases of energy metabolism. J Bioenerg Biomembr. 1994;26(3):241–250. [CrossRef] [PubMed]
Wallace DC . A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet. 2005;39:359–407. [CrossRef] [PubMed]
Coskun PE Beal MF Wallace DC . Alzheimer's brains harbor somatic mtDNA control-region mutations that suppress mitochondrial transcription and replication. Proc Natl Acad Sci U S A. 2004;101(29):10726–10731. [CrossRef] [PubMed]
Nag TC Wadhwa S Chaudhury S . The occurrence of cone inclusions in the ageing human retina and their possible effect upon vision: an electron microscope study. Brain Res Bull. 2006;71(1–3):224–232. [CrossRef] [PubMed]
Bravo-Nuevo A Williams N Geller S Stone J . Mitochondrial deletions in normal and degenerating rat retina. Adv Exp Med Biol. 2003;533:241–248. [PubMed]
Liang FQ Godley BF . Oxidative stress-induced mitochondrial DNA damage in human retinal pigment epithelial cells: a possible mechanism for RPE aging and age-related macular degeneration. Exp Eye Res. 2003;76(4):397–403. [CrossRef] [PubMed]
Olsen TW Feng X . The Minnesota Grading System of eye bank eyes for age-related macular degeneration. Invest Ophthalmol Vis Sci. 2004;45(12):4484–4490. [CrossRef] [PubMed]
Udar N Atilano SR Memarzadeh M . Mitochondrial DNA haplogroups associated with age-related macular degeneration. Invest Ophthalmol Vis Sci. 2009;50(6):2966–2974. [CrossRef] [PubMed]
Eckhart L Bach J Ban J Tschachler E . Melanin binds reversibly to thermostable DNA polymerase and inhibits its activity. Biochem Biophys Res Commun. 2000;271(3):726–730. [CrossRef] [PubMed]
Atilano SR Chwa M Kim DW . Hydrogen peroxide causes mitochondrial DNA damage in corneal epithelial cells. Cornea. 2009;28(4):426–433. [CrossRef] [PubMed]
Futterman S Kinoshita JH . Metabolism of the retina. I. Respiration of cattle retina. J Biol Chem. 1959;234(4):723–726. [PubMed]
Winkler BS . Glycolytic and oxidative metabolism in relation to retinal function. J Gen Physiol. 1981;77(6):667–692. [CrossRef] [PubMed]
Wang AL Lukas TJ Yuan M Neufeld AH . Age-related increase in mitochondrial DNA damage and loss of DNA repair capacity in the neural retina. Neurobiol Aging. Published online December 10, 2008.
SanGiovanni JP Arking DE Iyengar SK . Mitochondrial DNA variants of respiratory complex I that uniquely characterize haplogroup T2 are associated with increased risk of age-related macular degeneration. PLoS One. 2009;4(5):e5508. [CrossRef] [PubMed]
Canter JA Olson LM Spencer K . Mitochondrial DNA polymorphism A4917G is independently associated with age-related macular degeneration. PLoS ONE. 2008;3(5):e2091. [CrossRef] [PubMed]
Jones MM Manwaring N Wang JJ . Mitochondrial DNA haplogroups and age-related maculopathy. Arch Ophthalmol. 2007;125(9):1235–1240. [CrossRef] [PubMed]
Ruiz-Pesini E Lapena AC Diez-Sanchez C . Human mtDNA haplogroups associated with high or reduced spermatozoa motility. Am J Hum Genet. 2000;67(3):682–696. [CrossRef] [PubMed]
Esposito LA Melov S Panov A . Mitochondrial disease in mouse results in increased oxidative stress. Proc Natl Acad Sci U S A. 1999;96(9):4820–4825. [CrossRef] [PubMed]
Brown MD Torroni A Reckord CL Wallace DC . Phylogenetic analysis of Leber's hereditary optic neuropathy mitochondrial DNA's indicates multiple independent occurrences of the common mutations. Hum Mutat. 1995;6(4):311–325. [CrossRef] [PubMed]
Torroni A Lott MT Cabell MF . mtDNA and the origin of Caucasians: identification of ancient Caucasian-specific haplogroups, one of which is prone to a recurrent somatic duplication in the D-loop region. Am J Hum Genet. 1994;55(4):760–776. [PubMed]
Bendall KE Sykes BC . Length heteroplasmy in the first hypervariable segment of the human mtDNA control region. Am J Hum Genet. 1995;57(2):248–256. [PubMed]
Hauswirth WW Clayton DA . Length heterogeneity of a conserved displacement-loop sequence in human mitochondrial DNA. Nucleic Acids Res. 1985;13(22):8093–8104. [CrossRef] [PubMed]
Bendall KE Macaulay VA Sykes BC . Variable levels of a heteroplasmic point mutation in individual hair roots. Am J Hum Genet. 1997;61(6):1303–1308. [CrossRef] [PubMed]
Tiranti V Chariot P Carella F . Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene. Hum Mol Genet. 1995;4(8):1421–1427. [CrossRef] [PubMed]
Parsons TJ Muniec DS Sullivan K . A high observed substitution rate in the human mitochondrial DNA control region. Nat Genet. 1997;15(4):363–368. [CrossRef] [PubMed]
Fan W Waymire KG Narula N . A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science. 2008;319(5865):958–962. [CrossRef] [PubMed]
Bannwarth S Procaccio V Paquis-Flucklinger V . Surveyor Nuclease: a new strategy for a rapid identification of heteroplasmic mitochondrial DNA mutations in patients with respiratory chain defects. Hum Mutat. 2005;25(6):575–582. [CrossRef] [PubMed]
Figure 1.
 
