Human Trabecular Meshwork Cells Secrete Neurotrophins and Express Neurotrophin Receptors (Trk)

Abstract

purpose. The purpose of this study was to compare the mRNA expression of neurotrophins (NTs) and NT receptors (Trk) in cultured human trabecular meshwork (HTM) cells and ex vivo HTM tissues, to immunolocalize both NT and Trk receptors in cultured HTM cells, and to demonstrate secretion of NTs by HTM cells.

methods. Reverse transcription–polymerase chain reaction (RT-PCR) was used to detect the expression of NT and Trk receptor mRNAs in early-passaged, cultured HTM cells from donors of several ages. RT-PCR was used on ex vivo HTM tissues from donors to compare and contrast mRNA expression with cell culture results. In addition, immunohistochemistry was used to localize the translated NT and low- (p75) and high- (Trk) affinity NT receptor proteins within cultured HTM cells and trabecular meshwork tissues. Last, enzyme-linked immunoassay (ELISA) was used to demonstrate secretion of NTs by HTM cells.

results. Amplification products of the expected size for NTs were detected in both cultured HTM cells and ex vivo HTM tissues. Specifically identified were amplification products for the following NTs: NGF, BDNF, NT-3, and NT-4. Amplification products for the full-length Trk A and Trk C high-affinity receptor were observed, as well as truncated isoforms for Trk B and Trk C. No amplification products were produced for the full-length Trk B receptor nor for the low-affinity p75 receptor. Immunohistochemistry indicated that proteins for the various NTs and full-length and truncated Trk receptors were translated by cultured HTM cells and tissues. Immunoassays (ELISA) detected BDNF, NT-4, NGF, and NT-3 in the culture media from HTM cells.

conclusions. The results demonstrate, for the first time, mRNA expression for NT and Trk receptors by both cultured HTM cells and ex vivo HTM tissues. NTs were immunolocalized in HTM tissues and cultured HTM cells are capable of secreting NTs. Specific NTs acting through high-affinity Trk receptors within the HTM may be involved in maintaining the normal function of this complex tissue.

Neurotrophins (NTs) constitute a family of polypeptide growth factors that are structurally and functionally similar. ¹ These growth factors are known primarily for their direct action on neurons that can influence neural development, maintenance, and regeneration. ² Nerve growth factor (NGF) was the first NT reported ³ and is the best characterized family member. Other mammalian NTs include brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3), and neurotrophin 4/5 (NT-4/5). ¹ It is known that NTs mediate their effects by interacting with specific cell surface receptors that have been divided into two classes according to binding affinity. ⁴ The low-affinity p75 receptor is capable of binding all the NTs with similar affinity, but this protein apparently does not serve as a functional receptor for signal transduction. ⁵ NTs initiate signal transduction through one of three specific tyrosine kinase (Trk) receptors (Trk A, Trk B, and Trk C) which constitute high-affinity receptors. ⁴ The preferred receptor for each NT is: NGF/Trk A; BDNF and NT-4/Trk B; NT-3/Trk C. ^{2 4} In addition, splice variants of Trk A and truncated forms of Trk B ^{6 7} and Trk C ^{8 9 10} have been reported. Similar to p75, truncated Trk receptors have no intracellular tyrosine kinase domain and are incapable of transducing a functional signal. 

The classic NT hypothesis holds that during development neuron processes grow into their target tissue, express a single specific Trk receptor, and compete with other developing neurons for a limited supply of a single, target-derived NT. ¹¹ Successful neuron competitors survive, whereas unsuccessful neuron competitors die. Thus NTs were primarily considered to be target-derived molecules. However, the classic NT hypothesis has recently undergone significant modifications. ¹² For example, it is now clear that individual neurons can respond to more than one NT. Also, recent studies have indicated that in addition to target-derived NT acquisition, non–target-derived paracrine mechanisms of NT presentation to neurons are of critical importance. ^{13 14} In addition, NTs have been shown to act on non-neuronal cells such as astrocytes. The colocalization of Trk mRNA with the cognate NT within specific neuron cell populations such as the retinal ganglion cell ^{15 16} implies that NTs may also exert their effects through an autocrine loop. Last, there is growing information that demonstrates that NTs can be expressed by and act on non-neuronal cell populations through Trk receptors. ^{1 12} For example, NGF can act on a wide variety of blood cells including lymphocytes, monocytes, neutrophils, and basophils. ¹ It is also clear that keratinocytes, ¹⁷ skeletal and smooth muscle cells, ¹⁸ and corneal epithelial cells ¹⁹ respond to NTs. 

