August 2010
Volume 51, Issue 8
Free
Retinal Cell Biology  |   August 2010
Gene Expression Profile of Hyperoxic and Hypoxic Retinas in a Mouse Model of Oxygen-Induced Retinopathy
Author Affiliations & Notes
  • Keijiro Ishikawa
    From the Departments of Ophthalmology and
  • Shigeo Yoshida
    From the Departments of Ophthalmology and
    the Fukuoka University Chikushi Hospital, Fukuoka, Japan; and
  • Koji Kadota
    the Agricultural Bioinformatics Research Unit, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan.
  • Takanori Nakamura
    The Research Support Center, Kyushu University Graduate School of Medical Sciences, Fukuoka, Japan;
  • Hiroaki Niiro
    Medicine and Biosystemic Science, and
  • Satoshi Arakawa
    From the Departments of Ophthalmology and
  • Ayako Yoshida
    From the Departments of Ophthalmology and
  • Koichi Akashi
    Medicine and Biosystemic Science, and
  • Tatsuro Ishibashi
    From the Departments of Ophthalmology and
  • Corresponding author: Shigeo Yoshida, Department of Ophthalmology, Kyushu University Graduate School of Medical Sciences, Fukuoka, 812-8582, Japan; yosida@eye.med.kyushu-u.ac.jp
Investigative Ophthalmology & Visual Science August 2010, Vol.51, 4307-4319. doi:10.1167/iovs.09-4605
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Keijiro Ishikawa, Shigeo Yoshida, Koji Kadota, Takanori Nakamura, Hiroaki Niiro, Satoshi Arakawa, Ayako Yoshida, Koichi Akashi, Tatsuro Ishibashi; Gene Expression Profile of Hyperoxic and Hypoxic Retinas in a Mouse Model of Oxygen-Induced Retinopathy. Invest. Ophthalmol. Vis. Sci. 2010;51(8):4307-4319. doi: 10.1167/iovs.09-4605.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To determine a profile of gene expression in retinas of a murine model of oxygen-induced retinopathy (OIR).

Methods.: OIR was induced in C57BL/6N mice by exposing postnatal day (P)7 pups to 75% oxygen for 5 days and then returning them to room air at P12. Gene microarrays containing more than 47,000 transcripts were used to study the changes in gene expression in retinas isolated immediately (P12) and at 12 hours (P12.5) after exposure to hyperoxia. The retinas of P12 mice raised under normoxic conditions served as control subjects. Quantitative RT-PCR and multiplex ELISA were performed to validate the microarray analyses.

Results.: The expression of 83 gene transcripts was significantly altered in the hyperoxic P12 retinas. These genes were classified as cellular components or were associated with development, metabolism, transport, stress response, cell adhesion, inflammation, or vision. The genes related to retinal growth, such as Pdgfb and Robo4, which are associated with vascular development, were downregulated. In contrast, the expression levels of 95 genes were significantly altered in the hypoxic P12.5 retinas, which contained several known hypoxia-regulated genes including Vegfa and Hif1a. The differentially expressed genes were broadly clustered into the development, inflammation, metabolism, signaling, antiapoptosis, cellular component, transport, glycolysis, and vision groups. Those associated with organogenesis (e.g., Vegfa, Igfbp3, Tnfrsf12a, and Nestin) and to inflammation (e.g., Ccl3, Ccl4, and MHCs) were upregulated. The results of quantitative RT-PCR and multiplex ELISA were in agreement with the microarray data.

Conclusions.: These alterations in gene expression may determine the hyperoxic growth retardation, postischemic inflammation, neovascularization, and remodeling in retinas of murine OIR.

Retinal ischemia is an important intermediate step in the pathogenesis of many retinal neovascular diseases, such as diabetic retinopathy, retinopathy of prematurity, and retinal vein occlusion. The ischemia is followed by vascular dysfunction resulting in retinal neovascularization, which can lead to irreversible damage to visual function. The ischemia-induced mediators of angiogenesis have been determined in well-established murine models of oxygen-induced retinopathy (OIR). Using this model, researchers have shown that vascular endothelial growth factor (VEGF) is a major oxygen-regulated mediator of angiogenesis. 1 Other angiogenic factors, such as angiopoietin-2, 2 hypoxia inducible factor-1α, 3 and NAD(P)H oxidase, 4 have been reported to be also induced by retinal ischemia in this model. 
We have demonstrated that the transcription nuclear factor-κB, 5,6 macrophage inflammatory protein (MIP)-1α, monocyte chemoattractant protein (MCP)-1, 7 and interleukin (IL)-8 8 were induced in ischemic retinas, and these factors may be associated with retinal neovascularization. 911  
Earlier conventional studies investigating the molecular effects of ischemia on the retina have focused mainly on one or a few molecules or pathways. Therefore, the molecular events taking place in ischemic retinas that may lead to retinal neovascularization remain undetermined. 
The advent of microarray technology, with its capacity to monitor the expression of thousands of genes simultaneously, has made it possible to determine a comprehensive pattern of gene expression in a specific tissue. 12,13 Thus, Sato et al. 14 determined the gene expression profile in murine OIR by microarray-based gene profiling (GeneChip; Affymetrix, Santa Clara, CA). They focused only on a selected set of 94 genes related to inflammation and angiogenesis by performing RT-PCR with a low-density array (TLDA; TaqMan, Applied Biosystems, Inc. [ABI], Foster City, CA) selected from 1304 genes extracted by comparing single DNA microarray hybridization between retinas obtained from murine OIR and controls. 
Because their study focused only on genes related to inflammation and angiogenesis, we hypothesized that microarray analyses of the same murine model of OIR would reveal a new functional set of genes. To test this hypothesis, we applied microarray analyses in murine retinas subjected to OIR, with DNA microarray technology (Illumina, San Diego, CA). Plausible molecular signatures associated with retinal ischemia in murine OIR are discussed. 
Materials and Methods
Murine Model of OIR
All experimental procedures on the animals were performed according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 
OIR was induced in C57BL/6N mice by the protocol described by Smith et al. 15 Briefly, litters of 7-day-old (postnatal day [P]7) C57BL/6N pups along with their mothers were placed in a 75% ± 2% oxygen atmosphere for 5 days and then returned to room air at age P12. 6 The mice were killed by cervical dislocation, and the eyes were enucleated. Whole retinas free of vitreous were isolated from the mice immediately (P12), at 12 hours (P12.5), and at 1 day (P13) after exposure to hyperoxia. Pups raised under normoxic conditions were killed at P12 as control subjects. All samples were stored at −80°C until they were used. 
To isolate sufficient total RNA for labeling protocols, the two retinas from one mouse were pooled. For enzyme-linked immunosorbent assays, the four retinas from two mice raised under the same conditions were pooled. To minimize false positives due to biological variations, the results of three experiments for each condition (biological replicates) were used for the statistical analyses. 
RNA Isolation
To extract the RNA, retinas isolated from normal P12 and hyperoxia-exposed P12 and P12.5 mice were homogenized (Polytron; Kinematica GmbH, Luzern, Switzerland) in extraction reagent (TRIzol; Invitrogen-Life Technologies, Carlsbad, CA), extracted with chloroform, and the aqueous phase was precipitated in isopropanol. The pellet was washed with 75% ethanol, dissolved in water, and frozen at −80°C. The concentration and quality of the RNA were assessed by spectroscopy (ND-1000 spectrophotometer; NanoDrop Technologies, Wilmington, DE), and the integrity of the RNA was assessed by electrophoresis. 16,17  
Microarray Analyses
We used a mouse microarray (Sentrix BeadChip Array Mouse-6; Illumina), which allowed us to assay more than 47,000 transcripts, largely on the MEEBO (Mouse Exonic Evidence Based Oligonucleotide; http://waterdragon.stanford.edu/alizadehlab/credits.html) set and supplemented with more than 11,000 probes for additional targets from RIKEN FANTOM2 (http://fantom2.gsc.riken.jp/db/ provided in the public domain by Riken Bioresource Center) 18 and the National Center for Biotechnology Information (NCBI; Bethesda, MD) Reference Sequence (RefSeq) database. The cRNA preparation and array hybridization were performed with a microarray technique (Illumina). 
A total of 250 ng of isolated total RNA was converted to biotinylated-cRNA according to the manufacturer's procedures (Illumina TotalPrep RNA Amplification Kit; Ambion, Austin, TX). Briefly, reverse transcription to synthesize first-strand cDNA was performed for 2 hours at 42°C, primed with an oligo (dT) primer bearing a T7 promoter, and catalyzed by reverse transcriptase (ArrayScript; Ambion). Second strand cDNA was synthesized by adding DNA polymerase I, and RNase H, and incubated for 2 hours at 16°C. After cDNA purification, the eluted cDNA was used for in vitro transcription with T7 RNA polymerase. In vitro transcription was performed at 37°C for 14 hours, yielding multiple copies of biotinylated antisense RNA molecules from each mRNA in the sample. The measurement of the cRNA yield was determined spectrophotometer (ND 1000; NanoDrop). 
A total of 1500 ng of biotin-cRNA from each sample was loaded on an individual array spot on the mouse microarray (Mouse-WG6 BeadChip; Illumina), according to the hybridization protocol. The chips were hybridized at 58°C for 19 hours, washed, fluorescently labeled, and scanned in the array reader (BeadArray Reader; Illumina). Raw gene expression data were summarized using the accompanying software (Bead Studio; Illumina). The microarray datasets have been submitted to the GEO database under the identifier GSE19886 (www.ncbi.nlm.nih.gov/geo/ provided in the public domain by NCBI). 
Normalization (quantile method), calculation of signal intensities, and the change ratio analyses between groups were performed (Genespring ver., 7.3; Agilent Technologies, Santa Clara, CA). Three experimental replicates were hybridized independently resulting in three microarray replicates for each condition. The ratios of the average signal intensity were then calculated for the probesets (hyperoxic P12 retina relative to control normoxic P12 retina, hypoxic P12.5 retina relative to hyperoxic P12 retina, and hypoxic P12.5 retina relative to control normoxic P12 retina). If the signals were low, these probesets are reported as having a detection score of less than 0.99 (based on Bead Studio; Illumina) in all microarrays. For each condition, the probesets with the signals considered to be absent were removed. The filtered datasets were subsequently subjected to Welch's t-test 19 coupled with multidimensional false-discovery control (FDR2D) 20 (OCplus package from the repository implemented on the R platform; http://www.bioconductor.org/ provided in the public domain by Bioconductor, open source and open development software project for the analysis and comprehension of genomic data). 21  
We compared the number of differentially expressed genes at various FDR levels and determined the cutoff values in order that the number in each group comparison was similar to one another. Consequently, the FDR cutoff values were 5%, 5%, and 7%, respectively, for each of the group comparisons between hyperoxic P12 and control normoxic P12 retinas; hypoxic P12.5 and hyperoxic P12 retinas; and hypoxic P12.5 and control normoxic P12 retinas. 
Functional annotation was performed by Gene Ontology (GO; http://www.geneontology.org/ developed by a consortium and provided in the public domain by The Gene Ontology Project) classifications with GO category obtained through appropriate public databases such as DAVID Bioinformatics Resources (http://david.abcc.ncifcrf.gov/home.jsp/ Database for Annotation, Visualization and Integrated Discovery, provided in the public domain by the National Institute of Allergy and Infectious Diseases). 22,23  
Quantitative Real-Time Reverse Transcription–Polymerase Chain Reaction
Selected genes from the microarray analyses were validated by real-time quantitative RT-PCR (qPCR). The primers used are shown in Table 1. Total RNA was reverse-transcribed with a first-strand cDNA synthesis kit for RT-PCR (Roche Diagnostics, Indianapolis, IN), according to the manufacturer's instructions. For all samples, a 1:50 dilution was used for the qPCR analyses. All samples were stored at −20°C until analyzed. The reverse-transcribed cDNAs were then subjected to qPCR (SYBR Premix Ex Taq; TaKaRa Bio Inc., Otsu, Japan) and thermal cycling (LightCycler; Roche Diagnostics). The reaction conditions were denaturing at 95°C for 10 seconds followed by 40 cycles of denaturing at 95°C for 5 seconds, and annealing and extending at 60°C for 20 seconds. The level of mRNA expression was estimated from the fluorescence intensity relative to β-actin. 
Table 1.
 
Primer Sequences Used for Real-Time RT-PCR
Table 1.
 
