The Effects of Retinoic Acid on Human Corneal Stromal Keratocytes Cultured In Vitro Under Serum-Free Conditions

Abstract

Purpose.: Retinoic acid (RA) is a metabolite of vitamin A that plays a fundamental role in the development and function of the human eye. The purpose of this study was to investigate the effects of RA on the phenotype of corneal stromal keratocytes maintained in vitro for extended periods under serum-free conditions.

Methods.: Keratocytes isolated from human corneas were cultured up to 21 days in serum-free media supplemented with RA or DMSO vehicle. The effects of RA and of its removal after treatment on cell proliferation and morphology were evaluated. In addition, the expression of keratocyte markers was quantified at the transcriptional and protein levels by quantitative PCR and immunoblotting or ELISA, respectively. Furthermore, the effects of RA on keratocyte migration were tested using scratch assays.

Results.: Keratocytes cultured with RA up to 10 × 10⁻⁶ M showed enhanced proliferation and stratification, and reduced mobility. RA also promoted the expression of keratocyte-characteristic proteoglycans, such as keratocan, lumican, and decorin, and increased the amounts of collagen type-I in culture while significantly reducing the expression of matrix metalloproteases 1, 3, and 9. RA effects were reversible, and cell phenotype reverted to that of control after removal of RA from media.

Conclusions.: Retinoic acid was shown to control the phenotype of human corneal keratocytes cultured in vitro by regulating cell behavior and extracellular matrix composition. These findings contribute to our understanding of corneal stromal biology in health and disease, and may prove useful in optimizing keratocyte cultures for applications in tissue engineering, cell biology, and medicine.

Introduction

Retinoids are biologically active derivatives of vitamin A (retinol) involved in essential physiological processes of the eye. ¹ In the human cornea, active endogenous retinoids, such as the all-trans retinoic acid (RA), are produced through oxidation of retinol in a series of reactions catalyzed by several alcohol and aldehyde dehydrogenases. ² There, RA affects signaling by direct regulation of gene expression through interaction with nuclear retinoic acid receptors (RARs) and control of RAR binding to retinoic acid response element (RARE) sequences from gene promoters, or indirectly, through several other signaling pathways. ³  

The effects of RA deprivation due to lack of retinol in the human eye, and particularly in the cornea, have been extensively described. ^4,5 These include atrophic changes in the normal mucosal surface, replacement of normal epithelia by an inappropriate keratinized stratified squamous epithelium, punctate keratopathy, stromal edema, and, in severe cases, full-thickness liquefactive necrosis of the cornea (keratomalacia). ⁵ However, the molecular mechanisms responsible for these effects are still poorly understood, as is the functional role of RA in the various corneal tissues. 

Here we investigated the effects of RA on human corneal stromal keratocytes cultured in vitro for prolonged periods in serum-free conditions. We found that RA induced a dose-dependent and reversible response, affecting the expression of keratocyte markers and promoting cell proliferation and stratification while reducing cell migration. In view of these findings, we proposed a model in which RA has a relevant biological role in maintaining stromal integrity and homeostasis, and on the onset and progression of corneal diseases. 

Materials and Methods

Reagents

All-trans retinoic acid and other reagents were, unless otherwise noted, purchased from Sigma-Aldrich (St. Louis, MO). RA powder was solubilized in dimethyl sulfoxide (DMSO) to produce a 5 × 10⁻² M (1.5% wt/vol) stock solution, which was sterile-filtered and kept at −80°C for up to 1 month. RA was added to media immediately before use by diluting in DMSO (1:1000 media volume). 