A common denominator for some, although not all, of the non-neural cells that are capable of expressing and/or responding to NTs is embryonic origin from the neural crest. Using immunohistochemistry for neuron specific enolase, a specific marker for cells of neural crest origin, Tripathi and Tripathi ²⁰ have shown that human trabecular meshwork (HTM) cells originate from the neural crest. Based on their embryologic origin and the fact that other neural crest–derived cells are known to express NT and/or Trk receptors, we hypothesized that HTM cells would express NT and Trk receptors. The objectives for this study were to determine whether cultured HTM cells express mRNA for NT and Trk receptors, to determine whether fresh ex vivo HTM tissues express mRNA for NT and Trk receptors, to immunolocalize NT and Trk receptor proteins in cultured HTM cells, and to determine whether HTM cells secrete NTs. 

Methods

HTM Tissue Dissection and Total Tissue RNA Isolation for Reverse Transcription–Polymerase Chain Reaction

Human donor eyes were obtained from regional eye banks within 24 hours of death. The eyes were equatorially bisected and the lens, iris, and ciliary body were removed from the anterior segment. The trabecular meshwork from each eye was obtained by making parallel cuts anterior to the scleral spur and posterior to Schwalbe’s line, using a surgical microscope. Normal human trabecular meshwork samples were obtained from one 83-, and two 85-year-old normal donors. Total RNA was obtained from the trabecular meshwork samples from each pair of donated eyes (Micro RNA Isolation Kit; Stratagene, La Jolla, CA). Approximately 3 to 5 μg of total RNA was obtained from each trabecular meshwork ribbon. Subsequently, cDNA was synthesized and used for NT and Trk receptor mRNA expression in trabecular meshwork cells and tissues. 

HTM Cell Culture

Early passaged, well characterized, normal HTM cell lines from donors of 6 days, 6 months, 2 years, 54 years, and 80 years were used in studying the mRNA expression of NT and Trk receptors. The trabecular meshwork cells were grown until confluent in Ham’s F-10 medium (JRH Biosciences, Lenexa, KS) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT), 2 mM l-glutamine (0.292 mg/ml), penicillin (100 units/ml), and streptomycin (0.1 mg/ml; Life Technologies, Grand Island, NY). Cells were incubated at 37°C in 7% CO₂-93% air. The medium was changed every 3 days. The HTM cell lines used in these studies were identical with those used by our laboratory, as previously described by Steely et al. ²¹ and Wordinger et al. ²² Propagation of the HTM cell lines was performed as described previously. ^{21 22} Briefly, number 3 Cytodex beads (Sigma, St. Louis, MO) in a 2% suspension in sterile phosphate-buffered saline (PBS) were added to confluent monolayers. Seven days later, the monolayer was gently washed through a stream of culture medium, and dislodged cell-covered beads were transferred to new plates. The cells, which remain on the original plate, were allowed to regrow into an additional monolayer. Cytodex beads have been reported to allow longer retention of trabecular cell morphology than do methods using trypsin. ²¹  

Total Cellular RNA Extraction and cDNA Synthesis

Total RNA from HTM cell lines was prepared with an RNAzol B kit (Biotex Laboratories, Houston, TX). After ethanol precipitation, the RNA was resuspended in 20 μl of water and stored at −80°C. First-strand cDNA synthesis was prepared from total cellular and trabecular meshwork tissue RNA. Initially, to reduce secondary structure, RNA (20 μg) and random primers (0.75 μg; Promega, Madison, WI) were combined and incubated at 85°C for 3 minutes. The following were then added to the reaction tube: 80 units RNasin (Promega), 40 units avian myeloblastosis virus (AMV) reverse transcriptase (Promega), 0.625 mM each deoxyribonucleotide, 50 mM Tris-HCl, 75 mM potassium chloride, 10 mM dithiothreitol, and 3 mM magnesium chloride. The reaction tube was incubated at 42°C for 30 minutes followed by an incubation at 94°C for 2 minutes. The cDNA was stored at −20°C until used for polymerase chain reaction (PCR). A PCR reaction for β-actin (described later) was performed on each cDNA sample to ensure adequate synthesis and the absence of genomic DNA. 