Primer Sequences Used for Real-Time RT-PCR
Gene Name Accession No. 5′-Forward Primer Sequence-3′ 5′-Reverse Primer Sequence-3′
Vtn NM_011707 TGTTTGAGCACTTTGCCTTG GATAGCGCTTTCGGCTTCTA
Emcn NM_016885 CCAAAAGTGACGTATCCCAAA TGTTCTGGGAACCTGGTAGC
Cav1 NM_007616 GGCAAATACGTAGACTCCGAG GACCAGGTCAATCTCCTTGG
Ktn NM_008477 TGAAAGATCGGATTGGAACA TTGCTTTCCAGTTGGTTTGT
Selenbp2 NM_009150 TGGATGACCGCTTCCTTTAC CTCTTGGTCCTCCAGCACTT
Arr3 NM_133205 CAGCTTCTCCCAGACCTTTG AGGACACCACCAAGTTGACTC
Peli3 NM_172835 GCATCCTGTCTTGTCCTGGT ATGTGGTGCATGACATCTGG
ABCa8a NM_153145 GGGACACAATGGAGCTGGTA CCCCTTTATGGCTGCAAATA
Gstt1 NM_008185 TGCTCTACCTGGCACACAAG CTGCCAGTGTTTCAGGAGGT
Ccl3 NM_011337 ATGAAGGTCTCCACCACTGC CAAAGGCTGCTGGTTTCAA
Vegfa NM_001025250 GGAGAGCAGAAGTCCCATGA ACTCCAGGGCTTCATCGTTA
Gpi1 NM_008155 GCCAAAGTGAAAGAGTTTGGA ATGGAAAGTCCAATGGCTGA
Igfbp3 NM_008343 CTCACTGCCCTCACTCTGCT AACTTTGTAGCGCTGGCTGT
Nes NM_016701 AGCAGGAGAAGCAGGGTCTA CTGGGAACTTCTTCCAGGTG
Osmr NM_011019 CGACATCAATGGCTCAGAGA CAATGATGCTGAGCAAGACG
H2T23 NM_010398 ACCAACAGAGGGCATACCTG GGTCTCCACAAGCTCCATGT
Cdkn1a NM_007669 CGGTGGAACTTTGACTTCGT TCTGCGCTTGGAGTGATAGA
Muc2 XM_133960 GGCATTGTGTGCCAACCAAAG CCTTGGGCACACAGGAATAAACTG
Tnfrsf12 NM_013749 CAGATCCTCGTGTTGGGATT GCAGAAGTCGCTGTGTGGT
Ccl4 NM_0113652 CTCTGACCCTCCCACTTCCT CTCACTGGGGTTAGCACAGA
β-Actin NM_007393 GATGACCCAGATCATGTTTGA GGAGAGCATAGCCCTCGTAG
Multiplex Enzyme-Linked Immunosorbent Assay
The retinas were isolated from normal P12 and from hyperoxia-exposed P12- and P13 mice. P13 was chosen because it is likely to be the time point at which changes in protein synthesis resulting from transcriptional changes at P12.5 are evident. The retinas were individually immersed in 500 μL tissue protein extraction reagent (T-PER; Pierce, Rockford, IL) containing a proprietary detergent in 25 mM bicine and 150 mM sodium chloride (pH 7.6), supplemented with protease inhibitor cocktail (Halt; Pierce). The mixture was homogenized (Polytron; Kinematica AG) and clarified by centrifuging at 10,000g for 5 minutes. The clarified retinal lysates were then assayed by ELISA. The total protein was determined with a commercial assay (Bio-Rad protein assay reagent kit; Bio-Rad Laboratories, Inc, Hercules, CA). 
To measure the concentrations of KC (CCL8), MCP-1 (CCL2), MCP-5 (CCL12), MIP-1α (CCL3), MIP-2 (CXCL2), RANTES (CCL5), TARC (CCL17), EOTAXIN (CCL11), and SDF-1β (CXCL12), a mouse chemokine array (Searchlight; Pierce Biotechnology) was used, and for MIP-1β, an ELISA kit (R&D Systems, Minneapolis, MN) was used, both according to the manufacturers' instructions. The signals of the chemokine arrays were determined by CCD cameras (model LAS3000; Fujifilm, Tokyo, Japan) by chemiluminescence. The sensitivities of the assays for KC, MCP-1, MCP-5, MIP-1α, MIP-2, RANTES, TARC, EOTAXIN, SDF-1β, and MIP-1β were 6.0, 3.0, 1.6, 3.0, 6.0, 3.0, 6.0, 0.8, and 37.5 pg/mL, respectively. 
Results
Gene Expression Profile by Microarray Analysis
To obtain a differential gene expression profile of the retina to hypoxia, we determined the gene expression profiles in murine OIR to that of retinas obtained from mice raised under normoxic conditions. We extracted genes significantly altered by hyperoxia (hyperoxic P12 retina compared to normoxic P12 retina) and hypoxia (hypoxic P12.5 retinas compared to hyperoxic P12 retinas or to normoxic P12 retinas). We chose P12.5 pups to examine gene expression in the hypoxic retina because earlier studies demonstrated that the degrees of central avascular area and central vasoconstriction were at the maximum between P12 and P13. 14 Scatterplot analysis comparing gene expression levels in two different mice in each group showed an approximately linear distribution of expression levels along the 45° line (Fig. 1), indicating a high degree of reproducibility in the methods, measurements, and analyses. 
Figure 1.
 
Comparison of gene expression levels in two different mice in each group. The level of expression at each point in the scatterplot is determined by comparing the expression level at the x coordinate (one retina) and the expression level of the gene at the y coordinate (another retina). Analysis of expression levels in two independent experiments shows a tight linear distribution along the diagonal. Intragroup comparisons in P12 control (A), P12 hyperoxia (B), and P12.5 hypoxia (C).
Figure 1.
 
Comparison of gene expression levels in two different mice in each group. The level of expression at each point in the scatterplot is determined by comparing the expression level at the x coordinate (one retina) and the expression level of the gene at the y coordinate (another retina). Analysis of expression levels in two independent experiments shows a tight linear distribution along the diagonal. Intragroup comparisons in P12 control (A), P12 hyperoxia (B), and P12.5 hypoxia (C).
A subsequent volcano plot demonstrated that the retinal hypoxia was associated with alterations of specific mRNAs (Fig. 2). Several known hypoxia-induced genes in the retina, including Vegfa, Hif1a, Cdkn1a, Igfbp3, Ccl3, Mt1, and Adm, were differentially expressed, suggesting that our microarray experiments were reliable (Table 2). 
Figure 2.
 
Analysis of gene expression comparing hyperoxic P12 to hypoxic P12.5 retinas. The vertical axis value is the negative log of the P-values from a Welch's t-test, and the horizontal axis value is the log2 change between the two conditions. (•) The genes significantly regulated by comparison between hyperoxic P12 and hypoxic P12.5 retinas.
Figure 2.
 
