September 2002
Volume 43, Issue 9
Free
Biochemistry and Molecular Biology  |   September 2002
Global Gene Expression Analysis in a Mouse Model for Norrie Disease: Late Involvement of Photoreceptor Cells
Author Affiliations
  • Steffen Lenzner
    From the Max Planck Institute for Molecular Genetics, Berlin, Germany.
  • Sandra Prietz
    From the Max Planck Institute for Molecular Genetics, Berlin, Germany.
  • Silke Feil
    From the Max Planck Institute for Molecular Genetics, Berlin, Germany.
  • Ulrike A. Nuber
    From the Max Planck Institute for Molecular Genetics, Berlin, Germany.
  • H.-Hilger Ropers
    From the Max Planck Institute for Molecular Genetics, Berlin, Germany.
  • Wolfgang Berger
    From the Max Planck Institute for Molecular Genetics, Berlin, Germany.
Investigative Ophthalmology & Visual Science September 2002, Vol.43, 2825-2833. doi:https://doi.org/
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Steffen Lenzner, Sandra Prietz, Silke Feil, Ulrike A. Nuber, H.-Hilger Ropers, Wolfgang Berger; Global Gene Expression Analysis in a Mouse Model for Norrie Disease: Late Involvement of Photoreceptor Cells. Invest. Ophthalmol. Vis. Sci. 2002;43(9):2825-2833. doi: https://doi.org/.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

purpose. Mutations in the NDP gene give rise to a variety of eye diseases, including classic Norrie disease (ND), X-linked exudative vitreoretinopathy (EVRX), retinal telangiectasis (Coats disease), and advanced retinopathy of prematurity (ROP). The gene product is a cystine-knot–containing extracellular signaling molecule of unknown function. In the current study, gene expression was determined in a mouse model of ND, to unravel disease-associated mechanisms at the molecular level.

methods. Gene transcription in the eyes of 2-year-old Ndp knockout mice was compared with that in the eyes of age-matched wild-type control animals, by means of cDNA subtraction and microarrays. Clones (n = 3072) from the cDNA subtraction libraries were spotted onto glass slides and hybridized with fluorescently labeled RNA-derived targets. More than 230 differentially expressed clones were sequenced, and their expression patterns were verified by virtual Northern blot analysis.

results. Numerous gene transcripts that are absent or downregulated in the eye of Ndp knockout mice are photoreceptor cell specific. In younger Ndp knockout mice (up to 1 year old), however, all these transcripts were found to be expressed at normal levels.

conclusions. The identification of numerous photoreceptor cell–specific transcripts with a reduced expression in 2-year-old, but not in young, Ndp knockout mice indicates that normal gene expression in these light-sensitive cells of mutant mice is established and maintained over a long period and that rods and cones are affected relatively late in the mouse model of ND. Obviously, the absence of the Ndp gene product is not compatible with long-term survival of photoreceptor cells in the mouse.

Ocular symptoms of Norrie disease, a rare X-linked recessive form of congenital blindness, include bilateral leukokoria soon after birth, vascularized retrolental membranes, retinal detachment, and progressive shrinking of the eye. At least one third of affected males have mental retardation and experience progressive hearing loss in later life. 1 2 The NDP gene was isolated by positional cloning. Mutation analyses demonstrated that mental handicaps and hearing deficiencies are pleiotropic effects of a single gene defect. 3 4 5 6 Mutations in the NDP gene also account for a variety of other familial and sporadic eye diseases, including exudative vitreoretinopathy, retinopathy of prematurity, and Coats disease. 7 8 9 Disease symptoms of these traits are confined to the inner eye or retina; neither mental retardation nor deafness is observed. The predicted protein consists of 133 amino acid residues and contains an N-terminal signal sequence and a cystine-knot motif at its carboxyl-terminal end. Three-dimensional computer modeling of the amino acid sequence reveals striking similarity with transforming growth factor-β (TGFβ), 10 suggesting that this protein is involved in developmental and differentiation processes. However, the precise function of the gene has been hitherto unknown. 