LX-PCR of retinal and blood mtDNA. Representative ethidium bromide–stained gel showing LX-PCR mtDNA from retinas (A) and blood (B) of different AMD and normal subjects. The 16.2-kb product corresponds to the full-length mtDNA genome. The smaller sized LX-PCR products (<16.2 kb and >1.0 kb) represent mtDNA rearrangement/deletions. 18s represents nuclear DNA. (C) A representative gel of the LX-PCR mtDNA of retina, choroid, and blood samples from two AMD individuals (A8 and A9) and retina and choroid samples from one AMD individual (A7). Subject A7: retina R1 and choroid C1; subject A8: retina R2, blood B2, and choroid C2; subject A9: retina R3, blood B3, and choroid (C3). –, the water control; M, marker.
Figure 1.
 
LX-PCR of retinal and blood mtDNA. Representative ethidium bromide–stained gel showing LX-PCR mtDNA from retinas (A) and blood (B) of different AMD and normal subjects. The 16.2-kb product corresponds to the full-length mtDNA genome. The smaller sized LX-PCR products (<16.2 kb and >1.0 kb) represent mtDNA rearrangement/deletions. 18s represents nuclear DNA. (C) A representative gel of the LX-PCR mtDNA of retina, choroid, and blood samples from two AMD individuals (A8 and A9) and retina and choroid samples from one AMD individual (A7). Subject A7: retina R1 and choroid C1; subject A8: retina R2, blood B2, and choroid C2; subject A9: retina R3, blood B3, and choroid (C3). –, the water control; M, marker.
Figure 2.
 
Top: the sequence pattern of AMD subject A13 showing the C12577T(T-I) variant found in the retina, choroid, and blood mtDNA. Bottom: results from screening the blood mtDNA from an additional 271 subjects. There was one AMD subject who also had the C12577T variant. None of the normal subjects had this variant.
Figure 2.
 
Top: the sequence pattern of AMD subject A13 showing the C12577T(T-I) variant found in the retina, choroid, and blood mtDNA. Bottom: results from screening the blood mtDNA from an additional 271 subjects. There was one AMD subject who also had the C12577T variant. None of the normal subjects had this variant.
Figure 3.
 
Sequence pattern of mtDNA in the MT-Dloop shows heteroplasmy at site 16,092 (top) in the right eye retinal tissue, the left eye retinal tissue, and the right eye choroidal tissue of AMD subject A4. Bottom: heteroplasmy site 16,093 in the retinal tissue of normal subject N2.
Figure 3.
 
Sequence pattern of mtDNA in the MT-Dloop shows heteroplasmy at site 16,092 (top) in the right eye retinal tissue, the left eye retinal tissue, and the right eye choroidal tissue of AMD subject A4. Bottom: heteroplasmy site 16,093 in the retinal tissue of normal subject N2.
Figure 4.
 