Analysis of gene expression comparing hyperoxic P12 to hypoxic P12.5 retinas. The vertical axis value is the negative log of the P-values from a Welch's t-test, and the horizontal axis value is the log2 change between the two conditions. (•) The genes significantly regulated by comparison between hyperoxic P12 and hypoxic P12.5 retinas.
Table 2.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Hypoxic P12.5 Retina
Table 2.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Hypoxic P12.5 Retina
Description Gene Symbol RefSeq Change Ratio P
Inflammation
    Chemokine (C-C motif) ligand 4 Ccl4 NM_013652 4.248 0.0002
    Histocompatibility 2, class II antigen A, beta 1 H2-Ab1 NM_207105 3.139 0.0035
    Histocompatibility 2, Q region locus 6 H2-Q6 NM_207648.1 2.431 0.0004
    Histocompatibility 2, T region locus 23 H2-T23 NM_010398 2.356 0.0011
    Histocompatibility 2, Q region locus 8 H2-Q8 NM_023124 2.151 0.0010
    Histocompatibility 2, Q region locus 2 H2-D1 NM_010392 1.955 0.0001
    Histocompatibility 2, K1, Kregion H2-K1 NM_001001892.2 1.820 0.0031
    Chemokine (C-C motif) ligand 3 Ccl3 NM_011337 1.714 0.0061
    Histocompatibility 2, Q region locus 5 H2-Q5 NM_010393 1.638 0.0002
    Linker for activation of T cells family, member 2 isoform a Wbscr5 NM_022964 1.550 0.0007
Development
    Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a NM_013749 3.540 0.0050
    Annexin A2 Anxa2 NM_007585 2.726 0.0063
    p8 protein Nupr1 NM_019738 2.470 0.0188
    Tubulin, beta 6 Tubb6 NM_026473 2.395 0.0055
    Transgelin 2 Tagln2 NM_178598 2.116 0.0004
    Epithelial membrane protein 1 Emp1 NM_010128 2.098 0.0098
    EGL nine homolog 1 Egln1 NM_053207 2.073 0.0146
    Nestin Nes NM_016701 2.046 0.0006
    Insulin-like growth factor binding protein 3 Igfbp3 NM_008343 2.015 0.0063
    Adrenomedullin Adm NM_009627 1.992 0.0044
    RIKEN cDNA 1600014C23 gene 1600014C23Rik XM_128667 1.962 0.0034
    Spectrin beta 1 Spnb1 NM_013675 1.899 0.0025
    Galectin 3 Lgals3 NM_010705 1.889 0.0064
    Vascular endothelial growth factor A isoform 1 Vegfa NM_009505 1.873 0.0200
    Procollagen, type II, alpha 1 Col2a1 NM_031163 1.685 0.0036
    Plexin D1 Plxnd1 XM_149784 1.598 0.0002
    Ephrin A1 Efna1 NM_010107 1.577 0.0004
    Endomucin Emcn NM_016885 1.509 0.0015
    Neuronatin isoform alpha Nnat AK077465 1.361 0.0036
    Calsenilin, presenilin-binding protein, EF hand transcription factor Csen NM_019789 −1.300 0.0003
Antiapoptosis
    Bcl2-associated athanogene 3 Bag3 NM_013863 2.829 0.0003
    Similar to Mucin-5AC Muc5ac XM_133960 2.794 0.0001
    Cyclin-dependent kinase inhibitor 1A (P21) Cdkn1a NM_007669 2.250 0.0014
    Unc-5 homolog B Unc5b NM_029770 1.872 0.0061
Glycolysis
    Hexokinase 2 Hk2 NM_013820 2.273 0.0062
    Phosphofructokinase, platelet Pfkp NM_019703 2.223 0.0202
    Glucose phosphate isomerase 1 Gpi1 NM_008155 1.928 0.0001
Response to hypoxia
    Hypoxia inducible factor 1, alpha subunit Hif1a NM_010431.1 2.219 0.0048
Vision
    Retinitis pigmentosa 1 homolog (human)-like 1 isoform 1 Rp1hl1 XM_484387 −1.468 0.0003
    Guanylate cyclase activator 1B Guca1b NM_146079 −2.020 0.0098
    Arrestin 3, retinal Arr3 NM_133205 −2.494 0.0006
Metabolism
    Carboxyl terminal LIM domain protein 1 Pdlim1 NM_016861 3.059 0.0002
    6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 isoform 1 Pfkfb3 NM_133232 1.922 0.0029
    Ankyrin repeat and SOCS box-containing 16 Asb16 AK038411 1.905 0.0022
    Glutaminase 2 (liver, mitochondrial) Gls2 XM_125928 1.889 0.0041
    Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1–like Fthfsdc1 NM_172308 1.888 0.0023
    Plasminogen activator, tissue Plat NM_008872 1.674 0.0017
    Serine hydroxymethyl transferase 2 (mitochondrial) Shmt2 NM_028230 1.610 0.0006
    PHD zinc finger transcription factor Phf12 NM_174852 1.263 0.0003
    Acyl-CoA thioesterase 7 Bach NM_133348 −1.227 0.0001
    Phospholipase A2, group IVB isoform 1 Pla2g4b XM_355378 −1.279 0.0001
    Hypothetical protein LOC194237 BC057371 NM_177572 −1.305 0.0007
    Calcium/calmodulin-dependent protein kinase kinase 1, alpha Camkk1 NM_018883 −1.321 0.0052
    Mannose phosphate isomerase 1 isoform 1 Mpi1 XM_134931 −1.323 0.0037
    RIKEN cDNA 9630033F20 gene 9630033F20Rik NM_177003 −1.381 0.0006
    Cofactor required for Sp1 transcriptional activation, subunit 2 Crsp2 NM_012005 −1.429 0.0010
    Sushi domain containing 3 Susd3 NM_025491 −1.43 0.0003
    Creatine kinase, mitochondrial 1, ubiquitous Ckmt1 NM_009897 −1.475 0.0001
    Thioesterase, adipose associated Thea NM_025590 −1.481 0.0002
    Mitochondrial ribosomal protein L36 Mrpl36 NM_053163 −1.531 0.0006
    Glutathione S-transferase, theta 1 Gstt1 NM_008185 −1.789 0.0087
    Glutathione S-transferase, theta 3 Gstt3 NM_133994 −1.802 0.0008
Signaling
    Synaptopodin Synpo NM_177340.2 2.475 0.0029
    Metallothionein 1 Mt1 NM_013602 2.383 0.0002
    Sterile alpha motif domain containing 7 Samd7 XM_130828 2.194 0.0019
    Oncostatin M receptor Osmr NM_011019 2.161 0.0001
    Spermatogenesis associated 13 isoform 1 Spata13 XM_147847 1.772 0.0072
    Stanniocalcin 2 Stc2 NM_011491 1.747 0.0025
    Nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta Nfkbib NM_010908 1.585 0.006
    Rhomboid family 1 Rhbdf1 NM_010117 1.387 0.0008
    Similar to connector enhancer of kinase suppressor of Ras 1 Cnksr1 XM_110525 −1.629 0.0031
    Opioid receptor, mu 1 Oprm1 NM_011013 −1.701 0.0012
Cellular component
    Filamin C, gamma isoform 1 1110055E19Rik XM_284175 2.532 0.0002
    H1 histone family, member O, oocyte-specific H1foo NM_138311 1.626 0.0056
    Dystrobrevin alpha isoform 2 Dtna NM_010087 1.609 0.0006
    Vacuolar protein sorting 45 Vps45 NM_013841 −1.282 0.0005
    RAN guanine nucleotide release factor Rangnrf NM_021329 −1.608 0.0013
Transport
    Sideroflexin 5 Sfxn5 NM_178639 −1.289 0.0001
    ATP-binding cassette, sub-family B, member 9 Abcb9 NM_019875 −1.294 0.0001
    ATP-binding cassette, sub-family A (ABC1), member 8a Abca8a NM_153145 −1.852 0.0024
Cell cycle
    Cdk5 and Abl enzyme substrate 2 Cables2 NM_145851 −1.337 0.0008
    Meiosis-specific nuclear structural protein 1 Mns1 NM_008613 −1.493 0.0019
Cell adhesion
    Melanoma cell adhesion molecule Mcam NM_023061 2.017 0.0001
Cell part
    RIKEN cDNA 9230117N10 9230117N10Rik NM_133775 −1.969 0.0053
Unknown
    Nitric oxide synthase 3 antisense Nos3as NM_001002897 1.871 0.0012
    2010204K13Rik 0610010M13Rik AK008437 1.783 0.0022
    Hypothetical protein LOC320706 9830001H06Rik XM_283804 1.758 0.0063
    Complement component 1, q subcomponent, receptor 1 C1qr1 AK077882 1.742 0.0011
    Arrestin domain containing 3 Arrdc3 NM_178917 1.403 0.0022
    Epidermal growth factor receptor pathway substrate 15, related Eps15-rs AK036728 −1.462 0.0065
    Hypothetical protein LOC231296 BC031901 NM_153568 −1.681 0.0011
    RAD52 motif 1 Rad52b NM_025654 −1.880 0.0021
    Pellino 3 6030441F14Rik NM_172835 −2.020 0.0086
    Hypothetical protein LOC67304 3110070M22Rik NM_026084 −2.075 0.0091
    EST EST NM_001039244.2 −2.532 0.0176
Changes in Gene Expression between Hyperoxic and Normoxic Retinas
Eighty-three gene transcripts were significantly altered at the level of gene expression in hyperoxic P12 retinas compared with normoxic P12 retinas (Table 3). In hyperoxic P12 retinas, only eight genes (Selenbp1, Selenbp2, 1700060, C20, Rik, Mrpl15, Cks-1, and Ccl3) were upregulated. In contrast, 81 genes were found to be downregulated. These 75 genes were broadly classified into six categories: cellular components (Emp1, Dmn, Hist1h2af, E030006K04Rik, D11Ertd686e, Tubb6, Hist1h2bk, Slc40a1, Ktn1, Hist1h2bc, Hist1h2bp, Pecam1, Hist1h2bl, Hist1h2bj, C1qr1, Hist1h2bm, Ramp2, Hist1h2bn, Col4a1), development (Gja4, Vwf, Mglap, Cav1, Emcn, Igfbp7, Robo4, Gas7), metabolism (Pdlim1, Pfkfb3, Asb16, Gls2, Fthfsdc1, Plat, Shmt2, Phf12, Bach, Pla2g4b, BC057371, Camkk1, Mpi1, 9630033F20Rik, Crsp2, Susd3, Ckmt1, Thea, Mrpl36, Gstt1, Gstt3), transport (Zfp295, Pltp, Slco1c1, Hspg2, LOC381928, Slco2b1, Aqp1), cell adhesion (MGC68323, Vtn, Cldn5), and vision (Gnat1, Arr3; Table 3; Fig. 3). 
Table 3.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Normoxic P12 Retina
Table 3.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Normoxic P12 Retina
Description Gene Symbol RefSeq Change Ratio P
Cellular component
    Epithelial membrane protein 1 Emp1 NM_010128 −1.312 0.0059
    Desmuslin (Dmn) transcript variant 1 Dmn NM_207663 −1.538 0.0435
    Histone 1 H2af Hist1h2af NM_175661 −1.715 0.0268
    RIKEN cDNA E030006K04 gene E030006K04Rik NM_139206 −1.736 0.0289
    DNA segment Chr 11 ERATO Doi 686 expressed D11Ertd686e XM_110968 −1.742 0.0023
    RIKEN cDNA 2310057H16 gene Tubb6 NM_026473 −1.848 0.0185
    Histone 1 H2bk Hist1h2bk NM_175665 −1.912 0.0072
    Histone 1 H2ag Hist1h2ag NM_178186 −1.938 0.0302
    Solute carrier family 40 (iron-regulated transporter) member 1 Slc40a1 NM_016917 −1.938 0.0457
    Kinectin 1 (Ktn1) mRNA. Ktn1 NM_008477 −2.004 0.0486
    Histone 1 H2bc Hist1h2bc NM_023422 −2.070 0.0180
    Histone 1 H2bp Hist1h2bp NM_178202 −2.188 0.0315
    Platelet/endothelial cell adhesion molecule 1 Pecam1 NM_008816 −2.227 0.0258
    Histone 1 H2bl Hist1h2bl NM_178199 −2.358 0.0369
    Histone 1 H2bj Hist1h2bj NM_178198 −2.375 0.0249
    Complement component 1 q subcomponent receptor 1 Clqr1 NM_010740 −2.387 0.0040
    Histone 1 H2bm Hist1h2bm NM_178200 −2.404 0.0445
    Receptor (calcitonin) activity modifying protein 2 Ramp2 NM_019444 −2.457 0.0174
    Histone 1 H2bn Hist1h2bn NM_178201 −2.551 0.0158
    Procollagen type IV alpha 1 Col4a1 NM_009931 −2.618 0.0447
Development
    Gap junction membrane channel protein alpha 4 Gja4 NM_008120 −1.681 0.0181
    Von Willebrand factor homolog Vwf NM_011708 −2.053 0.0445
    Matrix gamma-carboxyglutamate (gla) protein Mglap NM_008597 −2.128 0.0360
    Caveolin Cav1 NM_007616 −2.128 0.0376
    Endomucin Emcn NM_016885 −2.336 0.0066
    Insulin-like growth factor binding protein 7 Igfbp7 NM_008048 −2.740 0.0334
    Roundabout homolog 4 Robo4 NM_028783 −2.809 0.0027
    Growth arrest specific 7 Gas7 NM_008088 −3.597 0.0039
Metabolism
    Mitochondrial ribosomal protein L15 Mrpl15 AK011775 1.494 0.0302
    Low density lipoprotein-related protein 1B (deleted in tumors) LRP-DIT AK080989 −1.248 0.0046
    Minichromosome maintenance deficient 6 Mcm6 NM_008567 −1.541 0.0107
    Platelet derived growth factor B polypeptide Pdgfb NM_011057 −1.570 0.0166
    Solute carrier family 17 (sodium phosphate) member 1 Slc17a1 NM_009198 −1.623 0.0103
    E26 avian leukemia oncogene 2 3 domain Ets2 NM_011809 −1.745 0.0119
    EGF-like domain 7 Egfl7 NM_198724 −1.825 0.0010
    Epoxide hydrolase 2 cytoplasmic Ephx2 NM_007940 −1.890 0.0312
    EGF latrophilin seven transmembrane domain containing 1 Eltd1 NM_133222 −1.984 0.0025
    Zinc finger protein 306 Zfp307 NM_023685 −2.012 0.0404
    RIKEN cDNA 2310003L22 gene 2310003L22Rik NM_027093 −2.237 0.0374
    Protein tyrosine phosphatase receptor type B Ptprb NM_029928 −2.278 0.0047
    Dual specificity phosphatase 11 (RNA/RNP complex 1–interacting) Dusp11 NM_028099 −2.639 0.0300
Transport
    Zinc finger protein 295 Zfp295 NM_175428 −1.255 0.0013
    Phospholipid transfer protein Pltp NM_011125 −1.764 0.0120
    Solute carrier organic anion transporter family member 1c1 Slco1c1 NM_021471 −1.869 0.0090
    Similar to deleted in malignant brain tumors 1 isoform c precursor LOC381928 XM_355949 −1.980 0.0092
    Perlecan (heparan sulfate proteoglycan 2) Hspg2 NM_008305 −2.033 0.0266
    Solute carrier organic anion transporter family member 2b1 Slco2b1 NM_175316 −2.053 0.0131
    Aquaporin 1 Aqp1 NM_007472 −2.174 0.0165
Stress response
    Selenium binding protein 1 Selenbp1 NM_009150 2.273 0.0166
    Selenium binding protein 2 Selenbp2 NM_019414 2.243 0.0102
    Chemokine-like factor super family 3 Cklfsf3 NM_024217 −1.524 0.0326
    Heat shock 27kDa protein 8 Hspb8 NM_030704 −1.592 0.0389
Cell adhesion
    Similar to glyceraldehyde-3-phosphate dehydrogenase MGC68323 NM_199472 −1.961 0.0482
    Vitronectin Vtn NM_011707 −2.146 0.0165
    Claudin 5 Cldn5 NM_013805 −3.165 0.0154
Inflammation
    Chemokine (C-C motif) ligand 3 Ccl3 NM_011337 1.290 0.0094
    Chemokine (C-X-C motif) ligand 12 Cxcl12 NM_013655 −1.661 0.0174
    Transforming growth factor beta receptor II Tgfbr2 NM_009371 −1.701 0.0022
Vision
    Arrestin 3 retinal Arr3 NM_133205 −2.336 0.0042
    Guanine nucleotide binding protein alpha transducing 1 Gnat1 NM_008140 −3.175 0.0140
Response to oxidative stress
    RIKEN cDNA 2310016C16 gene 2310016C16Rik NM_027127 −1.916 0.0149
Cell part
    RIKEN cDNA 1700093K21 gene 1700093K21Rik NM_026105 1.908 0.0244
Unknown
    RIKEN cDNA 1700060C20 gene 1700060C20Rik XM_149230 1.569 0.0074
    Similar to Cyclin-dependent kinases regulatory subunit 1 Cks-1 XM_123604 1.439 0.0003
    RIKEN cDNA 4930546H06 gene 4930546H06Rik XM_283398 1.352 0.0002
    Pleckstrin homology domain containing, family A member 6 Plekha6 NM_182930 −1.307 0.0091
    RNA exonuclease 4 homolog Rexo4 XM_130184 −1.330 0.0249
    Thrombospondin type I domain 1 Thsd1 NM_019576 −1.370 0.0097
    RIKEN cDNA 4931415C17 gene 2810048G06Rik AK088235 −1.453 0.0130
    Kelch-like 6 Klhl6 NM_183390 −1.466 0.0093
    Hypothetical protein A930010102 A930010102 NM_177799 −1.471 0.0100
    RIKEN cDNA 1700008G05 gene 1700008G05Rik XM_485205 −1.597 0.0068
    RIKEN cDNA 0610041G09 gene Acta2 NM_183274 −1.658 0.0235
    Hypothetical protein E130012K09 E130012K09 NM_174999 −1.894 0.0411
    FERM and PDZ domain containing 1 Frmpd1 XM_204152 −1.949 0.0346
    RIKEN cDNA 1700018O18 gene Mfsd2 XM_131683 −2.033 0.0324
    Solute carrier family 1 (glial high affinity glutamate transporter) member 2 Mfsd2 XM_131683 −2.033 0.0324
    Similar to hypothetical protein LOC381546 XM_355512 −2.208 0.0186
    Arrestin domain containing 3 Arrdc3 NM_178917 −2.268 0.0215
    RIKEN cDNA 1700025K23 gene 1700025K23Rik NM_183254 −2.299 0.0199
    RIKEN cDNA 2310056K19 gene 2310056K19Rik NM_080846 −2.488 0.0108
    Hypothetical AAA ATPase superfamily containing protein 4933439B08Rik AK014074 −2.494 0.0431
    Solute carrier family 38, member 5 Slc38a5 NM_172479 −3.401 0.0122
Figure 3.
 
Distribution of GO terms in genes regulated by hyperoxic retinas. Ontology of genes downregulated by hyperoxia. Seventy-five genes were analyzed.
Figure 3.
 
Distribution of GO terms in genes regulated by hyperoxic retinas. Ontology of genes downregulated by hyperoxia. Seventy-five genes were analyzed.
The main functional category, cellular components, contained many subtypes of histone, the chief protein components of chromatin. The second main category, development, contained genes associated with vascular and neural development, such as Robo4, Egfl7, and Gas7
Changes in Gene Expression between Hypoxic and Hyperoxic Retinas
The expression levels of 95 genes were significantly altered in hypoxic P12.5 retinas compared with hyperoxic P12 retinas (Table 2). Sixty-two genes were found to be upregulated, and 33 transcripts were downregulated. The maximum expression change was found for Ccl4 (4.2-fold increase), and the most downregulated gene was an EST (2.5-fold decrease). 
The upregulated genes in the hypoxic retina were broadly clustered into six functional categories: development (Tnfrsf12a, Anxa2, Nupr1, Tubb6, Tagln2, Emp1, Egln1, Nes, Igfbp3, Adm, 1600014C23Rik, Spnb1, Lgals3, Vegfa, Col2a1, Plxnd1, Efna1, Emcn, and Nnat), inflammation (Ccl4, H2-Ab1, H2-Q6, H2-T23, H2-Q8, H2-D1, H2-K1, Ccl3, H2-Q5, and Wbscr5), metabolism (Pdlim1, Pfkfb3, Asb16, Gls2, Fthfsdc1, Plat, Shmt2, and Phf12), signaling (Synpo, Mt1, Samd7, Osmr, Spata13, Stc2, Nfkbib, and Rhbdf1), antiapoptosis (Bag3, Muc5ac, Cdkn1a, and Unc5b), and glycolysis (Hk2, Pfkp, and Gpi1) (Table 2; Fig. 4). The most clustered category, development, contained genes associated with vasculogenesis and neurogenesis (e.g., Vegfa, Igfbp3, Tnfrsf12a, and Nestin). The genes categorized into inflammation were made up of several kinds of antigen processing and CC chemokines (Ccl3 and Ccl4). In addition, the upregulated genes were categorized into the antiapoptosis and glycolysis groups. 
Figure 4.
 
Distribution of GO terms in genes regulated by hypoxic retinas. Ontology of genes upregulated by hypoxia. Sixty-two genes were analyzed.
Figure 4.
 
Distribution of GO terms in genes regulated by hypoxic retinas. Ontology of genes upregulated by hypoxia. Sixty-two genes were analyzed.
The 32 transcripts that were downregulated included genes related to vision (Rp1hl1, Guca1b, Arr3), transport (Sfxn5, Abcb9, Abca8a), and cell cycle (Cables2, Mns1). 
Changes in Gene Expression between Hypoxic and Normoxic Retinas
The expression levels of 94 genes were significantly altered in hypoxic P12.5 retinas compared to normoxic P12 retinas (Table 4). Fifty-three genes were found to be upregulated, and 41 transcripts were downregulated. The maximum expression change was found for Selenbp1 (4.6-fold increase), and the most downregulated gene was an EST (4.1-fold decrease). 
Table 4.
 
Genes Significantly Altered in Expression between Hypoxic P12.5 Retina and Normoxic P12 Retina
Table 4.
 