Prior to the current study, we generated a mouse model for ND by homologous recombination in embryonic stem cells. 11 In the mouse, the Ndp gene is expressed in the inner layers of the retina, but also in brain and ear, as shown by RNA in situ hybridization. 11 12 Thus, the expression pattern matches the tissues affected in human disease. Morphologic characteristics in the eyes of mutant mice include retrolental structures, reduced number of retinal ganglion cells, regional disorganization of the inner nuclear and photoreceptor cell layers, and malformation of the retinal vasculature. 11 13 Electrophysiologic recordings reveal a negatively shaped b-wave of the electroretinogram, suggesting a predominant loss of inner retinal components. 14 Hearing deficits in mutant mice have also been reported. 12  
To shed more light on the cellular and molecular processes underlying ND in the eye, we compared gene expression patterns in mutant and wild-type mice by using cDNA subtraction and microarrays. These techniques enabled us to characterize hundreds of transcripts in parallel. For cDNA subtraction, we used whole-eye RNA from 2-year-old mice. Several thousand clones from the subtractions were printed on glass slides and used as probes to target cDNA from wild-type and Ndp knockout mice for differential expression. Approximately 1600 differentially expressed clones were identified and characterized in more detail. 
Methods
Animals
Ndp knockout mice were obtained by gene-targeting, as described previously. 11 Animal studies were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the regulation for animal experiments of the federal government of Germany. 
Light Microscopy
The enucleated eyes were immersion fixed for 5 hours in 2.5% glutaraldehyde in 0.05 M sodium cacodylate buffer. The cornea and lens were then removed. After postfixation in 2.5% glutaraldehyde overnight, the tissue was fixed in cacodylate-buffered osmium tetroxide (1%) for 1 hour and embedded in Spurr resin. For light microscopy analysis, 0.5-μm-thick sections were cut on a microtome (Ultracut E; Reichert-Jung, Arnsburg, Germany). Sections were stained with toluidine blue. 
RNA Extraction
Total RNA was isolated from mouse eyes with an extraction kit (RNeasy; Qiagen, Hilden, Germany). Briefly, tissues were disrupted and simultaneously homogenized (Polytron PT 3100; VWR International, Darmstadt, Germany) in lysis buffer containing guanidinium isothiocyanate. The sample was then applied to an RNA extraction column, in which the total RNA bound to the silica-gel matrix, and contaminants were efficiently washed away. High-quality RNA (longer than 200 bases) was eluted in water. 
Suppression Subtractive Hybridization
cDNAs were synthesized from 0.75 μg total RNA with a kit (Smart PCR cDNA synthesis kit; BD Biosciences-Clontech, Heidelberg, Germany). Single-stranded cDNA was amplified by long-distance PCR (Advantage cDNA PCR Kit; BD Biosciences-Clontech). Before subtraction, cDNA was size fractionated with spin columns (Chroma Spin-1000; BD Biosciences-Clontech), digested by RsaI, and purified (Nucleo Spin Extract; Macherey and Nagel, Düren, Germany). 
Subtraction was performed (PCR-Select cDNA Subtraction Kit; BD Biosciences-Clontech), according to the method described by Diatchenko et al. 15 and the manufacturer’s instructions. Two separate subtractive hybridization experiments were performed for the isolation of genes suppressed (wild-type cDNA was the tester for forward subtraction) or overexpressed (knockout cDNA was the tester for reverse subtraction) in the knockout mice, respectively. We applied 27 cycles of primary PCR and 12 cycles of secondary PCR with a cDNA polymerase mix (Advantage cDNA Polymerase Mix; BD Biosciences-Clontech). 
Subtraction Efficiency Test
A comparison of the abundance of known cDNAs before and after subtraction by hybridization analysis can be used to estimate the efficiency of subtraction. Secondary PCR products (10 μL from a 25-μL reaction) of forward- and reverse-subtracted and unsubtracted samples were separated on 1.6% agarose gels and transferred onto membranes (GeneScreenPlus; NEN Life Science Products, Köln, Germany) by alkaline transfer. Hybridizations were performed overnight with 32P-labeled cDNA probes at 65°C in 0.5 M phosphate buffer, 7% SDS, and 1 mM EDTA. 
Generation of Complete cDNAs
Complete cDNAs of five selected genes were amplified by RT-PCR using whole-eye RNA and sequence-specific primers (Pde6b: 5′-CAGTGAGGAACAGGTACGCA and 5′-AGGCAGAGTCCGTATGCAGT, 2623 bp; Bcp: 5′-GAATATCTCTTCGGTGGGGC and 5′-AGTGAGGGCCAACTTTGCTA, 1007 bp; Sag: 5′-CTGATAGGATTGCACCAGGTC and 5′-ATTTCTGGGAGGAATGCTCA, 1482 bp; Rpr1: 5′-TCAGTGGACAGCGATTCTCA and 5′-GCCCAAATAAAAATGCCAAG, 1158 bp; Xlrs1: 5′-GACCAAGGACAAGGAGAAAATGC, and 5′- TGATCCAAAGGTAGCCAGAAT, 5565 bp). 