Primer Design

A computer program (Oligos 4.0; National Biosciences, Plymouth, MN) was used to design PCR primers that had optimal annealing temperatures and that would amplify at similar temperatures and magnesium concentrations. Table 1 lists the upstream primer, downstream primer, annealing temperature and expected PCR product size (bp) for the human NT and Trk receptor primer pairs used in this study. Human primers were designed from their GenBank sequence. Each individual primer pair sequence was submitted through the Basic Local Alignment Search Tool (BLAST) ²³ available online from the National Center for Biotechnology Information (Bethesda, MD) to verify that primers would not hybridize to any other known nucleic acid sequences under the conditions used. All primer pairs were designed so that amplification of potentially contaminating genomic DNA sequences would produce mRNA PCR products that would be substantially larger than expected, because intron sequences that were excised during RNA processing would be included in genomic DNA. To ensure adequate cDNA synthesis, a primer pair for β-actin was designed and used as an internal control. The upstream primer (5′–3′) was AGGCCAACCGCGAGAAGATGACC, and the downstream primer (5′–3′) was GAAGTCCAGGGCGACGTAGCAC. This primer pair had an optimal annealing temperature of 55°C and yielded a PCR product of 350 bp on electrophoresis. 

PCR, Horizontal Gel Electrophoresis, and Sequencing PCR Products

Details of the PCR procedure used have been published previously. ^{22 24} All samples were amplified with a primer pair specific for each growth factor receptor using a master mix containing all the components in the PCR reaction, except the target template cDNA or water negative control. All PCR reactions were prepared using a commercially available method (Taq Start Antibody Hot Start; Clontech, Palo Alto, CA) in which the target and PCR master mix solution were brought to 94°C. The Taq antibody in the kit is a neutralizing monoclonal antibody to Taq DNA polymerase and is used to inhibit polymerase activity during set-up of the PCR reaction at room temperature. The inhibition of polymerase activity is completely reversed when the temperature is raised in the first template denaturation step of thermal cycling, and the enzyme functions normally during the course of the PCR. The antibody is used to prevent nonspecific amplification of primer–dimer formation, thus enhancing the specificity and sensitivity of the PCR reaction. Control reactions without template were included with each amplification for each pair of primers. Programmable temperature cycling (PTC-100; MJ Research, Watertown, MA) was performed with the following cycle profile: denaturation for 2 minutes at 94°C followed by 92°C for 2 minutes, 40 cycles of annealing for 30 seconds at the optimal annealing temperature, extension for 90 seconds at 72°C, and denaturation for 45 seconds at 92°C. Horizontal 1.5% agarose (Life Technologies, Gaithersburg, MD) gel electrophoresis was performed using 20 μl of each PCR reaction product and 4 μl of ×10 loading buffer per lane with 150 ml gel run in 50× TAE buffer (242 g Tris base, 57.1 ml glacial acetic acid, 10.0 ml 0.5 M EDTA in 1000.0 ml Milli Q water) using a wide-cell electrophoresis system (Mini-Sub; Bio-Rad, Richmond, CA). A 100-bp DNA ladder (Life Technologies) was used as molecular size standards. Ten microliters of 10 mg/ml ethidium bromide was added to the TAE running buffer, and 100 V was applied until the loading dye had traveled two thirds of the distance to the end of the gel (approximately 60 minutes). To ensure specificity of the reverse transcription–polymerase chain reaction (RT-PCR) reaction products, nucleic acid sequencing was performed by cloning each PCR product into the TA cloning vector (Invitrogen, San Diego, CA) and sequenced (Sequenase 2.0; US Biochemical, Cleveland, OH). 