Cell Culture

Human corneal stromal keratocytes were isolated from epithelia-depleted corneal rings from postmortem human eyes, kindly provided by Martin Leyland, MD (Royal Berkshire Hospital, Reading, UK). Briefly, the tissue was shredded using a scalpel, transferred to Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 2 g.L⁻¹ (450 units.mL⁻¹) of collagenase type-I (Invitrogen, Carlsbad, CA) and 5% fetal bovine serum (FBS) (Biosera, Boussens, France), and incubated under rotation for 5 hours at 37°C, followed by incubation with 0.25% Trypsin-EDTA in DMEM for 10 minutes. Isolated keratocytes (passage one) were plated onto standard polystyrene culture plates (Nunc; Thermo Scientific, Waltham, MA) and maintained in growth medium comprising DMEM/F12 media (Invitrogen) supplemented with 5% FBS, 1 × 10⁻³ M ascorbic acid, 1 × ITS liquid media supplement, and 1% penicillin/streptomycin. Medium was replaced every 2 to 3 days. On reaching 70% to 80% confluence, cells were passaged and transferred to growth medium without FBS (serum-free medium [SFM]) to induce quiescence. Passages three to five keratocytes were used in subsequent experiments. 

Proliferation Assays

To evaluate the effects of RA on cell proliferation, 3 × 10⁵ keratocytes were seeded onto 9.6 cm² wells of polystyrene plates in SFM for 24 hours, after which medium was exchanged to freshly prepared SFM containing 0.1 to 50 × 10⁻⁶ M of RA (+RA) or equivalent volume of DMSO vehicle (control), and then replaced every other 3 days (Fig. 1). In another experiment, cells in ±RA conditions were grown with RA-containing medium for the initial 12 days, and then with control SFM for the remaining time in culture (Fig. 1). Cell proliferation was evaluated using the alamarBlue assay. Briefly, cells were imaged in an inverted microscope, and then incubated with resazurin reagent (diluted 1:10 in fresh culture media) for 2 hours at 37°C, after which culture supernatants were sampled (100 μL, in triplicate) for fluorescence emission analysis at 590 nm, and cells replenished with fresh media. The process was performed 1 day after seeding and repeated every 3 days up to day 21. Cell number was calculated by interpolation using a standard curve for the fluorescence values of 1, 5, 10, 20, 50, and 100 × 10⁴ cells. To evaluate viability of the cells detached due to RA deprivation, day 15 cultures were extensively washed through pipetting 2 mL PBS 10 consecutive times. Washed-off keratocytes were sampled in triplicate for quantification using the trypan blue exclusion dye (10-μL aliquots), and the remainder then reseeded into a new 12-well plate. Reattached cells were counted 24 hours postseeding using the alamarBlue assay. Cell number values corresponded to average ± SD of 4 independent experiments. 

Figure 1

 

Schematic diagram of RA treatments. Keratocytes seeded at day 0 were incubated for 1 day in SFM (white), and then grown in SFM containing DMSO vehicle (gray) or 0.1 to 50 × 10⁻⁶ M of RA (yellow arrows) up to day 21 (control or +RA, respectively), or RA until day 12 and vehicle from then on (±RA).

Migration Assays

Effect of RA on keratocyte migration was evaluated using a scratch assay. Briefly, 5 × 10⁵ cells were seeded onto 9.6-cm² wells of polystyrene plates and cultured with SFM for 5 days. On confluence, cell monolayers were scratched with the tip of a 200-μL micropipette to create a cell-free area, and then washed twice with sterile PBS and incubated with freshly prepared SFM containing 0.1 to 10 × 10⁻⁶ M of RA or equivalent volume of DMSO vehicle, which was replaced every 3 days. Five pictures from distinct regions of each scratch were then taken (day 0), and imaging of the same regions repeated every 24 hours afterward, up to day 9, using an inverted microscope coupled with a digital camera (Digital Optic System; Jenoptic AG, Jena, Germany). The cell-free surface area was calculated for each binarized image using the tracing tool from ImageJ v1.46 (National Institutes of Health, Bethesda, MD). Rate of keratocyte migration was evaluated by calculating the ratio between the cell-free area from each day and that of the corresponding initial scratch (day 0). Area values corresponded to average ± SD of three independent experiments. 