Cloning of the Subtraction Libraries
Subtracted secondary PCR products were ligated into a plasmid vector from a T/A cloning kit (pGEM-T Easy plasmid vector; Promega, Mannheim, Germany). The resultant constructs were transformed by electroporation into XL1 Blue–competent cells (Stratagene, Heidelberg, Germany) and selected by blue–white screening. Colonies were chosen randomly, placed in 96-well plates, and grown for 16 hours in 100 μL LB medium containing ampicillin (50 μg/mL). For long-term storage (−80°C), an equal volume of glycerol was added. 
Microarray Construction
Clone inserts were PCR amplified with vector-specific standard M13 primers (M13for-TG: 5′-GTAAAACGACGGCCAGTG and M13rev-C: 5′- caggaaacagctatgacc). Subsequently, a nested PCR-reaction with 5′ amino-modified, adaptor-specific primers NPp1 (5′-amino- TCGAGCGGCCGCCCGGGCAGGT) and NPp2R (5′-amino- AGCGTGGTCGCGGCCGAGGT) was performed. Control genes (62 retina-specific genes [201 expressed sequence tags (ESTs)], 31 housekeeping genes [111 ESTs, used for normalization of fluorescence intensities], and 17 different plant cDNAs [used as the negative control and for background estimation]) were amplified with 5′ amino-modified M13 primers (M13for-TG and M13rev-C). By agarose gel electrophoresis, evaluated PCR products were ethanol precipitated, washed in 70% ethanol, air dried, and resuspended in 8 μL 100 mM sodium carbonate (pH 9). Microarrays were printed on pretreated amino-silane–coated slides (PE-Applied Biosystems, Weiterstadt, Germany) using a robotic spotting device (Beecher Instruments, Silver Spring, MD). Spotting volume was approximately 5 nL per spot, resulting in spots approximately 200 μm in diameter. 
Labeling of Targets and Microarray Hybridization
In general, targets (complete cDNAs, pools of PCR-amplified inserts, and subtraction products) were labeled by random priming in 60 μL labeling buffer containing 6.3 μg decanucleotides; 15 μM each of dGTP, dCTP, and dATP (Decalabel; MBI Fermentas, Vilnius, Lithuania); and 15 μM Cy3- or Cy5-dUTP (Amersham, Freiburg, Germany). Cy3- and Cy5-labeled targets were cohybridized on a single microarray. Each hybridization was replicated at least once, with a color swap. 
Total RNA (25 μg) was reverse transcribed by direct incorporation of fluorescent dyes in a reaction containing 1 μg oligo(dT), 100 μM Cy3- or Cy5-dUTP (Amersham), 200 μM dTTP, and 500 μM each of dGTP, dCTP, and dATP (Roche Diagnostics, Mannheim, Germany). 
Labeled products were purified with a kit (Qiaquick PCR Purification; Qiagen) and combined, and 30 μg mouse DNA enriched for repetitive sequences (mouse-COT-1 DNA; Gibco), 25 μg yeast t-RNA (Gibco), and 20 μg poly(dA-dT) were added. To block unspecific signals caused by cross-hybridization of flanking primer sequences of the subtraction products, an oligonucleotide mix containing the nested primers NPp1 and NPp2R and their complementary sequences was added. Products were dried in a speedvac, dissolved in a formamide-based hybridization buffer (50% formamide, 6× SSC, 0.5% SDS, and 5× Denhardt solution), and hybridized under a coverslip in a humid chamber for 16 hours at 42°C. Unbound targets were washed away by a 5-minute incubation in 0.01% SDS and 0.2× SSC, followed by two 5-minute incubations in 0.2× SSC at room temperature. 
Image Acquisition and Data Analysis
Hybridization signals were detected with a confocal laser scanner (model 418; Affymetrix, Santa Clara, CA). Sixteen-bit TIF-tagged images, with intensities ranging from 1 to 65,536 arbitrary units, were obtained for each dye and virtually merged by using an extension of image analysis software (IPLab Spectrum; Scanalytics, Billerica, MA). Background-corrected mean spot intensities were obtained from each processed picture using the algorithms of Chen et al. 16 Data sets were transferred to a spreadsheet computer program (Excel; Microsoft, Redmond, WA). Plant genes, clones without an insert, and empty spots were used to estimate nonspecific hybridization signals and background. Signals from clones containing mitochondrial sequences were used to normalize arrays with regard to labeling bias, differences in quantum yield, and photobleaching of the dyes. 