Immunohistochemical Localization of NTs and Trk Receptors in Cell Lines and Tissues

HTM cell lines were grown on glass coverslips in 24-well plates until 80% confluent and fixed in 3.5% formaldehyde (Fisher Scientific, Pittsburgh, PA) in PBS for 20 minutes for NT localization or with cold acetone for 2.0 minutes for Trk localization. Coverslips were washed with 1× PBS at least three times and then treated with 0.2% Triton X-100 (Fisher Scientific) in PBS for 5 minutes. Nonspecific binding was blocked by a 20-minute incubation with 10% normal serum in PBS. Rabbit polyclonal antibodies against specific NT or Trk receptors were obtained from Santa Cruz Laboratories (Santa Cruz, CA). Incubation with the primary antibody (1.0 mg/ml in PBS-bovine serum albumin [BSA]) was performed for 60 minutes at room temperature for NTs or overnight at 4°C for Trk receptors. After incubation with the primary antibodies, the coverslips were washed three times in PBS. The coverslips were subsequently incubated in FITC-labeled goat anti-rabbit secondary antibody (Sigma) at a concentration of 20 mg/ml in PBS-BSA for 45 minutes. After three washes in 1× PBS, the coverslips were mounted and viewed using a fluorescence microscope (Microphot-FXA; Nikon, Inc., Melville, NY) with appropriate filters. Control immunohistochemical preparations included both omission of the primary antibody and neutralization of the primary antibody with a 10-fold (by weight) excess of control peptide (Santa Cruz Laboratories) in PBS overnight at 4°C. To visualize cell nuclei, samples were incubated with 300 nM 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI) nucleic acid stain (Molecular Probes, Eugene, OR) for 5 minutes at room temperature. Samples were subsequently rinsed several times with PBS and then mounted (Vectashield; Vector, Burlingame, CA). In addition to cultured cells, two normal human eyes were also obtained in 10% PBS-buffered formalin from the Central Florida Eye Bank. The ages of the donors were 54 years and 74 years. The preservation interval from death was 3 hours 10 minutes and 3 hours 15 minutes, respectively. Eyes were bisected and embedded in paraffin and sectioned at 5 to 7 μm. Tissues sections were immunolocalized for NT and Trk receptors as indicated earlier. 

Immunoassay for NTs in HTM Cell Culture Media

Enzyme-linked immunosorbent assays (ELISAs) were used to identify NTs present in the culture media of HTM cells. A commercial immunoassay system (E_max; Promega) was used to quantitate secretion of BDNF, NGF, NT-3, and NT-4. Briefly, the immunoassay is a sandwich-type ELISA and consists of coating each well of a flat-bottomed 96-well plate (Nunc MaxiSorp-F96; Fisher Scientific, Itasca, IL) with 100 μl of the supplied NT monoclonal antibody. The wells were sealed and the plate incubated without shaking for 14 to 18 hours at 4°C. After incubation, the antibody solution was removed, the wells washed, and 200 μl of the provided blocking buffer added to each well and incubated for 1 hour without shaking at room temperature. An NT standard was provided with each assay and was used to generate a standard curve as detailed by the manufacturer. The initial standard curve for each NT ranged from 7.8 to 500 pg/ml. 

After preparation of the standard curve for each plate of culture, medium from HTM cells was centrifuged 15,000g to remove particulates and 100 μl added to four separate wells. HTM cells from passages 2 and 3 were used. The plate was sealed and incubated at room temperature on an orbital shaker (model 361; Fisher Scientific) at 100 rpm. After incubation, the wells were washed five times with buffer, and 100 μl of a secondary polyclonal antibody specific to the NT was added to each well. The plates were again sealed and incubated at room temperature for 2 hours with shaking. After incubation, the wells were washed five times with buffer and 100 μl of anti-IgG horseradish peroxidase was added to each well. The plates were incubated for 1 hour at room temperature with shaking. After incubation the wells were washed five times with buffer, and 100 μl of the enzyme substrate was added. After incubation for 10 minutes with shaking, a blue reaction color developed. The reaction was stopped by adding 100 ml of 1 M phosphoric acid to each well which coverts the blue color to yellow. The absorbance at 450 nm was recorded on an automated plate reader. 