Analysis of Keratocyte Gene Expression

Cells growing for 21 days were harvested, and RNA was isolated by standard Trizol (Invitrogen) extraction. RNA quality was assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific) to ensure the 260/280 ratio was within the range 1.7 to 2.0. Synthesis of cDNA from isolated total RNA was performed using the Maxima First cDNA Synthesis kit (Thermo Scientific) according to the manufacturer's instructions, in a TcPlus thermocycler (Techne, Staffordshire, UK). Quantitative PCR (qPCR) was performed using the default thermal profile of the Eco Real-Time PCR System (Illumina, San Diego, CA), with the following 40× three-step cycle: 10-second denaturation, 95°C; 30-second annealing, 60°C; 15-second elongation, 72°C. The relative expression of keratocyte genes coding for keratocan, lumican, decorin, aldehyde dehydrogenase 1 A1 (ALDH1), α-smooth muscle actin (αSMA), and matrix metalloproteases (MMP) 1 and 3 (primers against KERA, forward: 5′-TATTCCTGGAAGGCAAGGTG-3′, reverse: 5′-ACCTGCCTCACACTTCTAGACC-3′; LUM, forward: CCTGGTTGAGCTGGATCTGT, reverse: TAGGATAATGGCCCCAGGA; DCN, forward: GGCAAATTCCCGGATTAAA, reverse: CAGGAAACTTGTGCAAGCAG; ALDH1, forward: CTCTCACTGCTCTCCACGTG, reverse: GAGAAGAAATGGCTGCCCCT; ACTA2, forward: CTGAGCGTGGCTATTCCTTC, reverse: TTCTCAAGGGAGGATGAGGA; MMP1, forward: AGGTCTCTGAGGGTCAAGCA, reverse: CTGGTTGAAAAGCATGAGCA; and MMP3, forward: TGCTTTGTCCTTTGATGCTG, reverse: AAGCTTCCTGAGGGATTTGC, respectively) was calculated by the comparative threshold cycle (CT) (Eco Software v3.1; Illumina) and normalized to the expression of the POLR2A housekeeping gene (forward: CATCATCCGAGACAATGGTG, reverse: AACAATGTCCCCATCACACA). Results from three independent experiments were normalized relative to the expression from keratocytes grown with control media. The occurrence of RARE sequences in the promoter regions of the genes under analysis was investigated using the Ensembl Genome Browser (ensembl.org) and the Basic Local Alignment Search Tool (BLAST; National Center for Biotechnology Information, Bethesda, MD). 

Analysis of Keratocyte Protein Expression

The expression of proteoglycans keratocan, lumican, and decorin; ALDH1 crystallin; MMP1 and MMP9 proteases; and αSMA was analyzed from day 21 keratocyte lysates using ice-cold RIPA lysis buffer supplemented with Protease Inhibitors Cocktail (Roche, Basel, Switzerland) for 10 minutes. Keratocytes grown for 7 days in serum-containing medium (+FBS) were used as αSMA expression control. After precipitation with 4× volumes of ethanol and pellet resuspension in sample buffer, lysates were run by reducing SDS-PAGE using 10% Mini-Protean precast gels (Bio-Rad, Hercules, CA) and blotted onto polyvinylidene fluoride (PVDF; Thermo Scientific). Membranes were then blocked in PBS supplemented with 5% bovine serum albumin (BSA) and 0.1% Tween 20, and incubated with primary antibodies against keratocan (sc-66941; Santa Cruz Biotechnology, Santa Cruz, CA), lumican (kindly given by Dr Bruce Caterson, Cardiff School of Biosciences, Cardiff, UK), decorin (PC673, CalBiochem; Millipore, Billerica, MA), ALDH1, MMP1, MMP9 (ab23375, EP1247Y, EP1254, respectively, Abcam, Cambridge, UK) and αSMA (VP-S281, Vector Labs, Peterborough, UK) diluted 1:500 in blocking solution, followed by corresponding horseradish peroxidase–conjugated secondary antibodies. Mouse anti-GAPDH antibody (ab9484, Abcam) was used for protein loading normalization. Quantification was performed by densitometry analysis of imaged bands using ImageJ v1.46. The expression of collagen type-I was evaluated using the Human CI ELISA kit (ref. M036007; MD Bioproducts, Zurich, Switzerland) according to the manufacturer's protocol. Results from three independent experiments were normalized relative to the expression from keratocytes grown with control media. 