In the comparative analysis, transcript levels were considered significantly different when the ratio of the experimental to the control average fluorescence intensities was more than threefold and the average fluorescence intensity was greater than 1000 arbitrary units. The latter criteria minimized selection of genes that showed multifold changes over a control involving weak absolute responses (low average fluorescence intensities). 
DNA Sequencing
Putative differentially expressed clones were chosen from glycerol stocks. Plasmid DNA was prepared using a robot and a kit (model 9600 robot and Turbo kit; Qiagen). Inserts of recombinant clones were sequenced (Big Dye terminator chemistry; PE-Applied Biosystems). The sequencing gels were run (model ABI377 sequencer; PE-Applied Biosystems), and data were assembled and edited using the GAP4 Contig Editor (provided in the public domain by the Laboratory of Molecular Biology, Medical Research Council, Cambridge, UK, and available at http://www.mrc-lmb.cam.ac.uk/pubseq/manual/gap4_unix_1.html). 17 Sequences were compared with entries in the GenBank and EMBL databases by using the BLAST homology search program. 18 (GenBank is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD, and is available at http://www.ncbi.nlm.nih.gov/Genbank/; EMBL is provided in the public domain by the European Molecular Biology Laboratory, Heidelberg, Germany, and is available at http://www.embl-heidelberg.de/.) 
Virtual Northern Blot Analysis
Plasmids of individual clones were digested with RsaI (New England Biolabs, Frankfurt am Main, Germany), and inserts were recovered for hybridization experiments. PCR-amplified cDNAs (15 μL from a 100-μL reaction; Smart PCR cDNA synthesis kit; BD Biosciences-Clontech) from wild-type and Ndp knockout mice were electrophoresed, blotted, and hybridized, as described for the subtraction efficiency test. 
Results
Suppression Subtractive Hybridization, Characterization of Subtraction Libraries, and Construction of a cDNA Microarray
To identify changes in gene expression in the eyes of Ndp knockout mice, we used suppression subtractive hybridization (SSH), a subtractive hybridization technique that enriches the amount of cDNA fragments from transcripts present in one population of mRNAs (tester) but absent from another (driver). The technique simultaneously reduces fragments of equally expressed genes. Subtraction was performed in both orientations, forward (tester: wild-type whole-eye RNA) and reverse (tester: knockout whole-eye RNA). The forward subtraction was performed to identify genes downregulated or not expressed in 2-year-old knockout mice, and the reverse library was generated to recognize upregulated genes. 
From the forward-subtraction library, 96 randomly chosen clones were analyzed in an initial differential screening test by hybridizing the inserts to blots of wild-type and knockout cDNAs (virtual Northern blot analysis). A large percentage of clones (49/96; 51%) detected normal signal intensities in wild-type but no or weak signals in knockout cDNA, indicating lower levels or complete loss of expression in the eyes of knockout mice. Hybridization of 38 randomly selected clones from the reverse library revealed no expression differences between wild-type and mutant mice. Because of this result, we determined the efficiency of subtractive suppression. In addition to the subtractive enrichment, SSH excludes sequences that the tester and driver have in common (subtractive suppression). The hybridization of probes from two housekeeping genes (Gapdh and mt-Nd1) to wild-type and knockout cDNAs before and after SSH showed their reduction in both subtracted samples (Fig. 1) . To determine the enrichment rate of tester-specific fragments, we hybridized two clones from the forward-subtraction library (clones 90 and 975) to blotted cDNAs and subtraction products. The abundance of both fragments was significantly increased in the forward subtraction (Fig. 1) . In addition, we performed a PCR-based subtraction efficiency test (data not shown) and obtained consistent results. Altogether, these data demonstrate a high fidelity of cDNA subtraction in both orientations (forward and reverse subtraction). 
Because 49 of 96 clones from the forward-subtraction library were identified as differentially expressed genes (i.e., RNA transcripts present in wild-type but absent or reduced in mutant mice), we analyzed this library in more detail. The inserts of further 3072 clones were PCR-amplified and spotted together with controls onto glass slides. Subsequently, the cDNA microarray was hybridized with fluorescently labeled subtracted cDNA targets (e.g., Cy3-labeled forward-subtraction product and Cy5-labeled reverse-subtraction product, Fig. 2A ). Based on the 96 clones assessed in the previous differential screening test, criteria were defined to identify additional differentially expressed cDNA fragments (see the Methods section). On the microarray, 1565 of 3072 clones (i.e., 51%) fulfilled these criteria. Before individual inserts were tested for differential expression, redundant clones were eliminated. The full-length cDNAs of five genes (Pde6b, Opn1sw, Sag, Rpr1, and Rsh1) representing 13 of the precharacterized set of 96 clones were hybridized to the microarray. In this way, 339 of 1565 clones were excluded from further analysis. Of the remaining 1226 clones, 295 were then hybridized on virtual Northern blots. Differential expression was confirmed for 187 (63.4%) of them. Some of the corresponding transcripts were completely absent in knockout mice, whereas others showed a decreased expression level in the affected tissue (Fig. 2B) . Consistent results were obtained for more than 100 of these clones on a second pair of (wild-type and knockout) animals. 