Results

Control PCR

Each of the cDNA samples from cultured HTM cell lines (Fig. 1) and normal ex vivo HTM tissues (Fig. 2) exhibited actin PCR amplification products of the expected size (350 bp). There was no evidence of a 790-bp genomic amplification product (data not shown) indicating the absence of contaminating genomic DNA. These results demonstrate the quality of the cDNA used for PCR detection of mRNA expression. During PCR amplification reactions, control reactions were negative for amplification products, demonstrating that the PCR method and reagents used yielded specific amplified products only when a cDNA source was included. 

NT Expression in Cultured HTM Cells and Ex Vivo HTM Tissues

Figure 1 demonstrates that amplification products of the expected size for NGF (189 bp), BDNF (369 bp), and NT-3 (302 bp) were uniformly expressed in cell lines originating from the normal HTM. Amplification products for NT-4 (345 bp) were variably expressed in HTM cell cultures. The donor ages for the cell lines used in this experiment ranged from 6 days to 80 years. As seen in Figure 1 , there were no significant differences between ages in the expression of NGF and BDNF. However, NT-3 was variably expressed. The cell line derived from the 6-month-old donor barely expressed NT-3. Nucleic acid sequencing of PCR-generated products demonstrated that the amplified products were specific and derived from mRNA for the expected NTs. Figure 1 also demonstrates that identical amplification products of the expected size for NGF, BDNF, NT-3, and NT-4 were expressed by the majority of ex vivo isolated trabecular meshwork tissues originating from normal human donors. Nucleic acid sequencing of the PCR-generated products demonstrated that the amplified products were derived from mRNA for the specific NT. The profile of expression of mRNA for NTs by trabecular meshwork cell lines appeared to be similar to expression of mRNA in dissected HTM tissues. 

mRNA Expression for Full-length and Truncated Trk Receptors in Cultured HTM Cells and Ex Vivo HTM Tissues

Figure 2 demonstrates that amplification products of the expected size for the full-length Trk A (590 bp) and Trk C (266 bp) high-affinity NT receptors were expressed in both cell lines originating from the normal HTM and ex vivo tissues. No PCR reaction product for the Trk B full-length high-affinity receptor was detected in any of the cell lines or ex vivo tissues. However, expression of mRNA for Trk B was seen in the positive control sample that consisted of PC-12 cells. This indicates that the primer pair was specific for Trk B (664 bp). The donor ages for the cell lines used in this experiment ranged from 6 days to 80 years. As seen in Figure 2 , there was some variation between ages in the expression of Trk A. The 6-day, 6-month, and 80-year-old donors had expressed levels of Trk A. The expression of Trk C was more consistent among donors. Nucleic acid sequencing of PCR-generated products demonstrated that the amplified products were specific and derived from mRNA for the expected Trk receptors. 

Figure 2 also demonstrates that amplification products of the expected size for the truncated Trk B (430 bp) and truncated Trk C (572 bp) receptors were expressed in both cell lines originating from the normal HTM and ex vivo tissues. There was some variability in expression of the truncated Trk B receptor, in that the cell line originating from the 2-year-old donor did not express the truncated Trk B receptor mRNA. Also, a second lower band in truncated Trk C may represent alternatively spliced forms of truncated Trk C, because at least six isoforms of the truncated Trk C receptor have been reported. ^{1 4}  

Immunohistochemical Localization of NTs and Trk Receptors in Cultured HTM Cells

The expression of NGF/Trk A and NT-3/Trk C proteins by HTM cells was demonstrated by immunohistochemical localization and is shown in Figure 3 . HTM cells contained moderate immunohistochemical localization for both NGF and Trk A. Immunostaining appeared as a diffuse pattern within the cell cytoplasm. In contrast, immunolocalization for NT-3 appeared as distinct cytoplasmic vesicles located immediately around the nucleus. Trk C staining was diffuse and equally expressed throughout the cytoplasm. The expression of BDNF and NT-4, as well as the truncated Trk B proteins, by HTM cells was demonstrated by immunohistochemical localization and is shown in Figure 4 . It appears that HTM cells expressed both BDNF and NT-4 proteins; however, the NT-4 immunostaining was lower compared with BDNF in intensity. Truncated Trk B were immunolocalized, with the truncated isoform expressed at a much greater level. 

