Purpose
The Cre/loxP recombinase system has been very useful in performing conditional gene targeting experiments that aim the exploration of genetic pathways that control both the development and function of the retinal pigment epithelium (RPE). We have previously shown that Trp1-Cre mice exhibit baseline RPE pathology due to high levels of Cre recombinase expressed at the level of RPE. Here, we aim to describe the abnormalities seen in the retinal vascular network seen in the Trp1Cre mouse, a transgenic mouse line commonly used in conditional gene targeting studies of the RPE.
Methods
For all the experiments described, mice carrying the Cre transgene were identified by DNA tail biopsy and PCR analysis using the following primers.(F:GTGAAACAGCATTGCTGT CACTT, R: GCGGTCTGGCAGTAAAAACTATC). Littermates non-carrying the transgene were used as controls. The number of retinal vessels was evaluated by means of color fundus imaging and fluorescein angiography (FA). FA was performed using a commercial camera and imaging system. Photographs were captured with a 20 D lens in contact with the fundus camera lens after intraperitoneal injection of 0.1 mL of 2% fluorescein sodium. Adult 2 month old Trp1 Cre mice (n=6) and wild type (n=5) littermate controls were used.
Results
There was a statistical significant difference (p<0.0004) in the number of major retinal vessels emanating from the optic disc between Trp1Cre mice and wild type counterparts. In addition, the number of vessel bifurcation was significantly lower in the Trp1 Cre mice. Fluorescein angiographies of Trp1-Cre mice were also significant for large peripheral areas of RPE atrophy, that increased in intensity over time but not in size (window defects)
Conclusions
We have previously shown that Trp1-Cre mice exhibit baseline RPE pathology due to high levels of Cre recombinase expression. Here we show that the Trp1-Cre mice exhibit also abnormalities in the superficial retinal vascular network. Moreover, this is an indirect piece of evidence that the RPE may play a role in the development of the retinal vascular network.
Keywords: 701 retinal pigment epithelium •
748 vascular endothelial growth factor •
740 transgenics/knock-outs