Identity of Differentially Expressed Clones and Calculation of Number of Genes in the Microarray
All 236 confirmed differentially expressed clones (49/96 and 187/3072) were sequenced. Of those, 156 represented 83 known genes (mouse genes or human orthologues). Further, 67 clones were part of 51 different ESTs, and 13 clones did not show homology to any known sequences (sequence information provided on a Web site hosted by the Max Planck Institute for Molecular Genetics, Berlin, Germany, at http://www.molgen.mpg.de/∼norrie/iovs/welcome.html). Among known genes, structural proteins of photoreceptor cells (peripherin and rod outer membrane protein) and numerous components of the phototransduction cascade (rhodopsin, transducin, two phosphodiesterase subunits, arrestin, guanylate cyclase–activating protein, and cyclic guanosine monophosphate [cGMP] gated cation channel) were identified. The human orthologues of 13 of these transcripts have been shown to be mutated in familial forms of photoreceptor degeneration. We also found genes involved in calcium binding, signal transduction, and exocytosis, RNA-binding, apoptosis, and cytoskeleton organization. The results of sequence-based gene identification are summarized in Table 1 1 1
To estimate the number of individual transcripts in the subtraction library we ascertained the frequency of identical fragments by screening the microarray with nine pools each containing 6 to 14 individual clone inserts. On average, each fragment occurred with a frequency of two to three. Subsequently, we calculated the number of amplifiable RsaI fragments per transcript. Sequence data for 12 complete cDNAs were extracted from the database or generated by sequencing of full-length RT-PCR products. On average, each transcript contained five amplifiable RsaI fragments. Correspondingly, clones from the forward-subtraction library (n = 3072) should represent approximately 250 different transcripts. On virtual Northern blot analysis, 49 (51%) of 96 randomly selected clone inserts from the forward-subtraction library detected differentially expressed transcripts. Hence, this library contains at least 126 transcripts that are underrepresented in the eyes of knockout mice. 
Differential Gene Expression during Disease Progression
Initially, the temporal transcription pattern of the Ndp gene itself was analyzed to confirm whether the gene is active throughout life. Indeed, the transcript was detected on virtual Northern blot analysis from postnatal day 14 up to 2 years of age in the eyes of wild-type mice (Fig. 3) . As expected, no transcript was found in all Ndp knockout mice. 11 To monitor differential gene expression early in disease, the cDNA microarray was cohybridized with Cy5- and Cy3-labeled PCR-amplified cDNA targets (Smart PCR cDNA synthesis kit; BD Biosciences-Clontech) from 4-week-old Ndp knockout mice and wild-type littermates, respectively (Fig. 2C) . None of the clones on the microarray produced differential signals according to the defined criteria, whereas marked signal differences were found with PCR-amplified cDNA from 2-year-old animals (Fig. 2D)
In addition to PCR-amplified cDNAs, total RNAs from eyes of wild-type and Ndp knockout mice at 4 weeks and 2 years of age, respectively, were used as targets in hybridization experiments (data not shown). To obtain reliable sets of expression data, total RNAs from three independent pairs of animals were hybridized to separate microarrays. Again, the expression of photoreceptor-specific transcripts was drastically reduced only in 2-year-old but not in 4-week-old knockout mice. 
Subsequently, selected differentially expressed clones were hybridized to virtual Northern blots containing total eye cDNA from wild-type and mutant mice at 0.5, 1, 3, 9, 12, and 24 months of age (Fig. 3) . These genes showed normal expression levels up to 12 months. Significant reduction of transcript levels was observed only after 2 years. 
To correlate gene expression with histologic data, we examined retinal morphology in Ndp knockout mice at 24 and 29 months of age by light microscopy (Fig. 4) . All retinal layers were significantly reduced; however, remnants of photoreceptor cells were still present. 