Immunohistochemical Localization of NTs in HTM Tissue

The expression of NT proteins within HTM tissue was demonstrated by immunolocalization and is shown in Figure 5 . HTM cells were positive for all NTs with a diffuse cytoplasmic localization pattern observed for NGF, BDNF, and NT-4 (Fig. 5) . The localization pattern for NT-3 was somewhat different. There appeared to be a specific nuclear localization pattern for this NT (Fig. 5) . Because all tissue nuclei were specifically labeled with DAPI staining, HTM cells were observed to colocalize NT-3, with DAPI reactivity resulting in a yellow staining pattern (Fig. 5) . Iris tissue was observed on the same section and nuclei present in this tissue did not express a colocalization pattern (e.g., iris nuclei were reactive for DAPI [blue] only). 

NT Secretion by Cultured HTM Cells

To verify the translation of NTs by HTM cells, the secretion of NTs by a well-characterized HTM cell line (HTM-10) was demonstrated by sensitive immunoassays (ELISA). Conditioned media from HTM-10 cells grown for 24 hours in serum-free medium were used. Because there were no significant differences in NT expression with cell passage, all data were combined. Detection of the specific NT (average ± SD) was as follows: NGF, 32.5 ± 11.0 pg/ml; BDNF, 72.0 ± 7.1 pg/ml; and NT-3, 41.7 ± 8.4 pg/ml. Each NT was replicated four times per assay with a total of two passages examined per NT. Secretion of NT-4 was not detected using an immunoassay that has a minimum detection level of 9.4 pg/ml NT-4. Secretion results for NGF, BDNF, and NT-3 were all within the normal sensitivity range of the respective NT immunoassay. These results also confirm immunohistochemical results, in that proteins for NGF, BDNF, and NT-3 are translated. 

Discussion

We have previously shown that HTM cells and ex vivo HTM tissues express growth factors ²⁵ and growth factor receptors. ^{22 24} The results of the present study showed, for the first time, that NT and high-affinity Trk receptors are also expressed within the HTM. Our results are of further significance because we have demonstrated similar PCR patterns of NT and Trk receptors in cultured HTM cells and ex vivo HTM tissues. These latter results demonstrate that cells within HTM tissues express mRNA for NT and Trk receptors and that this expression is not an artifact of cell culture. In addition, using immunoassays, we have demonstrated that cultured HTM cells are capable of secreting NTs. It is now clear that NTs are widely expressed by a variety of non-neuronal cells within the cardiovascular, endocrine, hemopoietic, reproductive, and immune systems. ²⁶ Although our knowledge of the specific role(s) NTs play in non-neuronal cells is limited, there is increasing evidence that these molecules may have major physiological roles. However, the question remains of why NT and Trk receptors are expressed within the HTM and what is their function? 

Parasympathetic, sympathetic, and sensory nerve fibers have been demonstrated to terminate within the HTM. ^{27 28 29} All regions of the HTM have been reported to contain terminal nerve fibers. ^{30 31} The anatomic location of trabecular axons has been demonstrated to be in the connective tissue core of the trabecular beams, on the surface of the trabecular beam, or crossing the trabecular spaces. ²⁷ An interesting finding indicates that trabecular axons lose their Schwann cell coverings and are surrounded by HTM cells. ²⁷ This anatomic relationship would directly facilitate a paracrine release of NTs from HTM cells and the subsequent uptake by trabecular axons through the expression of cell surface Trk receptors. Thus, the expression and secretion of NTs by cells within the HTM may represent the classic NT mechanism (e.g., synthesis and release of NTs by a target tissue for the maintenance and survival of innervating nerve fibers). The differential expression and secretion of several NTs by HTM cells would provide the means to maintain the viability of different neuron populations enervating the HTM. 