Immunofluorescence Microscopy

Cells cultured for 21 days were fixed in 4% (vol/vol) paraformaldehyde for 20 minutes, washed twice with PBS for 5 minutes, blocked for 1 hour in PBS supplemented with 2% goat serum and 2% BSA, incubated with anti-keratocan, anti-ALDH1, anti-αSMA, and anti-MMP1 antibodies (same as used for Western blotting) in blocking solution (1:1000) for 2 hours, washed three times with PBS for 5 minutes, and incubated with 1:1000 Alexa 594-conjugated phalloidin (A12381; Invitrogen) and fluorescein-labeled goat anti-rabbit IgG antibody (FI-1000; Vector Labs) for an additional hour. Cells were mounted in VectaShield mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI) (Vector Labs) to label cell nuclei and imaged using a Axio upright epifluorescence microscope (Zeiss, Jena, Germany) coupled with a digital video camera (CoolSnap; RS Photometrics, Tucson, AZ), or a Leica TCS SP2 confocal microscope (Leica Microsystems, Wetzlar, Germany). Brightness and contrast were maintained in the triplicate micrographs from two independent experiments. 

Data Analysis and Statistics

Error bars represent the SD of the mean. Differences between groups were determined using one- or two-way ANOVA with Bonferroni's multiple comparisons post hoc test. Significance between groups was established for P less than 0.05, 0.01, and 0.001. 

Results

Effects of RA on the Proliferation of Keratocytes From Human Corneal Stroma

In this work, we tested the effects of increasing concentrations of RA on the proliferation of human keratocytes maintained in serum-free conditions. For that, cells were maintained in culture with SFM containing 0.1 to 50 × 10⁻⁶ M of RA (+RA) or the equivalent volume of DMSO vehicle (control) for 21 days (Fig. 1). Results showed that RA significantly increased cell numbers relative to the control throughout the entire period in culture (Fig. 2). This effect was shown to be dose-dependent, with maximal effect observed for 10 × 10⁻⁶ M RA (Fig. 2). In contrast, 50 × 10⁻⁶ M RA was toxic to keratocytes, and immediately impaired cell proliferation and induced cell death (Fig. 2). 

Figure 2

 

Effects of increasing concentrations of RA on keratocyte proliferation. Cells were grown with SFM containing DMSO vehicle (control, 0 M) or 0.1 to 50 × 10⁻⁶ M of RA up to day 21. Quantification was performed using the alamarBlue assay, and cell numbers were normalized as a percentage of the cells initially seeded. Data (mean ± SD) were obtained from four independent experiments (n = 4) and compared using ANOVA with Bonferroni's post hoc correction (* and *** corresponded to P < 0.05, and 0.001, respectively).

To test if the effects of RA on cell proliferation were reversible, keratocytes were maintained in RA-containing medium up to day 12 and then in control conditions for the remainder of the experiment (±RA, Fig. 1). As such, ±RA keratocytes duplicated those in +RA up to day 12 and of control conditions from then on. Results showed that, 6 days after removal of RA from media, cell numbers were significantly lower when compared with +RA conditions, and equivalent to those of control (Fig. 3A). Moreover, RA removal corresponded to a 25% reduction in cell number from ±RA at day 18 compared with that of day 12. This effect was not due to impaired viability of ±RA cultures, as cells continued proliferating at later days, although never attaining the numbers of +RA cultures (Supplementary Fig. S1). 

Figure 3

 

Effect of RA removal from media after RA 11-day treatment. (a) Proliferation of keratocytes grown in SFM containing DMSO vehicle (control) or 10 × 10⁻⁶ M RA up to day 21 (+RA) or day 12 (±RA). Quantification was performed using the alamarBlue assay, and cell numbers were normalized as a percentage of the cells initially seeded. Data (mean ± SD) were obtained from four independent experiments (n = 4) and compared using ANOVA with Bonferroni's post hoc correction (*** corresponded to P < 0.001). (b) Phase-contrast micrographs (upper) and fluorescence confocal microscopy z-stacks (lower) of keratocyte cultures in all three different conditions at day 15. Scale bars: 200 μm (phase-contrast), 20 μm (fluorescence microscopy).