Discussion
To search for alterations in the gene expression pattern in the eyes of Ndp knockout mice, we used RNA from 2-year-old wild-type and mutant animals for SSH, an approach that enriches the amount of differentially expressed genes. The total number of different transcripts in the forward-subtraction library and the quantity of confirmed differentially expressed genes was calculated to be approximately 250 and 126, respectively. Most likely, the absolute numbers are much higher, because numerous clones occur only once in the subtraction library. Although SSH has been reported to detect expression differences efficiently, 15 the forward-subtraction library may contain only a portion of all differentially expressed genes. Because subtractive enrichment relies on RsaI fragments of cDNAs, it apparently fails to identify transcripts that do not contain amplifiable RsaI fragments. 
Because of the advanced age of the mice (2 years), the subtraction products reflect primarily consequences of disease progression. In the forward subtraction, numerous differentially expressed genes were identified that were present in wild-type, but not in mutant, mice. Absence of specific mRNAs in the eyes of mutant mice is mainly due to disease-associated loss of particular cell types, but is also due to altered gene expression. Histologic examination of the eyes of 2-year-old Ndp knockout mice revealed that all retinal cell layers were drastically reduced but still present, including photoreceptors. Possibly, the almost complete absence of several photoreceptor-specific transcripts does not result from complete loss of photoreceptors but rather from their failure to express the characteristic set of genes. 
Although we used RNA from whole eyes for cDNA subtraction, many of the differentially expressed genes are known to be retina specific, consistent with the fact that disease processes in the Ndp knockout mouse are most conspicuous in retinal cells 11 and that the Ndp gene is highly expressed in mouse retina. Macroscopically, the eyes of Ndp knockout mice are normal, but light and electron microscopy have revealed characteristic morphologic changes in the retina and vitreous. 11 13  
Studies of the electroretinogram in young mutant mice have pointed to a defect of inner retinal components, whereas the pathologic features of photoreceptors are less pronounced. 14 By analyzing the gene expression of several photoreceptor-specific transcripts over time we found alterations only late in the disease. 
In addition to photoreceptor-specific transcripts, differentially expressed genes encode proteins involved in Fas-mediated apoptotic cell death. Bcl-2 binding protein (Bis) and Fas apoptosis inhibitory molecule (Faim) are expressed in wild-type mice at 2 years, but not in age-matched Ndp knockout mice. Both genes code for negative regulators of apoptotic pathways. Bis itself has only weak antiapoptotic activity, but enhances Bcl-2-mediated prevention of apoptosis. 19 Ectopic expression of Bcl-2 in photoreceptor cells of mice with a mutation in the peripherin (retinal degeneration slow, rds) gene protects against photoreceptor cell death. 20 It also has been shown that overexpression of Bcl-2 protects photoreceptor cells in vitro against apoptosis induced by exposure to visible light. 21 Faim was originally isolated by analyzing Fas-resistant B lymphocytes but was also shown to be expressed in other tissues and cell types. It functions as inducible mediator of Fas resistance, thereby affecting apoptotic processes. 22 Loss of the antiapoptotic functions of Bis and Faim in Ndp knockout mice may contribute to the degeneration of photoreceptor cells during disease progression. 
In summary, we identified numerous alterations in gene expression that reflect pathologic changes at the molecular level in an advanced disease stage of Ndp knockout mice. Because the Ndp gene is predominantly expressed in the inner cell layers of the adult mouse retina, and photoreceptor degeneration is seen relatively late in Ndp knockout mice, the effect of the NDP protein on rods and cones may be indirect. However, our results demonstrate that proximal retinal cell layers and continuous expression of the Ndp gene have an important function for maintenance and integrity of all retinal cell layers, in particular photoreceptor cells. 
Differentially expressed genes are involved in phototransduction, protein trafficking, RNA processing, cytoskeleton and extracellular matrix turnover, apoptosis, and exo- and endocytosis. Also, numerous novel genes were shown to be differentially expressed in Ndp knockout mice, many of which may be candidate genes for retinal diseases, and their characterization promises to provide new insights into physiological processes in the retina. Clues to the initial pathogenetic processes in ND can be expected from the analysis of subtraction libraries prepared from early disease stages. Characterization of differentially expressed cDNAs from these libraries is in progress. 
 
Figure 1.
 
Subtraction efficiency test. Virtual Northern blot analysis of four RsaI fragments from different mRNAs on wild-type and knockout mice cDNAs before and after subtraction (forward: tester is wild-type; reverse: tester is knockout). The concentrations of the housekeeping transcripts (Gapdh and mt-Nd1) were considerably lower after forward and reverse subtraction. The clone inserts 90 and 975 are RsaI fragments from different mRNAs that are absent or significantly reduced in knockout tissue. The abundance of both fragments was highly enriched during forward subtraction.