However, this explanation would not account in total for our findings, because HTM cells themselves express high-affinity Trk receptors and can respond to at least one NT. ²⁰ An alternative explanation to the classic NT mechanism may be that NT secretion and Trk receptor localization within the HTM represents unique paracrine–autocrine signaling pathways within this tissue. In this regard, our results indicate that HTM cells can be added to the growing list of non-neural cells that express NT and/or Trk receptors. One common denominator for some non-neural cells that express NT is their origin from the neural crest. Using neuron-specific enolase (NSE) expression to demonstrate differentiation from neuroectoderm, ^{32 33} Tripathi and Tripathi ²⁰ reported that HTM cells originate embryologically from the neural crest. These authors also demonstrated that NGF upregulates NSE staining in trabecular meshwork cells in culture, suggesting the presence of functional Trk A receptors. Thus, the expression of NT and Trk receptors by cells within the HTM may reflect its embryologic origin from the neural crest. In addition to the HTM and juxtacanalicular cells, several other ocular tissues appear to originate from the neural crest. These tissues include corneal endothelial cells and keratocytes, parts of the sclera, and components of the uveal tract, including choroid fibroblasts, ciliary body muscle, and iris stromal cells. ³⁴ Several of these cells and tissues are dependent on aqueous humor (AH). The presence of NT in the AH or produced locally by cells of neural crest origin may help to maintain cell viability or function. Sieber–Blum and Zhang ³⁵ have shown that growth factors and NTs affect survival, proliferation, and differentiation of neural crest cells. Thus, it is not surprising that HTM cells express NT and Trk receptors. In fact, these investigators have further demonstrated that the concerted action of combinations of growth factors and NTs, rather than individual factors acting alone, may be of greater importance. Thus NT cooperativity ¹⁴ may be critical in understanding the mechanism of action of NTs within the HTM and their possible role in maintaining the functionality of this tissue. 

The expression of high-affinity Trk receptors by HTM cells suggests their ability to respond to NTs. Our results demonstrated the presence of Trk A and Trk C and alternatively spliced isoforms for Trk B and Trk C. Although all Trk genes generate receptor isoforms through alternative splicing, little is known about their function in neural and non-neuronal cell populations. However, the apparently robust expression of truncated Trk B and Trk C by HTM cells is intriguing. The truncated Trk B receptor has been reported to be preferentially expressed in non-neural cells, whereas the full-length Trk B receptor is preferentially expressed in neurons. Our results with HTM cell lines support the non-neural expression of the truncated form of Trk B. This expression may allow HTM cells to sequester soluble NTs near the cell membrane. This would have the net effect of augmenting the levels of NTs, which could then directly interact with the full length, kinase-active Trk receptor to activate a signal pathway. This may be of importance in the HTM, because we were not able to demonstrate expression of the low-affinity p75 receptor. Conversely, some studies have indicated that truncated forms of Trk receptors may function as naturally occurring dominant negative elements of the full-length receptor. ^{6 7} As indicated by Tessarollo, ²⁶ it is interesting that the intracellular domain of the truncated Trk receptors is highly conserved between species, suggesting a functional importance. In fact, there has been one report ³⁶ that demonstrated signaling capability through truncated Trk B receptors, although the pathway was not identified. Clearly, the role of truncated Trk B and Trk C receptors within the HTM and other non-neural cells remains to be established. 

In conclusion, growth factors and growth factor receptors may play a critical role in maintaining the normal function of HTM as well as playing a role in the pathophysiology of glaucoma. The results from the present study add NT and Trk receptors as another potential signaling mechanism within this tissue. As we begin to identify the various signaling molecules produced within the HTM, the physiological complexity of the HTM becomes readily apparent. Currently, we do not know whether NT and/or Trk receptor expression or NT secretion is altered in glaucoma or under glaucomatous conditions. Future studies will be directed toward a better understanding of the role NTs play in normal and pathologic conditions within the HTM. 

 Presented at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort Lauderdale, Florida, May, 1998.

 Supported in part by Grant G19990017 of the National Glaucoma Program of the American Health Assistance Foundation, Rockville, Maryland, and Alcon Research, Ltd., Fort Worth, Texas.

 Submitted for publication September 28, 1999; revised May 23, 2000; accepted June 8, 2000.

 Commercial relationships policy: C (RJW); E (AFC); N (WL, RA, MT).

 

Table 1.