Low-copy heteroplasmy sites within the MT-ND5B genome. This gel is representative of the genome after nuclease digestion. The 10 bands represent five heteroplasmic sites (top). Bottom: describes the numbers of bands and heteroplasmic sites in the MT-ATP6, MT-ND5A, and MT-CYB genomes.
Figure 4.
 
Low-copy heteroplasmy sites within the MT-ND5B genome. This gel is representative of the genome after nuclease digestion. The 10 bands represent five heteroplasmic sites (top). Bottom: describes the numbers of bands and heteroplasmic sites in the MT-ATP6, MT-ND5A, and MT-CYB genomes.
Table 1.
 
Tissue Demographics
Table 1.
 
Tissue Demographics
Normal Retinas AMD Retinas Blood
Age Sex Race Age Sex Race AMD Level* Age Sex Race
N1 79 M NA A1 64 F C 4 B1 63 F NA
N2 73 F C A2 88 M C 3d B2 74 F NA
N3 76 M C A3 78 F C 4 B3 85 F NA
N4 79 F C A4 78 F C 3d B4 75 F NA
N5 79 M C A5 82 M C 4 B5 90 M NA
N6 88 F C A6 78 F C 4 B6 80 M NA
N7 91 M C A7 93 F C 4 B7 82 F NA
N8 97 F C A8 88 F C 3d B8 73 M NA
N9 60 M B A9 90 M C 4 B9 62 F NA
N10 56 F C A10 83 F C 4 B10 88 M NA
N11 59 M C A11 89 F C 3d
N12 84 F C A12 71 F C 3
N13 85 F C A13 NA M C 4
Table 2.
 
Primers Used in This Study
Table 2.
 
Primers Used in This Study
Name Forward Primer Reverse Primer Size (bp) PCR Annealing Temp. (°C)
LHON 11778G>A GAAGCTTCACCGGCGCAGTCATTCTCA TGGGTGAGTGAGCCCCATTGTGTTGTG 243 58
LHON 3460G>A TCACAAAGCGCCTTCCCCCGTAAATGA TGTGGCGGGTTTTAGGGGCTCTTTGGT 348 60
LHON 14484T>C GCCATCGCTGTAGTATATCCAAAGATAACCA TGGTCGTGGTTGTAGTCCGTGCGAGAA 250 55
MT-Dloop CTAAGCCAATCACTTTATTG GCTGCGTGCTTGATGCTTGT 1640 55
12557 C>T CCCCCATCCTTACCACCCTCGTTAACCCTAA TTCCTACGCCCTCTCAGCCGATGAACA 396 65
LX-PCR TGAGGCCAAATATCATTCTGAGGGGC TTCATCATGCGGAGATGTTGGATGG 16292 68
MT-ND5A CCCCGACATCATTACCGGGTTTTCCTC TTGTGGATGATGGACCCGGAGCACATA 1275 65
MT-ND5B TCATCCGCTTCCACCCCCTAGCAGAAA TGGAGGTAGGATTGGTGCTGTGGGTGA 1269 66
MT-CYTB CACACCCGACCACACCGCTAACAATCA GGTGAGGGGTGGCTTTGGAGTTGCAGT 1715 65
MT-ATP6 TCTTGCACTCATGAGCTGTC GCCAATAATGACGTGAAGTCC 1739 52
Table 3.
 
Numbers of SNPs in Each mtDNA Gene Found in Retina, Choroid, and Blood
Table 3.
 
Numbers of SNPs in Each mtDNA Gene Found in Retina, Choroid, and Blood
Gene Subject A7 Subject A8 Subject A9 Total SNPs Nonsynonymous Changes
MT-Dloop 14 3 16 33 Noncoding
MT-RNR1 0 0 0 0 Noncoding
MT-RNR2 2 0 2 4 Noncoding
MT-ND1 2 0 2 4 0
MT-ND2 3 1 4 8 0
MT-CO1 2 0 3 5 0
MT-CO2 1 0 0 1 0
MT-ATP8 0 0 1 1 0
MT-ATP6 1a 0 0 1 aG8616T [L-F]
MT-CO3 1 0 0 1 0
MT-ND3 2b 0 0 2 bA10398G [T-A]
MT-TR 0 1c 0 1 cA10420C; unreported
MT-ND4 3 0 3 6 0
MT-TL2 0 0 1 1 Noncoding
MT-ND5 3d 0 4e 7 eC12557T [T-I]
dA13780G [I-V]
MT-ND6 1 0 0 1 0
MT-CYB 2f 0 1f 3 f14766T [T-I]
MT-TT 1 0 0 1 Noncoding
Total 38 4 37 80
Table 4.
 