Figure 1.
 
Subtraction efficiency test. Virtual Northern blot analysis of four RsaI fragments from different mRNAs on wild-type and knockout mice cDNAs before and after subtraction (forward: tester is wild-type; reverse: tester is knockout). The concentrations of the housekeeping transcripts (Gapdh and mt-Nd1) were considerably lower after forward and reverse subtraction. The clone inserts 90 and 975 are RsaI fragments from different mRNAs that are absent or significantly reduced in knockout tissue. The abundance of both fragments was highly enriched during forward subtraction.
Figure 2.
 
(A) cDNA microarray hybridization with subtracted targets. The microarray containing 3072 PCR-amplified cDNA clones from the forward-subtraction library and controls was hybridized with fluorescently labeled forward-subtracted (Cy3) and reverse-subtracted (Cy5) targets. Green signals: genes with a higher expression in the forward-subtracted target; red signals: false positives or artifacts of the subtraction process; and yellow signals: transcripts with an equal expression in both targets. Of the 3072 clones in the microarray, 1565 fulfilled the criteria for differential expression. White boxes: cDNA clones from the forward-subtraction library representing RsaI fragments of the indicated transcripts. (B) Confirmation of differential expression on virtual Northern blot analysis. Selected cDNA clones were hybridized on Southern blots containing equal amounts of PCR-amplified cDNA from whole eyes of 2-year-old wild-type and Ndp knockout mice, respectively. A clone for alcohol dehydrogenase family-3 (Ahd3), which exhibits identical expression levels in wild-type and Ndp knockout mice served as a control. (C, D) Hybridization of cDNA microarrays with PCR-amplified whole-eye cDNA targets derived from animals at 4 weeks (C) and 2 years (D) of age. The cDNAs from wild-type and Ndp knockout mice were fluorescently labeled with Cy3 and Cy5, respectively, and cohybridized to the microarray. Numerous differentially expressed clones were detected late in disease (D), but not in young Ndp knockout mice (C).
Figure 2.
 
(A) cDNA microarray hybridization with subtracted targets. The microarray containing 3072 PCR-amplified cDNA clones from the forward-subtraction library and controls was hybridized with fluorescently labeled forward-subtracted (Cy3) and reverse-subtracted (Cy5) targets. Green signals: genes with a higher expression in the forward-subtracted target; red signals: false positives or artifacts of the subtraction process; and yellow signals: transcripts with an equal expression in both targets. Of the 3072 clones in the microarray, 1565 fulfilled the criteria for differential expression. White boxes: cDNA clones from the forward-subtraction library representing RsaI fragments of the indicated transcripts. (B) Confirmation of differential expression on virtual Northern blot analysis. Selected cDNA clones were hybridized on Southern blots containing equal amounts of PCR-amplified cDNA from whole eyes of 2-year-old wild-type and Ndp knockout mice, respectively. A clone for alcohol dehydrogenase family-3 (Ahd3), which exhibits identical expression levels in wild-type and Ndp knockout mice served as a control. (C, D) Hybridization of cDNA microarrays with PCR-amplified whole-eye cDNA targets derived from animals at 4 weeks (C) and 2 years (D) of age. The cDNAs from wild-type and Ndp knockout mice were fluorescently labeled with Cy3 and Cy5, respectively, and cohybridized to the microarray. Numerous differentially expressed clones were detected late in disease (D), but not in young Ndp knockout mice (C).
Table 1.
 
Differentially Expressed Genes
Table 1.