 

Expected Sizes of PCR Amplification Products with Each Human NT and Trk Receptor Primer Pair and Optimal Annealing Temperature

NT/Trk	Size (bp)	Upstream Primer (5′–3′)	Downstream Primer (5′–3′)	Annealing Temperature (C)
NGF	189	CCAAGGGAGCAGCTTTCTATCCTGG	GGCAGTGTCAAGGGAATGCTGAAGT	68.0
BDNF	369	CCTCCTCTTCTCTTTCTGCTG	AATTCTCTTTTTGCTATCCAT	54.2
NT-3	302	ACGCGGAGCATAAGAGTCACC	CCACCGCCAGCCCACGAGTTT	57.0
NT-4	345	GGGGTGAGCTGGCTGTGTGCGATGCA	CGGCTGAGGAGTGTGCAGAGCA	55.0
p75	663	AGCCAACCAGACCGTGTGTG	TTGCAGCTGTTCCACCTCTT	65.0
Trk A	591	CCCCCTTCTCCCACACTGCTA	GAACCCCAAACCTGACTCCAT	60.0
Trk B	648	CTTTTGGTAATGCTGTTTCTG	CGCGGCGATCTGCTGGGCTAT	55.5
T-TrkB	430	GGGAGGGATGAGAAACAGATT	CGGGATAAGCCAACAGCAGTC	54.0
Trk C	266	CATGAGCACATTGTCAAGTTC	GCAGTTCCTGGTGGCCAGGTC	57.0
T-Trk C	572	GTTGGTGGTTCTCTTCGTCAT	CTTCCAACCTCTCAGAGGGCC	55.3

Figure 1.

 

Ethidium bromide–stained agarose gel of NT PCR products from cDNA samples generated from cultured HTM cells and ex vivo HTM tissues from donors of various ages. NTs included nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), NT-3 (NT-3), and NT-4 (NT-4). Actin was included as an internal standard. bp, expected base pair size.

Figure 2.

 

Ethidium bromide–stained agarose gel of NT receptor (Trk) PCR products from cDNA samples generated from cultured HTM cells and ex vivo HTM tissues from donors of various ages. Trk receptors included Trk A, Trk B, Trk C, truncated Trk B, and truncated Trk C. p75 was the low affinity NT receptor. Actin was included as an internal standard. bp, expected base pair size.

Figure 3.

 

Immunohistochemical results demonstrating localization of NGF, trk A, NT-3, and Trk C in cultured HTM cells. (A, C) NGF and Trk A, respectively; (E, G) NT-3 and Trk C, respectively; (B, D, F, and H) control preparations consisting of the addition of the peptide to the primary antibody before immunolocalization.

Figure 4.

 

Immunohistochemical results demonstrating localization of BDNF, NT-4, Trk B, and truncated Trk B in cultured HTM cells. (A, C) BDNF and NT-4, respectively; (E, G) Trk B and truncated Trk B, respectively; (B, D, F, and H) control preparations consisting of the addition of the peptide to the primary antibody before immunolocalization. No truncated Trk C antibody was available for the study.

Figure 5.

 

Immunohistochemicalresults demonstrating localization of BDNF (A) and NT-3 (C, E) in HTM tissue sections; (B, D, and F) control preparations consisting of the addition of the respective peptide to the primary antibody before immunolocalization. (A) BDNF localization in HTM cells. Note the diffuse cellular localization pattern (white arrow). This staining pattern was also seen with NGF and NT-4. Nuclei (N) are blue due to DAPI localization. (B) BDNF control section. (C, E) NT-3 localization in HTM tissue sections. (C) Lower magnification of part of the anterior segment that includes the trabecular meshwork (TM) and iris (Ir). Note the co-localization of NT-3 to the nuclei of the HTM (∗) but not the nuclei (white arrows) of the iris. (D) Control for NT-3. (E) Higher magnification of NT-3 co-localization with DAPI (white arrows) nuclear staining. (F) is a control preparation for NT-3. N, nuclei; B, trabecular beams.

The authors thank Sherry English-Wright for assistance in the cell culture and dissection of the HTM and The Central Florida Lions Eye and Tissue Bank for providing the human eyes used in this study.