Genes Significantly Altered in Expression between Hypoxic P12.5 Retina and Normoxic P12 Retina
Description Gene Symbol RefSeq Change Ratio P
Inflammation
    Histocompatibility 2, class II antigen A, beta 1 H2-Ab1 NM_207105 3.410 0.0004
    Chemokine (C-C motif) ligand 4 Ccl4 NM_013652 2.605 0.0009
    Histocompatibility 2 T region locus 23 H2-T23 NM_010398 2.063 0.0006
    Histocompatibility 2 Q region locus 8 H2-Q8 NM_023124 2.043 0.0002
    Transcription factor E3 Tcfe3 NM_172472 1.263 0.0002
    Chemokine (C-X-C motif) ligand 12 Cxcl12 NM_013655 −1.548 0.0001
Cellular component
    RIKEN cDNA 1190002C06 gene 1190002C06Rik NM_028447 1.554 0.0007
    Fibrosin 1 Fbs1 XM_284344 −1.247 0.0001
    RIKEN cDNA E030006K04 gene E030006K04Rik NM_139206 −1.408 0.0002
    Platelet/endothelial cell adhesion molecule 1 Pecam1 NM_008816 −1.672 0.0001
    Histone 1 H2bh Hist1h2bh NM_178197 −2.024 0.0003
    Solute carrier family 40 (iron-regulated transporter) member 1 Slc40a1 NM_016917 −2.128 0.0001
Development
    Nuclear protein 1 Nupr1 NM_019738 3.380 0.0004
    Integrin alpha 3 Itga3 NM_013565 2.653 0.0001
    Tumor necrosis factor receptor superfamily member 12a Tnfrsf12a NM_013749 2.589 0.0147
    Cofilin 1 non-muscle Cfl1 NM_007687 2.550 0.0005
    Connective tissue growth factor Ctgf NM_010217 2.313 0.0013
    Outer dense fiber of sperm tails 2 Odf2 NM_013615 1.558 0.0001
    Growth hormone releasing hormone Ghrh NM_010285 1.505 0.0005
    Microtubule-associated protein tau Mapt NM_010838 1.474 0.0023
    Exocyst complex component 7 Exoc7 NM_016857 1.384 0.0002
    Rnolase 3 beta muscle Eno3 NM_007933 1.353 0.0001
    TCF3 (E2A) fusion partner Tfpt NM_023524 1.326 0.0001
    Calcium channel voltage-dependent alpha 1F subunit Cacna1f NM_019582 −1.546 0.0001
    Growth arrest specific 7 Gas7 NM_008088 −2.513 0.0141
Antiapoptosis
    Cyclin-dependent kinase inhibitor 1A (P21) Cdkn1a NM_007669 3.299 0.0001
    similar to Mucin-5AC Muc5ac XM_133960 2.438 0.0001
    Bcl2-associated athanogene 3 Bag3 NM_013863 2.302 0.0001
Apoptosis
    Serine/threonine kinase 17b (apoptosis-inducing) Stk17b NM_133810 −1.247 0.0005
Glycolysis
    Hexokinase 2 Hk2 NM_013820 1.607 0.0030
Metabolism
    Formyltetrahydrofolate synthetase domain containing 1 Fthfsdc1 NM_172308 2.773 0.0008
    Spectrin beta 1 Spnb1 NM_013675 2.738 0.0004
    Glutaminase 2 (liver, mitochondrial) Gls2 XM_125928 2.401 0.0108
    Ubiquitin specific protease 2 Usp2 NM_198091 2.339 0.0008
    PDZ and LIM domain 1 (elfin) Pdlim1 NM_016861 2.318 0.0009
    Zinc finger, RAN-binding domain containing 1 Zranb1 NM_207302 1.999 0.0031
    Dimethylarginine dimethylaminohydrolase 1 Ddah1 NM_026993 1.509 0.0002
    Intestinal cell kinase Ick NM_019987 1.416 0.0013
    ADP-ribosyltransferase 1 Parp1 NM_007415 −1.292 0.0003
    Inner mitochondrial membrane peptidase 2-like Immp2l NM_053122 −1.364 0.0001
    Uroporphyrinogen III synthase Uros NM_009479 −1.464 0.0001
    Phosphatidylinositol-4-phosphate 5-kinase type II alpha Pip5k2a NM_008845 −1.499 0.0004
    Ectonucleoside triphosphate diphosphohydrolase 3 Entpd3 NM_178676 −1.543 0.0001
    Alkaline phosphatase 2 liver Akp2 NM_007431 −1.577 0.0029
    RAB guanine nucleotide exchange factor (GEF) 1 Rabgef1 NM_019983 −1.832 0.0007
    Solute carrier family 17 (sodium phosphate) member 1 Slc17a1 NM_009198 −1.927 0.0033
    Trophoblast glycoprotein Tpbg NM_011627 −2.024 0.0018
    Dual specificity phosphatase 11 Dusp11 NM_028099 −2.227 0.0001
    Solute carrier organic anion transporter family member 1c1 Slco1c1 NM_021471 −2.370 0.0071
Signaling
    Metallothionein 1 Mt1 NM_013602 3.472 0.0001
    Sterile alpha motif domain containing 7 Samd7 XM_130828 2.789 0.0040
    Calmodulin-like 4 Calml4 NM_138304 2.268 0.0140
    Leucine rich repeat transmembrane neuronal 1 Lrrtm1 NM_028880 1.660 0.0005
    Smoothelin-like 2 Smtnl2 NM_177776 1.473 0.0001
    Inhibitory adapter molecule DOK3 Dok3 NM_013739 −1.499 0.0001
Transport
    ATP synthase H+ transporting mitochondrial F1F0 complex subunit e Atp5k AK011342 2.894 0.0104
    Solute carrier family 27 (fatty acid transporter) member 3 Slc27a3 XM_130954 1.695 0.0010
    Solute carrier family 25 member 19 Slc25a19 NM_026071 −1.698 0.0001
    RIKEN cDNA 1810012H11 gene 1810012H11Rik NM_028048 −2.096 0.0095
    Aquaporin 1 Aqp1 NM_007472 −2.128 0.0074
    ATP-binding cassette sub-family A (ABC1) member 8a Abca8a NM_153145 −2.212 0.0001
Stress response
    Selenium binding protein 1 Selenbp1 NM_009150 4.607 0.0036
    Selenium binding protein 2 Selenbp2 NM_019414 4.356 0.0012
    Cold inducible RNA binding protein Cirbp NM_007705 2.135 0.0012
Response to oxidative stress
    RIKEN cDNA 2310016C16 gene 2310016C16Rik NM_027127 −2.155 0.0011
Vision
    Guanylate cyclase activator 1B Guca1b NM_146079 −2.217 0.0009
    Guantne nucleotide binding protein alpha transducing 1 Gnat1 NM_008140 −2.451 0.0262
    Arrestin 3 retinal Arr3 NM_133205 −4.082 0.0001
Cell adhesion
    Cerebral endothelial cell adhesion molecule 1 Ceecam1 NM_207298 2.040 0.0022
    RIKEN cDNA 1700060C20 gene 1700060C20Rik XM_149230 1.995 0.0009
    Ependymin related protein 1 Epdr1 NM_134065 −1.239 0.0008
    Vitronectin Vtn NM_011707 −2.404 0.0050
    Claudin 5 Cldn5 NM_013805 −2.899 0.0001
Cell cycle
    Anillin actin binding protein Anln NM_028390 1.441 0.0003
    Septin 3 Sep3 NM_011889 1.338 0.0013
Unknown
    Arrestin domain containing 4 Arrdc4 NM_025549 2.666 0.0014
    Similar to rab interacting lysosomal protein Rilp XM_207763 2.252 0.0013
    RIKEN cDNA 9830001H06 gene 9830001H06Rik XM_283804 2.223 0.0001
    RIKEN cDNA 1700093K21 gene 1700093K21Rik NM_026105 2.141 0.0001
    EST EST XM_484892 2.071 0.0001
    RIKEN cDNA 9130213B05 gene 9130213B05Rik NM_145562 1.935 0.0003
    TRIO and F-actin binding protein Tara NM_138579 1.914 0.0001
    RIKEN cDNA 1110038B12 gene 1110038B12Rik XM_359415 1.661 0.0008
    Alport syndrome mental retardation midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog Ammecr1 NM_019496 1.336 0.0015
    RIKEN cDNA 1100001A21 gene 1100001A21Rik NM_025651 1.274 0.0003
    Hypothetical protein C130086A10 C130086A10 NM_173746 −1.399 0.0001
    HD domain containing 3 Hddc3 NM_026812 −1.558 0.0002
    cDNA sequence BC024537 BC024537 NM_146237 −1.773 0.0003
    Similar to hypothetical protein MGC45441 LOC381546 XM_355512 −2.088 0.0001
    WD repeat domain 78 Wdr78 NM_146254 −2.294 0.0005
    RIKEN cDNA 6030441F14 gene 6030441F14Rik NM_172835 −2.331 0.0001
    Hypothetical AAA ATPase superfamily containing protein 4933439B08Rik AK014074 −2.695 0.0029
    Solute carrier family 38, member 5 Slc38a5 NM_172479 −3.497 0.0015
    EST EST NM_001039244.2 −4.115 0.0028
More than 40% of the gene transcripts were overlapped by genes differentially expressed in hyperoxic P12 and normoxic P12 retina (18 genes) or in hyperoxic P12 and hypoxic P12.5 retina (20 genes; Table 4). In addition, the genes significantly altered were broadly clustered into cellular component, development, inflammation, metabolism, transport, stress response, signaling, antiapoptosis, glycolysis, and vision. 
These functional categories were in parallel with the functional categories obtained by comparing hyperoxic P12 to normoxic P12 retinas (Table 2) or hyperoxic P12 to hypoxic P12.5 retinas (Table 4). 
Microarray Validation by Quantitative Real-Time RT-PCR
To validate the outcome of our microarray analyses, we performed qPCR assays. Relative quantifications of the mRNA expression by qPCR were calculated for 5 genes selected from the gene significantly altered by comparing normoxic and hyperoxic P12 retinas (Table 3), and for 15 genes by comparing hyperoxic P12 and hypoxic P12 retinas (Table 2; Fig. 5). We found excellent agreement between microarray and qPCR. In all samples, the expression changes were identical in direction of variation and were very similar in the extent of the alteration. These findings further demonstrated the high reliability of our array results. 
Figure 5.
 
Real-time quantitative RT-PCR for microarray validation. Array validation was performed by quantitative RT-PCR for 20 selected genes (5 and 15 genes selected from gene lists in Table 3 and Table 2, respectively). β-Actin was used as an internal standard. Relative change was the mean differences in gene expression between the groups. Dashed black line at change of onefold indicates no change.
Figure 5.
 
Real-time quantitative RT-PCR for microarray validation. Array validation was performed by quantitative RT-PCR for 20 selected genes (5 and 15 genes selected from gene lists in Table 3 and Table 2, respectively). β-Actin was used as an internal standard. Relative change was the mean differences in gene expression between the groups. Dashed black line at change of onefold indicates no change.
Chemokine Protein Levels in Hypoxic Retinas by ELISA
Because genes related to inflammation were upregulated in hypoxic retinas, which may reflect postischemic inflammation, we next asked whether molecules encoded by these genes were upregulated at the protein level. We performed multiplex ELISA to determine the protein levels of KC (CCL8), MCP-1 (CCL2), MCP-5 (CCL12), MIP-1α (CCL3), MIP-2 (CXCL2), RANTES (CCL5), TARC (CCL17), EOTAXIN (CCL11), and SDF-1β (CXCL12) (Fig. 6). 
Figure 6.
 
Protein levels of the chemokines MIP-1α, MIP-1β, MCP-1, SDF-1β, MIP-2, MCP-5, KC, TARC, RANTES, and EOTAXIN in normoxic P12, hyperoxic P12, and hypoxic P13 retinas. Retinal lysates were prepared and were individually assayed by multiplex ELISA. The bars show the mean ± SEM results in three independent experiments per group. *Statistically significant differences (P < 0.01) compared with control subjects.
Figure 6.
 