When observed by phase-contrast or fluorescence confocal microscopy at day 15, keratocytes maintained in the various conditions showed to be differently organized. Cells maintained in control SFM formed a uniform confluent monolayer, whereas RA induced keratocyte stratification (Fig. 3B). On the other hand, ±RA cultures contained many round-shaped cells with dendritic projection on top of a confluent monolayer similar to that of control conditions (Fig. 3B, upper panel). When closely observed, the round keratocytes showed to be loosely attached to, or progressively detaching from the underlying cell monolayer. When dislodged by extensive washing, these cells were shown to be mostly viable and able to grow after reseeding onto new tissue culture plates (Supplementary Fig. S2). Taken together, these results suggest that RA increased keratocyte proliferation while inducing cell stratification. On removal of RA from the medium, this effect was rapidly lost and stratified keratocytes, albeit viable, started to detach and be released to the culture supernatant, leaving the underlying monolayer intact (Fig. 3B, lower panel). 

Effects of RA on the Expression of Keratocyte Markers

To examine the effects of +RA and ±RA conditions on the molecular phenotype of keratocytes after 21 days in SFM culture, several keratocyte markers were analyzed at the transcript level and compared with the control (Fig. 4). Results showed that +RA treatment significantly increased transcription of genes coding for keratocan (KERA), lumican (LUM), and decorin (DCN) by 26.0 ± 14.0-, 5.0 ± 2.9-, and 7.4 ± 2.7-fold, respectively (Fig. 4). Despite this strong upregulation, no RARE sequences were found in the promoter regions of these genes. In addition, transcription of gene coding for ALDH1A1 crystallin (ALDH1) was 3.0 ± 1.2-fold increased. On the other hand, genes coding for two keratocyte matrix metalloproteases, MMP1 and MMP3 were downregulated to 3% ± 1% and 14% ± 10% of the control, respectively (Fig. 4). No significant differences were observed for transcripts of ACTA2, the gene coding for αSMA. In contrast, ±RA keratocytes showed profiles of transcript expression similar to the control (Fig. 4), indicating that, 9 days after RA removal from the medium, the expression of keratocyte markers reverted to that of control cells. 

Figure 4

 

Expression of keratocyte markers at the transcriptional level. Total mRNA from cells cultured for 21 days in control (white), +RA (yellow), and ±RA conditions (gray bars) was extracted and analyzed by qPCR. Gene expression was normalized relative to that of control cells. Data (mean ± SD) were obtained from three independent experiments (n = 3) and compared using ANOVA with Bonferroni's post hoc correction (*, **, and *** corresponded to P < 0.05, 0.01, and 0.001, respectively).

Furthermore, these data were supported by protein expression levels analyzed by densitometry, with +RA cells showing fold-increased expression for keratocan (6.5 ± 2.7), lumican (2.1 ± 0.1), decorin (3.6 ± 1.7), and ALDH1 (3.2 ± 1.8) relative to the SFM control (Figs. 5A, 5B). The proteoglycan keratocan, in particular, was observed throughout cells and surrounding areas with +RA, whereas its distribution in control conditions was mostly perinuclear (Fig. 6). On the other hand, the localization of ALDH1 was not substantially modified by RA treatments, despite its stronger detection (Fig. 6). In addition, the ELISA analysis showed that +RA keratocytes increased collagen type-I expression by 1.9 ± 0.2 compared with the control (Fig. 5C). On the other hand, the expression of MMP1 and MMP9 in +RA conditions was significantly reduced to 7.0% ± 5.9% and 12.0% ± 5.3% of control levels, respectively (Fig. 5D), and could not be observed by immunofluorescence microscopy (Fig. 6). Similar to that observed for the transcript expression profiles, protein markers from ±RA cells reverted to those of control conditions (Figs. 5, 6). In addition, αSMA levels were not affected by RA treatment, and remained residual compared with the levels of FBS-activated keratocytes (+FBS) (Fig. 5E). Accordingly, no substantial expression of αSMA was detected by immunofluorescence microscopy in cells maintained in SFM, independently of RA supplementation (Fig. 6). 