SNP Data
Table 4.
 
SNP Data
A. Number of SNPs Per Person in MT-ATP6, MT-CYB, and MT-ND5 Genes
Decade Total
50 60 70 80 90
Normal subjects (n = 3) (n = 1) (n = 5) (n = 2) (n = 2) (n = 13)
    MT-ATP6 1.7 0 2.2 1.5 1.0 1.3
    MT-CYB 5.5 1.0 4.0 5.0 1.5 3.4
    MT-ND5 5.0 1.0 1.3 1.0 0.5 1.8
AMD subjects (n = 0) (n = 1) (n = 3) (n = 3) (n = 2) (n = 9)
    MT-ATP6 n/a 3.0 0.7 0.3 1.5 1.4
    MT-CYB n/a 5.0 3.3 2.7 2.5 3.4
    MT-ND5 n/a 2.0 3.3 1.3 2.0 2.2
Normal + AMD subjects (n = 3) (n = 2) (n = 8) (n = 5) (n = 4) (n = 22)
    MT-ATP6 1.7 3.0 2.9 1.8 2.5 2.4
    MT-CYB 5.5 6.0 7.3 7.7 4.0 6.1
    MT-ND5 5.0 3.0 4.6 2.3 2.5 3.5
B. Unreported SNPs in Various Mitochondrial Genes
Gene Unreported SNPS Predicted Amino Acid Change Incidence
MT-CO2 8133C>T Thr>Ile 1/9 AMD; 0/12 NL
MT-ATP8 8429C>T Leu>Phe 1/9 AMD; 0/12 NL
MT-ND5 12953C>T Ala>Val 1/9 AMD; 0/12 NL
MT-ND5 13926T>C Pro>Pro 0/9 AMD; 1/12 NL
MT-ND6 14659C>T Leu>Leu 0/9 AMD; 1/12 NL
MT-CYB 14845C>T Phe>Phe 1/9 AMD; 0/12 NL
MT-CYB 15852T>C Ile>Thr 1/9 AMD; 0/12 NL
C. Reported Nonsynonymous SNPs in Various Mitochondrial Genes
Gene Reported SNPS Predicted Amino Acid Change Incidence
MT-ATP8 8519G>A Glu>Lys 1/9 AMD; 0/12 NL
MT-ATP6 8616G>T Leu>F 0/9 AMD; 1/12 NL
MT-ATP6 8701A>G Thr>Ala 1/9 AMD; 0/12 NL
MT-ATP6 8794C>T His>Tyr 1/9 AMD; 0/12 NL
MT-ATP6 8869A>G Met>Val 1/9 AMD; 0/12 NL
MT-ATP6 9055G>A Ala>Thr 1/9 AMD; 1/12 NL
MT-CO3 9477G>A Val>Ile 0/9 AMD; 2/12 NL
MT-ND5 13681A>G Thr>Ala 1/9 AMD; 0/12 NL
MT-ND5 13708G>A Ala>Thr 2/9 AMD; 1/12 NL
MT-ND5 13759G>A Ala>Thr 0/9 AMD; 1/12 NL
MT-ND5 13780A>G Ile>Val 1/9 AMD; 1/12 NL
MT-ND5 13928G>C Ser>Thr 0/9 AMD; 1/12 NL
MT-ND5 13958G>C Gly>Ala 0/9 AMD; 1/12 NL
MT-CYB 14766C>T Thr>Ile 8/9 AMD; 5/11 NL
MT-CYB 14798T>C Phe>Leu 2/9 AMD; 1/11 NL
MT-CYB 14861G>A Ala>Thr 0/9 AMD; 1/11 NL
MT-CYB 15110G>A Ala>Thr 0/9 AMD; 1/11 NL
MT-CYB 15452C>A Leu>Ile 3/9 AMD; 2/11 NL
MT-CYB 15849C>T Thr>Ile 0/9 AMD; 1/11 NL
Table 5.
 