Protein levels of the chemokines MIP-1α, MIP-1β, MCP-1, SDF-1β, MIP-2, MCP-5, KC, TARC, RANTES, and EOTAXIN in normoxic P12, hyperoxic P12, and hypoxic P13 retinas. Retinal lysates were prepared and were individually assayed by multiplex ELISA. The bars show the mean ± SEM results in three independent experiments per group. *Statistically significant differences (P < 0.01) compared with control subjects.
In the P13 retinas at 1 day after hypoxia, the KC, MCP-1, MIP-1α, MIP-1β, and SDF-1β protein levels were significantly increased (25.2, 36.2, 14.5, 4.02, and 1596.0 pg/mL, respectively) compared with control P12 and hyperoxic P12 retinas. In contrast, the MCP-5, MIP-2, RANTES, and EOTAXIN protein levels were not significantly increased in the hypoxic retinas. KC and MIP-1β protein in normoxic P12 and hyperoxic P12 retinas were below the level of detection. The results of ELISA were in agreement with the microarray data. Moreover, the assay revealed that retinal hypoxia markedly altered the protein levels of specific chemokines attracting granulocyte-macrophage lineages (e.g., KC, MCP-1, MIP-1α, MIP-1β, and SDF-1β), but it did not alter the other chemokines mainly related to eosinophils, mast cells, and lymphocytes. 
Discussion
Our analyses showed that retinal hyperoxia/hypoxia were associated with specific changes in the patterns of gene expression as determined by comprehensive DNA microarray analyses. These alterations may determine the hyperoxic growth retardation, postischemic inflammation, and subsequent neural and vascular remodeling, and pathologic neovascularization in retinas of murine OIR. 
In an earlier study, Sato et al. 14 examined only a single microarray hybridization for each condition. We performed multiple hybridizations, and we were able to extract the differentially expressed genes by applying Welch's t-test coupled with multidimensional false-discovery control (FDR2D) 20 as the cutoff criteria. FDR2D can guard against false-positive results from transcripts whose variance is underestimated by chance, whereas their change ratios were small. Consequently, our method allowed us to identify differentially expressed genes reliably. 
As a result, we were able to extract well-known ischemia-regulated genes such as Vegfa and Hif1a (Table 2). Moreover, the results of our microarray analyses were in good agreement with independent qPCR assays for all the 20 genes selected (Fig. 5). These results demonstrated the high reliability of our microarray experimental procedures and subsequent data mining, and the extracted genes are likely to represent those that are regulated by hyperoxia/hypoxia in retinas of murine OIR. 
Hyperoxic Exposure to Neonatal Mice Resulted in Retinal Growth Retardation
Only eight genes were upregulated in the hyperoxic retinas compared with the normoxic control P12 retinas. Two of these, Selenbp1 and Selenbp2, may play a central role in protecting cells from oxidative damage. 24 Therefore, these two genes were enhanced in response to the hyperoxia to protect the retina from oxidative injury. 
The 75 genes that were downregulated in response to hyperoxia were broadly clustered into cellular components, development, metabolism, transport, cell adhesion, vision, inflammation, and stress response. About one-half of the classified genes were categorized into cellular components and development (Table 3; Fig. 3). In the mouse, much of the retinal development takes place during the first 3 weeks after birth, and the expression of different genes should be essential for neural differentiation and guidance. 25  
An interesting set of the genes showing decreased expression primarily in the hyperoxic retina were the histones: Hist1h2af, Hist1h2bk, Hist1h2bc, Hist1h2bp, Hist1h2bl, Hist1h2bj, Hist1h2bm, and Hist1h2bn. The decrease indicates that the chromosome biogenesis required for retinal development is largely suppressed. Moreover, several genes related to development such as cell structure (Emp1, Dmn, E030006K04Rik, D11Ertd686e, Tubb6, Slc40a1, Ktn1, Pecam1, C1qr1, Ramp2, and Col4a1), cell adhesion (MGC68323, Vtn, and Cldn5), and organogenesis (Gja4, Vwf, Mglap, Cav1, Emcn, Igfbp7, Robo4, and Gas7) were also downregulated, suggesting hyperoxia-exposed retinas from P7 to P12 are in a state of growth retardation. 26  
One of the key physiological processes that occur during postnatal mouse retinal development is vasculogenesis. Retinal hyperoxia was accompanied by a downregulation of genes related to vascular development (Tubb6, Egfl7, Pecam1, Emcn, Pdgfb, and Robo4). This change may correspond to the marked regression of the superficial network of vessels that had already formed in the central retina and delayed the development of the deep plexus observed in this model. 27  
We compared our findings on the genes altered by hyperoxic exposure to those in a similar study by Natoli et al., 28 who reported that the alteration of gene expression was mainly associated with the stress response and with apoptotic cell death in the adult C57BL6/J mouse retinas exposed to hyperoxia. However, there was only one overlapping gene (Vwf). We postulate that this discrepancy reflects the differences in the age of the mice used or the use of different statistical tests. Our study revealed a new major category of genes suppressed by hyperoxia, growth and development, in addition to the categories found by Natoli et al. 
Gene Expression Induced by Retinal Hypoxia: Inflammation, Development, Antiapoptosis, and Glycolysis
As shown, exposing the developing retina to hyperoxic conditions significantly altered the expression of several genes related to development and growth. These genes were also present in the group comparison between hypoxic P12.5 retinas and normoxic P12 retinas (Table 4). This finding indicates that the hypoxic P12.5 retinas were still in a state of retinal growth suppression by the 5-day hyperoxic exposure compared with the normal retinas (Table 3). However, even in this state of growth suppression, we observed that similar genes were detected when hypoxic P12.5 retinas were compared to normoxic or hyperoxic P12 retinas (Table 2). This finding suggests that certain genes that should be altered in hypoxia are also altered, even though retinal growth is still suppressed by the preceding hyperoxia, in murine OIR (Table 4). 
Despite the considerable differences in the extent and duration of the hypoxic stimulus, the age, and the number of animals used in the different studies, several genes reported to be involved in retinal hypoxia, such as Vegfa, Igfbp3, 29 Hif1a, 3 Cdkn1a, Adm, Mt1, 30,31 and Ccl3, 7 were also found to be differentially expressed in the hypoxic retina in our study. These results further confirm that our microarray analyses were reliable. This reproducibility also indicates that the gene expression changes associated with retinal ischemia are related to specific pathways. 
The genes altered in the hypoxic retina were broadly clustered into six categories; development, inflammation, metabolism, signaling, antiapoptosis, and glycolysis (Fig. 4). Several inflammation-related genes (Ccl4, H2-Ab1, H2-Q6, H2-T23, H2-Q8, H2-D1, H2-K1, Ccl3, H2-Q5, and Wbscr5) were upregulated, indicating that hypoxic retinas are in an elevated state of immune responsiveness. 32,33 The inflammation-related genes were subdivided into two main categories: CC chemokines and MHCs. We have demonstrated that Ccl3 is a CC chemokine involved in retinal neovascularization in murine OIR. 7 Our microarray analyses confirmed the upregulation of this gene. In addition, the change in the expression of Ccl4, another CC chemokine, was the highest among the 62 genes that were upregulated in the hypoxic retina (a 4.3-fold increase, Table 2). Because Ccl4 is not known to be a hypoxia-responsive gene in the retina, it may play more roles in hypoxic retinas than previously believed. 
Subsequent multiplex ELISA of the protein levels of several chemokines in the hypoxic retinas revealed that the protein levels of monocyte lineage–recruiting CC chemokines, such as MCP-1, MIP-1α, and MIP-1β, were specifically and significantly increased. In contrast, the protein levels of other chemokines that recruit other types of cell lineages, including eosinophils, lymphocytes, and mast cells, were not significantly higher (Fig. 6), indicating the involvement of Ccl3 and Ccl4, like Vegfa, 34 in recruiting monocyte lineage cells in response to ischemia. 35,36  
Concordant upregulation of genes related to MHCs may represent activation of resident and/or recruited macrophages/microglia. 37 Such activated macrophages/microglia may play crucial roles in postischemic inflammation. Moreover, these cells may participate in eliminating apoptotic cells, facilitating the subsequent pathologic neovascularization 7,34 and promoting vascular remodeling in this model. 27,38  
Several genes related to cell development (Tnfrsf12a, Anxa2, Nupr1, Tubb6, Tagln2, Emp1, Egln1, Nes, Igfbp3, Adm, 1600014C23Rik, Spnb1, Lgals3, Vegfa, Col2a1, Plxnd1, Efna1, Emcn, and Nnat) were also upregulated, indicating that 12 hours after hyperoxic exposure, retinas regain the ability to undergo retinal vascular and neural development. Among these, the genes related to vasculogenesis or neovascularization (Vegfa, Hif1a, Anxa2, Tnfrsf12a, Adm, and Igfbp3) were also increased. 1,3,29,3941 These results indicate that the changes in the gene expression in the P12.5 retina may contain what is required for the subsequent pathologic and physiological retinal neovascularization. 1,29,42,43  
The observation that genes related to inflammation and angiogenesis were upregulated in hypoxic retina is consistent with the previous microarray study on gene expression in the same model. 14 However, our comprehensive microarray analysis revealed alterations of a distinct set of genes belonging to functions other than inflammation and angiogenesis. An interesting set of upregulated genes (Tnfrsf12a, Igfbp3, Bag3, Cdkn1a, Unc5b, Vegfa, and Hif1a), are related to antiapoptosis. This may reflect the cells' adaptive response to retinal ischemia. Bag3, a modulator of chaperone activity, has antiapoptotic activity and increases the neuroprotective function of Bcl-2 induced by various stimuli. 44 Cdkn1a and Cdkn2b are known as cyclin-dependent kinase inhibitors (CDKIs) and regulators of cell cycle progression at G1 and have antiapoptotic properties. 45 Vegfa is also a prosurvival factor protecting retinal neurons against ischemic injury. In addition, Adm is associated with the HIF-mediated cell protection mechanism. These genes may play important roles in neuroprotection of the retina from ischemic injury. Activation of a diverse array of transcripts related to antiapoptosis is consistent with earlier ideas that fully protecting the retina may require several different antiapoptotic factors. 31  
Other upregulated genes in ischemic retinas were those related to glycolysis (Hk2, Pfkp, and Gpi1). This finding is in good agreement with those in earlier studies demonstrating increased glycolysis after experimental retinal ischemia 46,47 and further supports the idea that the techniques used to extract and identify the genes in this study are reliable. 
We also found that the photoreceptor-specific genes Rp1hl1, Guca1b, and Arr3 were downregulated in the hypoxic retina, probably because developing photoreceptors are known to be sensitive to oxygen, with increased apoptosis occurring after an ischemic insult. 48 In support of this notion, it has been reported that Arr3 acts as a scaffold by directly interacting with the neuronal JNK3 isoform and also by recruiting MKK4 and apoptosis signal-regulating kinase (ASK1) to form the complexes of ASK1-MKK4-JNK3. 49,50 The alterations of retina-specific genes in response to ischemia also suggest the existence of retina-specific pathways in ischemic retinas of murine OIR. 
Conclusions
Our comprehensive microarray studies on the retinas of murine OIR provide molecular insights on hyperoxic growth retardation, postischemic inflammation, neural and vascular development, and subsequent pathologic neovascularization. Recently, several trials of anti-VEGF therapy have been performed on patients with neovascular diseases, and the results have revolutionized the treatment of intraocular neovascular diseases. 51,52 However, finding additional or earlier targets that can be treated less invasively is certainly still a goal. Our comprehensive study clearly demonstrates that there are factors other than VEGF that could be additional molecular targets for such antiangiogenesis therapy. Our comprehensive microarray analyses in combination with multiplex ELISA support the idea that the macrophage recruitment mediated by CC chemokines may play a major role in the postischemic inflammation that contributes to the pathogenesis of ischemia-induced retinal neovascularization. Therefore, CC chemokines, especially Ccl4, which was most upregulated among the differentially expressed genes in ischemic retinas, could be therapeutic targets for inhibiting subsequent retinal neovascularization. Moreover, the comprehensive analysis also revealed that retinal ischemia accompanies enhancement of a diverse set of genes associated with antiapoptosis. This result raises the possibility that simultaneous molecular targeting therapies augmenting antiapoptotic pathways along with antiangiogenesis therapy enable effective maintenance of visual functions, while inhibiting pathologic retinal neovascularization. 
Footnotes
 Supported by grants from the Ministry of Education, Science, Sports and Culture, Japan (TI, SY).
Footnotes
 Disclosure: K. Ishikawa, None; S. Yoshida, None; K. Kadota, None; T. Nakamura, None; H. Niiro, None; S. Arakawa, None; A. Yoshida, None; K. Akashi, None; T. Ishibashi, None
The authors thank the staff of the Research Support Center (Graduate School of Medical Sciences, Kyushu University) for technical support and Naomi Higuchi (Kyushu University) for excellent technical help. 
References
Pierce EA Avery RL Foley ED Aiello LP Smith LE . Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization. Proc Natl Acad Sci U S A. 1995;92:905–909. [CrossRef] [PubMed]
Hackett SF Ozaki H Strauss RW . Angiopoietin 2 expression in the retina: upregulation during physiologic and pathologic neovascularization. J Cell Physiol. 2000;184:275–284. [CrossRef] [PubMed]
Ozaki H Yu AY Della N . Hypoxia inducible factor-1alpha is increased in ischemic retina: temporal and spatial correlation with VEGF expression. Invest Ophthalmol Vis Sci. 1999;40:182–189. [PubMed]
Saito Y Uppal A Byfield G Budd S Hartnett ME . Activated NAD(P)H oxidase from supplemental oxygen induces neovascularization independent of VEGF in retinopathy of prematurity model. Invest Ophthalmol Vis Sci. 2008;49:1591–1598. [CrossRef] [PubMed]
Yoshida A Yoshida S Hata Y Khalil AK Ishibashi T Inomata H . The role of NF-kappaB in retinal neovascularization in the rat. Possible involvement of cytokine-induced neutrophil chemoattractant (CINC), a member of the interleukin-8 family. J Histochem Cytochem. 1998;46:429–436. [CrossRef] [PubMed]
Yoshida A Yoshida S Ishibashi T Kuwano M Inomata H . Suppression of retinal neovascularization by the NF-kappaB inhibitor pyrrolidine dithiocarbamate in mice. Invest Ophthalmol Vis Sci. 1999;40:1624–1629. [PubMed]
Yoshida S Yoshida A Ishibashi T Elner SG Elner VM . Role of MCP-1 and MIP-1alpha in retinal neovascularization during postischemic inflammation in a mouse model of retinal neovascularization. J Leukoc Biol. 2003;73:137–144. [CrossRef] [PubMed]
Yoshida S Yoshida A Ishibashi T . Induction of IL-8, MCP-1, and bFGF by TNF-alpha in retinal glial cells: implications for retinal neovascularization during post-ischemic inflammation. Graefes Arch Clin Exp Ophthalmol. 2004;242:409–413. [CrossRef] [PubMed]
Yoshida S Ono M Shono T . Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor alpha-dependent angiogenesis. Mol Cell Biol. 1997;17:4015–4023. [PubMed]
Yoshida S Yoshida A Matsui H Takada Y Ishibashi T . Involvement of macrophage chemotactic protein-1 and interleukin-1beta during inflammatory but not basic fibroblast growth factor-dependent neovascularization in the mouse cornea. Lab Invest. 2003;83:927–938. [CrossRef] [PubMed]
Yoshida S Ishikawa K Matsumoto T Yoshida A Ishibashi T Kono T . Reduced concentrations of Angiogenesis-Related factors in vitreous after vitrectomy in patients with proliferative diabetic retinopathy. Graefes Arch Clin Exp Ophthalmol. Published online February 10, 2010.
Yoshida S Mears AJ Friedman JS . Expression profiling of the developing and mature Nrl−/− mouse retina: identification of retinal disease candidates and transcriptional regulatory targets of Nrl. Hum Mol Genet. 2004;13:1487–1503. [CrossRef] [PubMed]
Yoshida S Yashar BM Hiriyanna S Swaroop A . Microarray analysis of gene expression in the aging human retina. Invest Ophthalmol Vis Sci. 2002;43:2554–2560. [PubMed]
Sato T Kusaka S Hashida N Saishin Y Fujikado T Tano Y . Comprehensive gene-expression profile in murine oxygen-induced retinopathy. Br J Ophthalmol. 2009;93:96–103. [CrossRef] [PubMed]
Smith LE Wesolowski E McLellan A . Oxygen-induced retinopathy in the mouse. Invest Ophthalmol Vis Sci. 1994;35:101–111. [PubMed]
Yamaji Y Yoshida S Ishikawa K . TEM7 (PLXDC1) in neovascular endothelial cells of fibrovascular membranes from patients with proliferative diabetic retinopathy. Invest Ophthalmol Vis Sci. 2008;49:3151–3157. [CrossRef] [PubMed]
Yoshida S Ogura A Ishikawa K . Gene expression profile of fibrovascular membranes from patients with proliferative diabetic retinopathy. Br J Ophthalmol. Published online November 16, 2009.
Okazaki Y Furuno M Kasukawa T . Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature. 2002;420:563–573. [CrossRef] [PubMed]
Pan W . A comparative review of statistical methods for discovering differentially expressed genes in replicated microarray experiments. Bioinformatics. 2002;18:546–554. [CrossRef] [PubMed]
Ploner A Calza S Gusnanto A Pawitan Y . Multidimensional local false discovery rate for microarray studies. Bioinformatics. 2006;22:556–565. [CrossRef] [PubMed]
Gentleman RIaR . R: a language for data analysis and graphics. J Comput Graph Stat. 1996;5:299–314.
Huang da W Sherman BT Lempicki RA . Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44–57. [CrossRef] [PubMed]
Dennis GJr Sherman BT Hosack DA . DAVID: database for annotation, visualization, and integrated discovery. Genome Biol. 2003;4:P3. [CrossRef] [PubMed]
Bjornstedt M Kumar S Holmgren A . Selenodiglutathione is a highly efficient oxidant of reduced thioredoxin and a substrate for mammalian thioredoxin reductase. J Biol Chem. 1992;267:8030–8034. [PubMed]
Dorrell MI Aguilar E Weber C Friedlander M . Global gene expression analysis of the developing postnatal mouse retina. Invest Ophthalmol Vis Sci. 2004;45:1009–1019. [CrossRef] [PubMed]
Bernfield M Gotte M Park PW . Functions of cell surface heparan sulfate proteoglycans. Annu Rev Biochem. 1999;68:729–777. [CrossRef] [PubMed]
Ritter MR Banin E Moreno SK Aguilar E Dorrell MI Friedlander M . Myeloid progenitors differentiate into microglia and promote vascular repair in a model of ischemic retinopathy. J Clin Invest. 2006;116:3266–3276. [CrossRef] [PubMed]
Natoli R Provis J Valter K Stone J . Gene regulation induced in the C57BL/6J mouse retina by hyperoxia: a temporal microarray study. Mol Vis. 2008;14:1983–1994. [PubMed]
Chang KH Chan-Ling T McFarland EL . IGF binding protein-3 regulates hematopoietic stem cell and endothelial precursor cell function during vascular development. Proc Natl Acad Sci U S A. 2007;104:10595–10600. [CrossRef] [PubMed]
Crosson LA Kroes RA Moskal JR Linsenmeier RA . Gene expression patterns in hypoxic and post-hypoxic adult rat retina with special reference to the NMDA receptor and its interactome. Mol Vis. 2009;15:296–311. [PubMed]
Thiersch M Raffelsberger W Frigg R . Analysis of the retinal gene expression profile after hypoxic preconditioning identifies candidate genes for neuroprotection. BMC Genomics. 2008;9:73. [CrossRef] [PubMed]
Matsuoka Y Kitamura Y Okazaki M Sakata M Tsukahara T Taniguchi T . Induction of heme oxygenase-1 and major histocompatibility complex antigens in transient forebrain ischemia. J Cereb Blood Flow Metab. 1998;18:824–832. [CrossRef] [PubMed]
Zhang C Lam TT Tso MO . Heterogeneous populations of microglia/macrophages in the retina and their activation after retinal ischemia and reperfusion injury. Exp Eye Res. 2005;81:700–709. [CrossRef] [PubMed]
Ishida S Usui T Yamashiro K . VEGF164-mediated inflammation is required for pathological, but not physiological, ischemia-induced retinal neovascularization. J Exp Med. 2003;198:483–489. [CrossRef] [PubMed]
Davies MH Eubanks JP Powers MR . Microglia and macrophages are increased in response to ischemia-induced retinopathy in the mouse retina. Mol Vis. 2006;12:467–477. [PubMed]
Elner SG Strieter RM Elner VM Rollins BJ Del Monte MA Kunkel SL . Monocyte chemotactic protein gene expression by cytokine-treated human retinal pigment epithelial cells. Lab Invest. 1991;64:819–825. [PubMed]
Kaur C Sivakumar V Foulds WS . Early response of neurons and glial cells to hypoxia in the retina. Invest Ophthalmol Vis Sci. 2006;47:1126–1141. [CrossRef] [PubMed]
Davies MH Stempel AJ Powers MR . MCP-1 deficiency delays regression of pathologic retinal neovascularization in a model of ischemic retinopathy. Invest Ophthalmol Vis Sci. 2008;49:4195–4202. [CrossRef] [PubMed]
Lynch CN Wang YC Lund JK Chen YW Leal JA Wiley SR . TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem. 1999;274:8455–8459. [CrossRef] [PubMed]
Ribatti D Nico B Spinazzi R Vacca A Nussdorfer GG . The role of adrenomedullin in angiogenesis. Peptides. 2005;26:1670–1675. [CrossRef] [PubMed]
Sharma MR Koltowski L Ownbey RT Tuszynski GP Sharma MC . Angiogenesis-associated protein annexin II in breast cancer: selective expression in invasive breast cancer and contribution to tumor invasion and progression. Exp Mol Pathol. 2006;81:146–156. [CrossRef] [PubMed]
Lofqvist C Chen J Connor KM . IGFBP3 suppresses retinopathy through suppression of oxygen-induced vessel loss and promotion of vascular regrowth. Proc Natl Acad Sci U S A. 2007;104:10589–10594. [CrossRef] [PubMed]
Ozaki H Seo MS Ozaki K . Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization. Am J Pathol. 2000;156:697–707. [CrossRef] [PubMed]
Strettoi E Volpini M . Retinal organization in the bcl-2-overexpressing transgenic mouse. J Comp Neurol. 2002;446:1–10. [CrossRef] [PubMed]
Sharma RR Ravikumar TS Raimo D Yang WL . Induction of p21WAF1 expression protects HT29 colon cancer cells from apoptosis induced by cryoinjury. Ann Surg Oncol. 2005;12:743–752. [CrossRef] [PubMed]
Padnick-Silver L Linsenmeier RA . Effect of hypoxemia and hyperglycemia on pH in the intact cat retina. Arch Ophthalmol. 2005;123:1684–1690. [CrossRef] [PubMed]
Yamamoto F Steinberg RH . Effects of systemic hypoxia on pH outside rod photoreceptors in the cat retina. Exp Eye Res. 1992;54:699–709. [CrossRef] [PubMed]
Maslim J Valter K Egensperger R Hollander H Stone J . Tissue oxygen during a critical developmental period controls the death and survival of photoreceptors. Invest Ophthalmol Vis Sci. 1997;38:1667–1677. [PubMed]
McDonald PH Chow CW Miller WE . Beta-arrestin 2: a receptor-regulated MAPK scaffold for the activation of JNK3. Science. 2000;290:1574–1577. [CrossRef] [PubMed]
Zhang Z Hao J Zhao Z . beta-Arrestins facilitate ubiquitin-dependent degradation of apoptosis signal-regulating kinase 1 (ASK1) and attenuate H2O2-induced apoptosis. Cell Signal. 2009;21:1195–1206. [CrossRef] [PubMed]
Avery RL Pearlman J Pieramici DJ . Intravitreal bevacizumab (Avastin) in the treatment of proliferative diabetic retinopathy. Ophthalmology. 2006;113:1695 e1691–e1615. [CrossRef] [PubMed]
Gragoudas ES Adamis AP Cunningham ETJr Feinsod M Guyer DR . Pegaptanib for neovascular age-related macular degeneration. N Engl J Med. 2004;351:2805–2816. [CrossRef] [PubMed]
Figure 1.
 