Figure 5

 

Expression of keratocyte markers at the protein level. (a) Lysates from FBS-activated keratocytes (+FBS) and from cells grown in SFM with DMSO vehicle (control, Ctl) or 10 × 10⁻⁶ M RA up to day 21 (+RA) or day 12 (±RA) were extracted at day 21 and analyzed by reducing SDS-PAGE followed by immunoblotting. (b–e) Quantification of protein expression from control (white), +RA (yellow), ±RA (gray), and activated keratocytes (+FBS, black bars) was performed by immunoblot densitometry for all markers except collagen type-I, which was calculated by ELISA. Protein expression was normalized relatively to that of control cells. Data (mean ± SD) were obtained from three independent experiments (n = 3) and compared using ANOVA with Bonferroni's post hoc correction (*, **, and *** corresponded to P < 0.05, 0.01, and 0.001, respectively).

Figure 6

 

Effect of RA treatments on the expression of protein markers. Keratocan, ALDH1, αSMA, and MMP1 epitopes from keratocytes in control, +RA, and ±RA conditions were detected by immunofluorescence (green) after 21 days in culture. Nuclei were stained with DAPI (blue). Micrographs correspond to representative images from two independent assays. Scale bars: 50 μm.

Effects of RA on Keratocyte Migration

The effect of RA on keratocyte migration was evaluated using scratch assays. Confluent keratocyte monolayers were tip-scratched and incubated with SFM containing 0.1 to 10 × 10⁻⁶ M of RA or DMSO vehicle (control) (Fig. 7). The cell-free surface area was evaluated immediately after scratching (day 0) and then daily, up to the complete close of the wound. Results showed a direct correlation between RA concentration and size of the scratch along the entire period in culture (Fig. 7A). Starting at day 1, a significant delay in the closing rate was observed for keratocyte cultures treated with 1 to 10 × 10⁻⁶ M of RA compared with the control, with a maximum delay and latest scratch close (day 9) for the highest RA concentration (Fig. 7B). These results indicate that RA impaired keratocyte migration in a dose-dependent manner. This effect cannot be attributed to a decrease in cell numbers, as it was previously shown that RA at this concentration range increased keratocyte proliferation (Fig. 2). Taken together, these results indicate that RA affects keratocyte migration through a mechanism independent of that regulating cell proliferation. 

Figure 7

 

Effect of RA on keratocyte migration. (a) Phase-contrast micrographs from keratocyte monolayers maintained in control (0 M) and 0.1 to 10 × 10⁻⁶ M of RA immediately after scratch (day 0) and during wound closing. (b) Quantification of cell-free surface area as a rate of wound close during time. Values were normalized as percentage of initial scratch area. Data (mean ± SD) were obtained from three independent experiments (n = 3) and compared using ANOVA with Bonferroni's post hoc correction (* and *** corresponded to P < 0.05, and 0.001, respectively).

Discussion

All-trans retinoic acid (RA) was previously reported as playing a major role in mesenchyme and corneal morphogenesis, ⁶ as well as in proliferation and differentiation of the ocular surface epithelium. ⁷ But to our knowledge, this is the first study focusing on the effects of RA on human corneal stromal keratocytes cultured in vitro in serum-free conditions. We showed that, at a concentration range of 1 to 10 × 10⁻⁶ M, RA promoted keratocyte proliferation and stratification while reducing cell motility. A similar enhancement of cell proliferation was previously described for rabbit corneal fibroblasts, where 1 × 10⁻⁶ M of RA was shown to increase ³H-thymidine incorporation up to 114.7% above control cultures. ⁸ On the other hand, RA at 50 × 10⁻⁶ M was toxic to keratocytes. 