Number of SNPs per Person in MT-Dloop
Table 5.
 
Number of SNPs per Person in MT-Dloop
n Average Age, y (range) SNPs per Individual, Mean ± SEM P
Younger NL vs. Older NL 4 29.8 (19–43) 6.00 ± 1.91 0.95
10 79.9 (52–79) 5.90 ± 0.77
Younger NL vs. Older AMD 4 29.8 (19–43) 6.00 ± 1.91 0.05
8 80.0 (64–93) 9.75 ± 0.75
Younger NL vs. Older NL + AMD 4 29.8 (19–43) 6.00 ± 1.91 0.36
18 80.0 (64–93) 7.61 ± 0.70
Older NL vs. Older AMD 8 79.0 (52–97) 5.90 ± 0.77 0.003
10 80.0 (64–93) 9.75 ± 0.75
Table 6.
 
Description of C Insertions in Retinal mtDNA
Table 6.
 
Description of C Insertions in Retinal mtDNA
A. Sequences 303–309
Reference Sequence CCCCCCCTCCCCC Sequence Variation C7/T/C6
NL
    5/9 CCCCCCCTCCCCC C7/T/C6
    3/9 CCCCCCCCTCCCCCC C8/T/C6
CCCCCCCCCTCCCCC C9/T/C6
    1/9 CCCCCCCCTCCCCCC C8/T/C6
CCCCCCCCCTCCCCCC C9/T/C6
CCCCCCCCCCTCCCCCC C10/T/C6
AMD
    3/7 CCCCCCCTCCCCC C7/T/C6
    2/7 CCCCCCCTCCCCCC C7/T/C6
CCCCCCCCTCCCCCC C8/T/C6
    1/7 CCCCCCCCTCCCCC C8/T/C6
    1/7 CCCCCCCCCTCCCCC C9/T/C6
CCCCCCCCCCTCCCCC C10/T/C6
CCCCCCCCCCCTCCCCC C11/T/C6
B. Sequences 514–523 CA Repeat
Reference Sequence CACACACACA Sequence Variation CA(5)
NL
    2/9 CACACACA CA(4)
    7/9 CACACACACA CA(5)
AMD
    7/7 CACACACACA CA(5)
C. Sequences 568–573 polyC
Reference Sequence CCCCCC Sequence Variation C(6)
NL
    10/10 CCCCCC C(6)
AMD
    6/7 CCCCCC C(6)
    1/7 CCCCCCCC C(8)
CCCCCCCCC C(9)
CCCCCCCCCC C(10)
D. Sequences 16,180–16,195
Reference Sequence AAAACCCCCTCCCCAT Sequence Variation A4/C5/T/C4/AT
NL
    6/12 AAAACCCCCTCCCCAT A4/C5/T/C4/AT
    1/12 AAAACCCCCTCCTCAT A4/C5/T/C2/ T C/AT
    1/12 AAACCCCCCCCCCCAT A3/C11/AT
AAACCCCCCCCCCCCAT A3/C12/AT
AMD
    5/7 AAAACCCCCTCCCCAT A4/C5/T/C4/AT
    1/7 AAAACCCCCCCCCAT A4/C9/AT
AAAACCCCCCCCCCAT A4/C10/AT
AAAACCCCCCCCCCCAT A4/C11/AT
    1/7 AACCCCCCCCCCCCAT A2/C12/AT
AACCCCCCCCCCCCCAT A2/C13/AT
AACCCCCCCCCCCCCCAT A2/C14/AT
Table 7.
 
Description of LHON Mitochondrial Genes
Table 7.
 
Description of LHON Mitochondrial Genes
Gene Mutation Nucleotide Δ Amino Acid Δ Gene Genotypic Frequency of AMD Subjects (n = 58) Genotypic Frequency of Normal Subjects (n = 44)
LHON 11778A G>A R340H MT-ND4 GG = 58 GG = 44
GA = 0 GA = 0
AA = 0 AA = 0
LHON 14484C T>C M64V MT-ND6 TT = 58 TT = 44
TC = 0 TC = 0
CC = o0 CC = 0
LHON 3460A G>A A52T MT-ND1 GG = 58 GG = 44
GA = 0 GA = 0
AA = 0 AA = 0
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×