Comparison of gene expression levels in two different mice in each group. The level of expression at each point in the scatterplot is determined by comparing the expression level at the x coordinate (one retina) and the expression level of the gene at the y coordinate (another retina). Analysis of expression levels in two independent experiments shows a tight linear distribution along the diagonal. Intragroup comparisons in P12 control (A), P12 hyperoxia (B), and P12.5 hypoxia (C).
Figure 1.
 
Comparison of gene expression levels in two different mice in each group. The level of expression at each point in the scatterplot is determined by comparing the expression level at the x coordinate (one retina) and the expression level of the gene at the y coordinate (another retina). Analysis of expression levels in two independent experiments shows a tight linear distribution along the diagonal. Intragroup comparisons in P12 control (A), P12 hyperoxia (B), and P12.5 hypoxia (C).
Figure 2.
 
Analysis of gene expression comparing hyperoxic P12 to hypoxic P12.5 retinas. The vertical axis value is the negative log of the P-values from a Welch's t-test, and the horizontal axis value is the log2 change between the two conditions. (•) The genes significantly regulated by comparison between hyperoxic P12 and hypoxic P12.5 retinas.
Figure 2.
 
Analysis of gene expression comparing hyperoxic P12 to hypoxic P12.5 retinas. The vertical axis value is the negative log of the P-values from a Welch's t-test, and the horizontal axis value is the log2 change between the two conditions. (•) The genes significantly regulated by comparison between hyperoxic P12 and hypoxic P12.5 retinas.
Figure 3.
 
Distribution of GO terms in genes regulated by hyperoxic retinas. Ontology of genes downregulated by hyperoxia. Seventy-five genes were analyzed.
Figure 3.
 
Distribution of GO terms in genes regulated by hyperoxic retinas. Ontology of genes downregulated by hyperoxia. Seventy-five genes were analyzed.
Figure 4.
 
Distribution of GO terms in genes regulated by hypoxic retinas. Ontology of genes upregulated by hypoxia. Sixty-two genes were analyzed.
Figure 4.
 
Distribution of GO terms in genes regulated by hypoxic retinas. Ontology of genes upregulated by hypoxia. Sixty-two genes were analyzed.
Figure 5.
 
Real-time quantitative RT-PCR for microarray validation. Array validation was performed by quantitative RT-PCR for 20 selected genes (5 and 15 genes selected from gene lists in Table 3 and Table 2, respectively). β-Actin was used as an internal standard. Relative change was the mean differences in gene expression between the groups. Dashed black line at change of onefold indicates no change.
Figure 5.
 
Real-time quantitative RT-PCR for microarray validation. Array validation was performed by quantitative RT-PCR for 20 selected genes (5 and 15 genes selected from gene lists in Table 3 and Table 2, respectively). β-Actin was used as an internal standard. Relative change was the mean differences in gene expression between the groups. Dashed black line at change of onefold indicates no change.
Figure 6.
 
Protein levels of the chemokines MIP-1α, MIP-1β, MCP-1, SDF-1β, MIP-2, MCP-5, KC, TARC, RANTES, and EOTAXIN in normoxic P12, hyperoxic P12, and hypoxic P13 retinas. Retinal lysates were prepared and were individually assayed by multiplex ELISA. The bars show the mean ± SEM results in three independent experiments per group. *Statistically significant differences (P < 0.01) compared with control subjects.
Figure 6.
 
Protein levels of the chemokines MIP-1α, MIP-1β, MCP-1, SDF-1β, MIP-2, MCP-5, KC, TARC, RANTES, and EOTAXIN in normoxic P12, hyperoxic P12, and hypoxic P13 retinas. Retinal lysates were prepared and were individually assayed by multiplex ELISA. The bars show the mean ± SEM results in three independent experiments per group. *Statistically significant differences (P < 0.01) compared with control subjects.
Table 1.
 
Primer Sequences Used for Real-Time RT-PCR
Table 1.
 