Importantly, the presence of RA at 10 × 10⁻⁶ M in serum-free cultures induced a significant increase in the production of several stromal extracellular matrix (ECM) components, such as collagen type-I and keratocyte-characteristic proteoglycans keratocan, lumican, and decorin. These results demonstrate that, as in rabbits, ⁹ human corneal stromal keratocytes alter their ECM biosynthesis in response to RA. As no RARE sequences were found in the promoter regions of the genes coding for these molecular markers, these effects are probably mediated by RA through indirect mechanisms. ³ Together, these findings indicate that RA at low concentrations is a useful supplement for long-term in vitro culture of keratocytes in serum-free conditions, a notion supported by previous work using human corneas in organ culture. ¹⁰ On the other hand, the expression of MMP1 (i.e., interstitial collagenase), MMP3 (i.e., stromelysin-1), and MMP9 (i.e., gelatinase-B) proteases was significantly reduced by RA treatments at both the transcriptional and protein levels. Similar observations have been previously reported for primary and short-term cultured rabbit keratocytes ¹¹ and human fibroblasts. ¹² Moreover, we showed that removal of RA from the medium induced the reversal of these effects. Although RA removal did not compromise the viability of the culture, detachment of the stratified cells was observed along with a reduction in keratocyte numbers. We proposed that this detachment was driven by the enhanced expression of MMPs, previously abrogated in the presence of RA. Increased MMP proteolytic activity resulting from the removal of RA from the medium would then promote the cleavage of ECM components, thus eliminating the substrates maintaining the attachment of stratified cells (Fig. 8). This mechanism would also involve differential expression of integrins typically expressed by keratocytes, and consequently the ability of these cells to attach to their surrounding ECM. This hypothesis was supported by previous studies showing that RA at 1 × 10⁻⁷ M directly induces the expression of αVβ1 and αVβ3 integrins in fibroblasts. ^13,14 As such, our results suggested that RA acts as a growth factor in the human corneal stroma by controlling keratocyte behavior and regulating the expression and degradation of ECM components. 

Figure 8

 

Proposed model for the role of RA as a growth factor for tissue engineering and in corneal stroma homeostasis and disease.

RA and retinol deficiency have been shown to have a striking impact in the structure and function of the cornea, and are responsible for the onset and progression of diseases affecting this organ, such as xerophtalmia ⁴ and keratoconus. ¹⁵ Surprisingly, although stromal disorganization and thinning are common hallmarks of these pathologies, ^5,16 few studies focus on the role of RA or retinol on keratocyte biology. Several mechanisms have been proposed for the pathophysiology of these diseases, namely based on changes in the expression of MMPs and corresponding tissue inhibitors of metalloproteases (TIMPs) ¹⁷ or increase of oxidative stress. ¹⁶ Here, we propose a mechanism where endogenous RA directly regulates the various biochemical and molecular pathways involved in these diseases (Fig. 8). The effects of RA in the expression of MMPs and scleral ECM components shown in this and in previous studies ^11,18 support its role in maintaining the proper phenotype of keratocytes. On the other hand, RA was shown to prevent the generation of free-radical–induced oxidative injury and apoptosis in corneal endothelial cells. ¹⁹ Furthermore, RA has been successfully tested as an antioxidant in scavenging assays against nitric oxide, lipid peroxide, and hydroxyl and superoxide radicals in mice. ²⁰ As such, and according to our proposed mechanism, the absence of RA would compromise keratocyte homeostasis, free-radical scavenger generation, and ECM turnover and maintenance. Ultimately, a chronic deprivation of RA in the cornea would result in increased MMP activity, which would then affect the integrity of stromal lamellae and result in corneal degeneration and disease (Fig. 8). Interestingly, a very similar mechanism has been described for the effect of retinoids in human skin in vivo, where RA inhibits UV light-induced, MAP kinase-mediated MMP activation, and consequently, skin degradation. ²¹ Furthermore, our model would explain why topical application of retinoids lack efficacy in treating ocular surface diseases, ²² as lipophilic RA molecules applied topically to the cornea would be unable to reach keratocytes and the interior of the stroma. This, together with the inhibitory effects of RA on androgens, ²³ may contribute to the high variability of patient response to these treatments. ²⁴  

In summary, we have shown that RA enhanced keratocyte proliferation and stratification, and modulated the expression of keratocyte ECM components when used during extended culture periods in serum-free conditions. Along with the evident contribution to the development of better-suited serum-free media formulation for in vitro culture of these cells, the present findings suggested a model for the function of RA in healthy and diseased human corneal tissue. 

Supplementary Materials

pdf S1 

Acknowledgments

Supported by Biotechnology and Biological Sciences Research Council (United Kingdom) Grant BB/I008187/1. 

Disclosure: R.M. Gouveia, None; C.J. Connon, None