Primer Sequences Used for Real-Time RT-PCR
Gene Name Accession No. 5′-Forward Primer Sequence-3′ 5′-Reverse Primer Sequence-3′
Vtn NM_011707 TGTTTGAGCACTTTGCCTTG GATAGCGCTTTCGGCTTCTA
Emcn NM_016885 CCAAAAGTGACGTATCCCAAA TGTTCTGGGAACCTGGTAGC
Cav1 NM_007616 GGCAAATACGTAGACTCCGAG GACCAGGTCAATCTCCTTGG
Ktn NM_008477 TGAAAGATCGGATTGGAACA TTGCTTTCCAGTTGGTTTGT
Selenbp2 NM_009150 TGGATGACCGCTTCCTTTAC CTCTTGGTCCTCCAGCACTT
Arr3 NM_133205 CAGCTTCTCCCAGACCTTTG AGGACACCACCAAGTTGACTC
Peli3 NM_172835 GCATCCTGTCTTGTCCTGGT ATGTGGTGCATGACATCTGG
ABCa8a NM_153145 GGGACACAATGGAGCTGGTA CCCCTTTATGGCTGCAAATA
Gstt1 NM_008185 TGCTCTACCTGGCACACAAG CTGCCAGTGTTTCAGGAGGT
Ccl3 NM_011337 ATGAAGGTCTCCACCACTGC CAAAGGCTGCTGGTTTCAA
Vegfa NM_001025250 GGAGAGCAGAAGTCCCATGA ACTCCAGGGCTTCATCGTTA
Gpi1 NM_008155 GCCAAAGTGAAAGAGTTTGGA ATGGAAAGTCCAATGGCTGA
Igfbp3 NM_008343 CTCACTGCCCTCACTCTGCT AACTTTGTAGCGCTGGCTGT
Nes NM_016701 AGCAGGAGAAGCAGGGTCTA CTGGGAACTTCTTCCAGGTG
Osmr NM_011019 CGACATCAATGGCTCAGAGA CAATGATGCTGAGCAAGACG
H2T23 NM_010398 ACCAACAGAGGGCATACCTG GGTCTCCACAAGCTCCATGT
Cdkn1a NM_007669 CGGTGGAACTTTGACTTCGT TCTGCGCTTGGAGTGATAGA
Muc2 XM_133960 GGCATTGTGTGCCAACCAAAG CCTTGGGCACACAGGAATAAACTG
Tnfrsf12 NM_013749 CAGATCCTCGTGTTGGGATT GCAGAAGTCGCTGTGTGGT
Ccl4 NM_0113652 CTCTGACCCTCCCACTTCCT CTCACTGGGGTTAGCACAGA
β-Actin NM_007393 GATGACCCAGATCATGTTTGA GGAGAGCATAGCCCTCGTAG
Table 2.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Hypoxic P12.5 Retina
Table 2.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Hypoxic P12.5 Retina
Description Gene Symbol RefSeq Change Ratio P
Inflammation
    Chemokine (C-C motif) ligand 4 Ccl4 NM_013652 4.248 0.0002
    Histocompatibility 2, class II antigen A, beta 1 H2-Ab1 NM_207105 3.139 0.0035
    Histocompatibility 2, Q region locus 6 H2-Q6 NM_207648.1 2.431 0.0004
    Histocompatibility 2, T region locus 23 H2-T23 NM_010398 2.356 0.0011
    Histocompatibility 2, Q region locus 8 H2-Q8 NM_023124 2.151 0.0010
    Histocompatibility 2, Q region locus 2 H2-D1 NM_010392 1.955 0.0001
    Histocompatibility 2, K1, Kregion H2-K1 NM_001001892.2 1.820 0.0031
    Chemokine (C-C motif) ligand 3 Ccl3 NM_011337 1.714 0.0061
    Histocompatibility 2, Q region locus 5 H2-Q5 NM_010393 1.638 0.0002
    Linker for activation of T cells family, member 2 isoform a Wbscr5 NM_022964 1.550 0.0007
Development
    Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a NM_013749 3.540 0.0050
    Annexin A2 Anxa2 NM_007585 2.726 0.0063
    p8 protein Nupr1 NM_019738 2.470 0.0188
    Tubulin, beta 6 Tubb6 NM_026473 2.395 0.0055
    Transgelin 2 Tagln2 NM_178598 2.116 0.0004
    Epithelial membrane protein 1 Emp1 NM_010128 2.098 0.0098
    EGL nine homolog 1 Egln1 NM_053207 2.073 0.0146
    Nestin Nes NM_016701 2.046 0.0006
    Insulin-like growth factor binding protein 3 Igfbp3 NM_008343 2.015 0.0063
    Adrenomedullin Adm NM_009627 1.992 0.0044
    RIKEN cDNA 1600014C23 gene 1600014C23Rik XM_128667 1.962 0.0034
    Spectrin beta 1 Spnb1 NM_013675 1.899 0.0025
    Galectin 3 Lgals3 NM_010705 1.889 0.0064
    Vascular endothelial growth factor A isoform 1 Vegfa NM_009505 1.873 0.0200
    Procollagen, type II, alpha 1 Col2a1 NM_031163 1.685 0.0036
    Plexin D1 Plxnd1 XM_149784 1.598 0.0002
    Ephrin A1 Efna1 NM_010107 1.577 0.0004
    Endomucin Emcn NM_016885 1.509 0.0015
    Neuronatin isoform alpha Nnat AK077465 1.361 0.0036
    Calsenilin, presenilin-binding protein, EF hand transcription factor Csen NM_019789 −1.300 0.0003
Antiapoptosis
    Bcl2-associated athanogene 3 Bag3 NM_013863 2.829 0.0003
    Similar to Mucin-5AC Muc5ac XM_133960 2.794 0.0001
    Cyclin-dependent kinase inhibitor 1A (P21) Cdkn1a NM_007669 2.250 0.0014
    Unc-5 homolog B Unc5b NM_029770 1.872 0.0061
Glycolysis
    Hexokinase 2 Hk2 NM_013820 2.273 0.0062
    Phosphofructokinase, platelet Pfkp NM_019703 2.223 0.0202
    Glucose phosphate isomerase 1 Gpi1 NM_008155 1.928 0.0001
Response to hypoxia
    Hypoxia inducible factor 1, alpha subunit Hif1a NM_010431.1 2.219 0.0048
Vision
    Retinitis pigmentosa 1 homolog (human)-like 1 isoform 1 Rp1hl1 XM_484387 −1.468 0.0003
    Guanylate cyclase activator 1B Guca1b NM_146079 −2.020 0.0098
    Arrestin 3, retinal Arr3 NM_133205 −2.494 0.0006
Metabolism
    Carboxyl terminal LIM domain protein 1 Pdlim1 NM_016861 3.059 0.0002
    6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 isoform 1 Pfkfb3 NM_133232 1.922 0.0029
    Ankyrin repeat and SOCS box-containing 16 Asb16 AK038411 1.905 0.0022
    Glutaminase 2 (liver, mitochondrial) Gls2 XM_125928 1.889 0.0041
    Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1–like Fthfsdc1 NM_172308 1.888 0.0023
    Plasminogen activator, tissue Plat NM_008872 1.674 0.0017
    Serine hydroxymethyl transferase 2 (mitochondrial) Shmt2 NM_028230 1.610 0.0006
    PHD zinc finger transcription factor Phf12 NM_174852 1.263 0.0003
    Acyl-CoA thioesterase 7 Bach NM_133348 −1.227 0.0001
    Phospholipase A2, group IVB isoform 1 Pla2g4b XM_355378 −1.279 0.0001
    Hypothetical protein LOC194237 BC057371 NM_177572 −1.305 0.0007
    Calcium/calmodulin-dependent protein kinase kinase 1, alpha Camkk1 NM_018883 −1.321 0.0052
    Mannose phosphate isomerase 1 isoform 1 Mpi1 XM_134931 −1.323 0.0037
    RIKEN cDNA 9630033F20 gene 9630033F20Rik NM_177003 −1.381 0.0006
    Cofactor required for Sp1 transcriptional activation, subunit 2 Crsp2 NM_012005 −1.429 0.0010
    Sushi domain containing 3 Susd3 NM_025491 −1.43 0.0003
    Creatine kinase, mitochondrial 1, ubiquitous Ckmt1 NM_009897 −1.475 0.0001
    Thioesterase, adipose associated Thea NM_025590 −1.481 0.0002
    Mitochondrial ribosomal protein L36 Mrpl36 NM_053163 −1.531 0.0006
    Glutathione S-transferase, theta 1 Gstt1 NM_008185 −1.789 0.0087
    Glutathione S-transferase, theta 3 Gstt3 NM_133994 −1.802 0.0008
Signaling
    Synaptopodin Synpo NM_177340.2 2.475 0.0029
    Metallothionein 1 Mt1 NM_013602 2.383 0.0002
    Sterile alpha motif domain containing 7 Samd7 XM_130828 2.194 0.0019
    Oncostatin M receptor Osmr NM_011019 2.161 0.0001
    Spermatogenesis associated 13 isoform 1 Spata13 XM_147847 1.772 0.0072
    Stanniocalcin 2 Stc2 NM_011491 1.747 0.0025
    Nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta Nfkbib NM_010908 1.585 0.006
    Rhomboid family 1 Rhbdf1 NM_010117 1.387 0.0008
    Similar to connector enhancer of kinase suppressor of Ras 1 Cnksr1 XM_110525 −1.629 0.0031
    Opioid receptor, mu 1 Oprm1 NM_011013 −1.701 0.0012
Cellular component
    Filamin C, gamma isoform 1 1110055E19Rik XM_284175 2.532 0.0002
    H1 histone family, member O, oocyte-specific H1foo NM_138311 1.626 0.0056
    Dystrobrevin alpha isoform 2 Dtna NM_010087 1.609 0.0006
    Vacuolar protein sorting 45 Vps45 NM_013841 −1.282 0.0005
    RAN guanine nucleotide release factor Rangnrf NM_021329 −1.608 0.0013
Transport
    Sideroflexin 5 Sfxn5 NM_178639 −1.289 0.0001
    ATP-binding cassette, sub-family B, member 9 Abcb9 NM_019875 −1.294 0.0001
    ATP-binding cassette, sub-family A (ABC1), member 8a Abca8a NM_153145 −1.852 0.0024
Cell cycle
    Cdk5 and Abl enzyme substrate 2 Cables2 NM_145851 −1.337 0.0008
    Meiosis-specific nuclear structural protein 1 Mns1 NM_008613 −1.493 0.0019
Cell adhesion
    Melanoma cell adhesion molecule Mcam NM_023061 2.017 0.0001
Cell part
    RIKEN cDNA 9230117N10 9230117N10Rik NM_133775 −1.969 0.0053
Unknown
    Nitric oxide synthase 3 antisense Nos3as NM_001002897 1.871 0.0012
    2010204K13Rik 0610010M13Rik AK008437 1.783 0.0022
    Hypothetical protein LOC320706 9830001H06Rik XM_283804 1.758 0.0063
    Complement component 1, q subcomponent, receptor 1 C1qr1 AK077882 1.742 0.0011
    Arrestin domain containing 3 Arrdc3 NM_178917 1.403 0.0022
    Epidermal growth factor receptor pathway substrate 15, related Eps15-rs AK036728 −1.462 0.0065
    Hypothetical protein LOC231296 BC031901 NM_153568 −1.681 0.0011
    RAD52 motif 1 Rad52b NM_025654 −1.880 0.0021
    Pellino 3 6030441F14Rik NM_172835 −2.020 0.0086
    Hypothetical protein LOC67304 3110070M22Rik NM_026084 −2.075 0.0091
    EST EST NM_001039244.2 −2.532 0.0176
Table 3.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Normoxic P12 Retina
Table 3.
 
Genes Significantly Altered in Expression between Hyperoxic P12 Retina and Normoxic P12 Retina
Description Gene Symbol RefSeq Change Ratio P
Cellular component
    Epithelial membrane protein 1 Emp1 NM_010128 −1.312 0.0059
    Desmuslin (Dmn) transcript variant 1 Dmn NM_207663 −1.538 0.0435
    Histone 1 H2af Hist1h2af NM_175661 −1.715 0.0268
    RIKEN cDNA E030006K04 gene E030006K04Rik NM_139206 −1.736 0.0289
    DNA segment Chr 11 ERATO Doi 686 expressed D11Ertd686e XM_110968 −1.742 0.0023
    RIKEN cDNA 2310057H16 gene Tubb6 NM_026473 −1.848 0.0185
    Histone 1 H2bk Hist1h2bk NM_175665 −1.912 0.0072
    Histone 1 H2ag Hist1h2ag NM_178186 −1.938 0.0302
    Solute carrier family 40 (iron-regulated transporter) member 1 Slc40a1 NM_016917 −1.938 0.0457
    Kinectin 1 (Ktn1) mRNA. Ktn1 NM_008477 −2.004 0.0486
    Histone 1 H2bc Hist1h2bc NM_023422 −2.070 0.0180
    Histone 1 H2bp Hist1h2bp NM_178202 −2.188 0.0315
    Platelet/endothelial cell adhesion molecule 1 Pecam1 NM_008816 −2.227 0.0258
    Histone 1 H2bl Hist1h2bl NM_178199 −2.358 0.0369
    Histone 1 H2bj Hist1h2bj NM_178198 −2.375 0.0249
    Complement component 1 q subcomponent receptor 1 Clqr1 NM_010740 −2.387 0.0040
    Histone 1 H2bm Hist1h2bm NM_178200 −2.404 0.0445
    Receptor (calcitonin) activity modifying protein 2 Ramp2 NM_019444 −2.457 0.0174
    Histone 1 H2bn Hist1h2bn NM_178201 −2.551 0.0158
    Procollagen type IV alpha 1 Col4a1 NM_009931 −2.618 0.0447
Development
    Gap junction membrane channel protein alpha 4 Gja4 NM_008120 −1.681 0.0181
    Von Willebrand factor homolog Vwf NM_011708 −2.053 0.0445
    Matrix gamma-carboxyglutamate (gla) protein Mglap NM_008597 −2.128 0.0360
    Caveolin Cav1 NM_007616 −2.128 0.0376
    Endomucin Emcn NM_016885 −2.336 0.0066
    Insulin-like growth factor binding protein 7 Igfbp7 NM_008048 −2.740 0.0334
    Roundabout homolog 4 Robo4 NM_028783 −2.809 0.0027
    Growth arrest specific 7 Gas7 NM_008088 −3.597 0.0039
Metabolism
    Mitochondrial ribosomal protein L15 Mrpl15 AK011775 1.494 0.0302
    Low density lipoprotein-related protein 1B (deleted in tumors) LRP-DIT AK080989 −1.248 0.0046
    Minichromosome maintenance deficient 6 Mcm6 NM_008567 −1.541 0.0107
    Platelet derived growth factor B polypeptide Pdgfb NM_011057 −1.570 0.0166
    Solute carrier family 17 (sodium phosphate) member 1 Slc17a1 NM_009198 −1.623 0.0103
    E26 avian leukemia oncogene 2 3 domain Ets2 NM_011809 −1.745 0.0119
    EGF-like domain 7 Egfl7 NM_198724 −1.825 0.0010
    Epoxide hydrolase 2 cytoplasmic Ephx2 NM_007940 −1.890 0.0312
    EGF latrophilin seven transmembrane domain containing 1 Eltd1 NM_133222 −1.984 0.0025
    Zinc finger protein 306 Zfp307 NM_023685 −2.012 0.0404
    RIKEN cDNA 2310003L22 gene 2310003L22Rik NM_027093 −2.237 0.0374
    Protein tyrosine phosphatase receptor type B Ptprb NM_029928 −2.278 0.0047
    Dual specificity phosphatase 11 (RNA/RNP complex 1–interacting) Dusp11 NM_028099 −2.639 0.0300
Transport
    Zinc finger protein 295 Zfp295 NM_175428 −1.255 0.0013
    Phospholipid transfer protein Pltp NM_011125 −1.764 0.0120
    Solute carrier organic anion transporter family member 1c1 Slco1c1 NM_021471 −1.869 0.0090
    Similar to deleted in malignant brain tumors 1 isoform c precursor LOC381928 XM_355949 −1.980 0.0092
    Perlecan (heparan sulfate proteoglycan 2) Hspg2 NM_008305 −2.033 0.0266
    Solute carrier organic anion transporter family member 2b1 Slco2b1 NM_175316 −2.053 0.0131
    Aquaporin 1 Aqp1 NM_007472 −2.174 0.0165
Stress response
    Selenium binding protein 1 Selenbp1 NM_009150 2.273 0.0166
    Selenium binding protein 2 Selenbp2 NM_019414 2.243 0.0102
    Chemokine-like factor super family 3 Cklfsf3 NM_024217 −1.524 0.0326
    Heat shock 27kDa protein 8 Hspb8 NM_030704 −1.592 0.0389
Cell adhesion
    Similar to glyceraldehyde-3-phosphate dehydrogenase MGC68323 NM_199472 −1.961 0.0482
    Vitronectin Vtn NM_011707 −2.146 0.0165
    Claudin 5 Cldn5 NM_013805 −3.165 0.0154
Inflammation
    Chemokine (C-C motif) ligand 3 Ccl3 NM_011337 1.290 0.0094
    Chemokine (C-X-C motif) ligand 12 Cxcl12 NM_013655 −1.661 0.0174
    Transforming growth factor beta receptor II Tgfbr2 NM_009371 −1.701 0.0022
Vision
    Arrestin 3 retinal Arr3 NM_133205 −2.336 0.0042
    Guanine nucleotide binding protein alpha transducing 1 Gnat1 NM_008140 −3.175 0.0140
Response to oxidative stress
    RIKEN cDNA 2310016C16 gene 2310016C16Rik NM_027127 −1.916 0.0149
Cell part
    RIKEN cDNA 1700093K21 gene 1700093K21Rik NM_026105 1.908 0.0244
Unknown
    RIKEN cDNA 1700060C20 gene 1700060C20Rik XM_149230 1.569 0.0074
    Similar to Cyclin-dependent kinases regulatory subunit 1 Cks-1 XM_123604 1.439 0.0003
    RIKEN cDNA 4930546H06 gene 4930546H06Rik XM_283398 1.352 0.0002
    Pleckstrin homology domain containing, family A member 6 Plekha6 NM_182930 −1.307 0.0091
    RNA exonuclease 4 homolog Rexo4 XM_130184 −1.330 0.0249
    Thrombospondin type I domain 1 Thsd1 NM_019576 −1.370 0.0097
    RIKEN cDNA 4931415C17 gene 2810048G06Rik AK088235 −1.453 0.0130
    Kelch-like 6 Klhl6 NM_183390 −1.466 0.0093
    Hypothetical protein A930010102 A930010102 NM_177799 −1.471 0.0100
    RIKEN cDNA 1700008G05 gene 1700008G05Rik XM_485205 −1.597 0.0068
    RIKEN cDNA 0610041G09 gene Acta2 NM_183274 −1.658 0.0235
    Hypothetical protein E130012K09 E130012K09 NM_174999 −1.894 0.0411
    FERM and PDZ domain containing 1 Frmpd1 XM_204152 −1.949 0.0346
    RIKEN cDNA 1700018O18 gene Mfsd2 XM_131683 −2.033 0.0324
    Solute carrier family 1 (glial high affinity glutamate transporter) member 2 Mfsd2 XM_131683 −2.033 0.0324
    Similar to hypothetical protein LOC381546 XM_355512 −2.208 0.0186
    Arrestin domain containing 3 Arrdc3 NM_178917 −2.268 0.0215
    RIKEN cDNA 1700025K23 gene 1700025K23Rik NM_183254 −2.299 0.0199
    RIKEN cDNA 2310056K19 gene 2310056K19Rik NM_080846 −2.488 0.0108
    Hypothetical AAA ATPase superfamily containing protein 4933439B08Rik AK014074 −2.494 0.0431
    Solute carrier family 38, member 5 Slc38a5 NM_172479 −3.401 0.0122
Table 4.
 
Genes Significantly Altered in Expression between Hypoxic P12.5 Retina and Normoxic P12 Retina
Table 4.
 
Genes Significantly Altered in Expression between Hypoxic P12.5 Retina and Normoxic P12 Retina
Description Gene Symbol RefSeq Change Ratio P
Inflammation
    Histocompatibility 2, class II antigen A, beta 1 H2-Ab1 NM_207105 3.410 0.0004
    Chemokine (C-C motif) ligand 4 Ccl4 NM_013652 2.605 0.0009
    Histocompatibility 2 T region locus 23 H2-T23 NM_010398 2.063 0.0006
    Histocompatibility 2 Q region locus 8 H2-Q8 NM_023124 2.043 0.0002
    Transcription factor E3 Tcfe3 NM_172472 1.263 0.0002
    Chemokine (C-X-C motif) ligand 12 Cxcl12 NM_013655 −1.548 0.0001
Cellular component
    RIKEN cDNA 1190002C06 gene 1190002C06Rik NM_028447 1.554 0.0007
    Fibrosin 1 Fbs1 XM_284344 −1.247 0.0001
    RIKEN cDNA E030006K04 gene E030006K04Rik NM_139206 −1.408 0.0002
    Platelet/endothelial cell adhesion molecule 1 Pecam1 NM_008816 −1.672 0.0001
    Histone 1 H2bh Hist1h2bh NM_178197 −2.024 0.0003
    Solute carrier family 40 (iron-regulated transporter) member 1 Slc40a1 NM_016917 −2.128 0.0001
Development
    Nuclear protein 1 Nupr1 NM_019738 3.380 0.0004
    Integrin alpha 3 Itga3 NM_013565 2.653 0.0001
    Tumor necrosis factor receptor superfamily member 12a Tnfrsf12a NM_013749 2.589 0.0147
    Cofilin 1 non-muscle Cfl1 NM_007687 2.550 0.0005
    Connective tissue growth factor Ctgf NM_010217 2.313 0.0013
    Outer dense fiber of sperm tails 2 Odf2 NM_013615 1.558 0.0001
    Growth hormone releasing hormone Ghrh NM_010285 1.505 0.0005
    Microtubule-associated protein tau Mapt NM_010838 1.474 0.0023
    Exocyst complex component 7 Exoc7 NM_016857 1.384 0.0002
    Rnolase 3 beta muscle Eno3 NM_007933 1.353 0.0001
    TCF3 (E2A) fusion partner Tfpt NM_023524 1.326 0.0001
    Calcium channel voltage-dependent alpha 1F subunit Cacna1f NM_019582 −1.546 0.0001
    Growth arrest specific 7 Gas7 NM_008088 −2.513 0.0141
Antiapoptosis
    Cyclin-dependent kinase inhibitor 1A (P21) Cdkn1a NM_007669 3.299 0.0001
    similar to Mucin-5AC Muc5ac XM_133960 2.438 0.0001
    Bcl2-associated athanogene 3 Bag3 NM_013863 2.302 0.0001
Apoptosis
    Serine/threonine kinase 17b (apoptosis-inducing) Stk17b NM_133810 −1.247 0.0005
Glycolysis
    Hexokinase 2 Hk2 NM_013820 1.607 0.0030
Metabolism
    Formyltetrahydrofolate synthetase domain containing 1 Fthfsdc1 NM_172308 2.773 0.0008
    Spectrin beta 1 Spnb1 NM_013675 2.738 0.0004
    Glutaminase 2 (liver, mitochondrial) Gls2 XM_125928 2.401 0.0108
    Ubiquitin specific protease 2 Usp2 NM_198091 2.339 0.0008
    PDZ and LIM domain 1 (elfin) Pdlim1 NM_016861 2.318 0.0009
    Zinc finger, RAN-binding domain containing 1 Zranb1 NM_207302 1.999 0.0031
    Dimethylarginine dimethylaminohydrolase 1 Ddah1 NM_026993 1.509 0.0002
    Intestinal cell kinase Ick NM_019987 1.416 0.0013
    ADP-ribosyltransferase 1 Parp1 NM_007415 −1.292 0.0003
    Inner mitochondrial membrane peptidase 2-like Immp2l NM_053122 −1.364 0.0001
    Uroporphyrinogen III synthase Uros NM_009479 −1.464 0.0001
    Phosphatidylinositol-4-phosphate 5-kinase type II alpha Pip5k2a NM_008845 −1.499 0.0004
    Ectonucleoside triphosphate diphosphohydrolase 3 Entpd3 NM_178676 −1.543 0.0001
    Alkaline phosphatase 2 liver Akp2 NM_007431 −1.577 0.0029
    RAB guanine nucleotide exchange factor (GEF) 1 Rabgef1 NM_019983 −1.832 0.0007
    Solute carrier family 17 (sodium phosphate) member 1 Slc17a1 NM_009198 −1.927 0.0033
    Trophoblast glycoprotein Tpbg NM_011627 −2.024 0.0018
    Dual specificity phosphatase 11 Dusp11 NM_028099 −2.227 0.0001
    Solute carrier organic anion transporter family member 1c1 Slco1c1 NM_021471 −2.370 0.0071
Signaling
    Metallothionein 1 Mt1 NM_013602 3.472 0.0001
    Sterile alpha motif domain containing 7 Samd7 XM_130828 2.789 0.0040
    Calmodulin-like 4 Calml4 NM_138304 2.268 0.0140
    Leucine rich repeat transmembrane neuronal 1 Lrrtm1 NM_028880 1.660 0.0005
    Smoothelin-like 2 Smtnl2 NM_177776 1.473 0.0001
    Inhibitory adapter molecule DOK3 Dok3 NM_013739 −1.499 0.0001
Transport
    ATP synthase H+ transporting mitochondrial F1F0 complex subunit e Atp5k AK011342 2.894 0.0104
    Solute carrier family 27 (fatty acid transporter) member 3 Slc27a3 XM_130954 1.695 0.0010
    Solute carrier family 25 member 19 Slc25a19 NM_026071 −1.698 0.0001
    RIKEN cDNA 1810012H11 gene 1810012H11Rik NM_028048 −2.096 0.0095
    Aquaporin 1 Aqp1 NM_007472 −2.128 0.0074
    ATP-binding cassette sub-family A (ABC1) member 8a Abca8a NM_153145 −2.212 0.0001
Stress response
    Selenium binding protein 1 Selenbp1 NM_009150 4.607 0.0036
    Selenium binding protein 2 Selenbp2 NM_019414 4.356 0.0012
    Cold inducible RNA binding protein Cirbp NM_007705 2.135 0.0012
Response to oxidative stress
    RIKEN cDNA 2310016C16 gene 2310016C16Rik NM_027127 −2.155 0.0011
Vision
    Guanylate cyclase activator 1B Guca1b NM_146079 −2.217 0.0009
    Guantne nucleotide binding protein alpha transducing 1 Gnat1 NM_008140 −2.451 0.0262
    Arrestin 3 retinal Arr3 NM_133205 −4.082 0.0001
Cell adhesion
    Cerebral endothelial cell adhesion molecule 1 Ceecam1 NM_207298 2.040 0.0022
    RIKEN cDNA 1700060C20 gene 1700060C20Rik XM_149230 1.995 0.0009
    Ependymin related protein 1 Epdr1 NM_134065 −1.239 0.0008
    Vitronectin Vtn NM_011707 −2.404 0.0050
    Claudin 5 Cldn5 NM_013805 −2.899 0.0001
Cell cycle
    Anillin actin binding protein Anln NM_028390 1.441 0.0003
    Septin 3 Sep3 NM_011889 1.338 0.0013
Unknown
    Arrestin domain containing 4 Arrdc4 NM_025549 2.666 0.0014
    Similar to rab interacting lysosomal protein Rilp XM_207763 2.252 0.0013
    RIKEN cDNA 9830001H06 gene 9830001H06Rik XM_283804 2.223 0.0001
    RIKEN cDNA 1700093K21 gene 1700093K21Rik NM_026105 2.141 0.0001
    EST EST XM_484892 2.071 0.0001
    RIKEN cDNA 9130213B05 gene 9130213B05Rik NM_145562 1.935 0.0003
    TRIO and F-actin binding protein Tara NM_138579 1.914 0.0001
    RIKEN cDNA 1110038B12 gene 1110038B12Rik XM_359415 1.661 0.0008
    Alport syndrome mental retardation midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog Ammecr1 NM_019496 1.336 0.0015
    RIKEN cDNA 1100001A21 gene 1100001A21Rik NM_025651 1.274 0.0003
    Hypothetical protein C130086A10 C130086A10 NM_173746 −1.399 0.0001
    HD domain containing 3 Hddc3 NM_026812 −1.558 0.0002
    cDNA sequence BC024537 BC024537 NM_146237 −1.773 0.0003
    Similar to hypothetical protein MGC45441 LOC381546 XM_355512 −2.088 0.0001
    WD repeat domain 78 Wdr78 NM_146254 −2.294 0.0005
    RIKEN cDNA 6030441F14 gene 6030441F14Rik NM_172835 −2.331 0.0001
    Hypothetical AAA ATPase superfamily containing protein 4933439B08Rik AK014074 −2.695 0.0029
    Solute carrier family 38, member 5 Slc38a5 NM_172479 −3.497 0.0015
    EST EST NM_001039244.2 −4.115 0.0028
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×