 
Differentially Expressed Genes
Gene Name Gene Symbol (Alternate Symbols) Accession Number Human Orthologue Function Human Chromosome Disease
Cyclic nucleotide gated channel, cGMP-gated Cncg U19717 CNGA1 Phototransduction 4p12-cen Retinitis pigmentosa
Rod photoreceptor 1 (phosducin) Rpr1 L08075 PDC Phototransduction lq25-q31.1
(Rpr-1, Pdc)
Phosphodiesterase, gamma-subunit Pde6g Y00746 PDE6G Phototransduction 17q25
(Pdeg)
Phosphodiesterase, beta-subunit Pde6b X60133 PDE6B Phototransduction 4p16.3 Retinitis pigmentosa, night blindness
(rd, rd1, Pdeb)
Guanylate kinase 1 Guk1 U53514 GUK1 Phototransduction lq32-q41
(GMK)
Rhodopsin (rod opsin, L opsin, long-wavelength sensitive opsin) Rho M55171 RHO Phototransduction 3q21-q24 Retinitis pigmentosa, night blindness
(Ops, RP4, Opn2)
Opsin 1 (cone pigment), blue cone pigment Opn1sw U49720 OPN1SW Phototransduction 7q31.3-q32 Colorblindness (tritanopia)
(Bcp)
Guanine nucleotide binding protein, alpha transducing 1 (rod transducin) Gnat1 U38504 GNAT1 Phototransduction 3p21 Night blindness
(transducin, Tralpha)
Guanine nucleotide binding protein, alpha transducing 2 (cone transducin) Gnat2 L10666 GNAT2 Phototransduction 1p13
Recoverin Rcvrn X66196 RCV1 Phototransduction 17p13.1
(CAR, S-modulin)
Guanylate cyclase activator la Guca1a L36860 GUCA1A Phototransduction 6p21.1 Cone dystrophy
(Guca1, Gcap1)
Arrestin, retinal S-antigen Sag M24086 SAG Phototransduction 2q37.1 Night blindness (Oguchi disease)
(Irbp)
Interphotoreceptor matrix proteoglycan 1 Impg1 AF229929 IMPG1 Retinal adhesion, photoreceptor survival 6q14.2-q15
(SPACR, IMP150)
Peripherin 2 (retinal degeneration slow) Prph2 X14770 RDS Structural photoreceptor protein 6p21.2-cen Retinitis pigmentosa, macular dystrophy, retinitis punctata albescens, pattern dystrophy
(Rd2, Rds)
Rod outer segment membrane protein 1 Rom1 M96760 ROM1 Structural photoreceptor protein 11q13 Retinitis pigmentosa, digenic
Calcium binding protein 5 Cabp5 AF169161 CABP5 Calcium binding, calcium homeostasis 19q13.33
Calumenin Calu U81829 CALU Calcium binding, protein folding, and sorting 7q32
Prominin Prom AF039663 PROML1 4pter-p15.31 Early-onset severe retinal degeneration
Guanine nucleotide binding protein (G protein), gamma 1 subunit Gng1 U38495 Unknown Signal transduction, G-protein–coupled receptor signaling
(G(y)1)
ADP-ribosylation-like 6 (ADP-ribosylation-like factor homologue) Arl6 AF031903 Unknown Signal transduction, Arf-like small GTPase (vesicle transport, endocytosis)
GTP binding protein 3 Gtpbp3-pending AF325354 CRFG 10p15-p14
(Crfg)
LGN protein (HSU54999) U54999 HSU54999 Guanine nucleotide exchange factor 1p36.13-q23.3
Table 1A.
 
Differentially Expressed Genes (continued)
Table 1A.
 
Differentially Expressed Genes (continued)
Zinc finger protein 289 (RIKEN cDNA 2310032E02 gene) Zfp289 AF229439 ZFP289 GTPase activating protein for Arf 11p11.2-p11.12
(2310032E02Rik)
Zinc finger protein 101 Zfp101 U07861 Unknown Regulation of gene transcription
Synaptosomal-associated protein, 25kDa Snap25 M22012 SNAP25 Exocytosis 20p12-p11.2
(sp)
N-myc downstream regulated 3 Ndr3 AB033922 FLJ13556
Karyopherin (importin) alpha 2 Kpna2 U34229 KPNA2 Intracellular protein trafficking 17q23.1-q23.3
(Rch1, importin pendulin)
FKBP-associated protein (Fap48) U73704 FAP48 Protein complex assembly, protein folding 1pter-p21.3
Guanine nucleotide binding protein, betal subunit Gnb1 U88324 Unknown
Muscleblind-like (Drosophila) Mbnl AF231110 MBNL RNA-binding protein 3q25
(EXP42, EXP40, EXP35)
CUG triplet repeat, RNA-binding protein 2 Cugbp2 AF090697 CUGBP2 RNA-binding protein 10p13
(Napor, ETR-3, Napor2)
RNA binding motif protein 7 (Rbm7) AF156098 RBM7 RNA-binding protein 11q23.1-q23.2
Fas apoptotic inhibitory molecule Faim AF130367 Unknown Apoptosis inhibitor
Bcl2-associated athanogene 3 (Bcl-2-interacting death supressor) Bag3 AF130471 BAG3 Apoptosis inhibitor 10pter-q21.3
(Bis)
BCL2/adenovirus E1B 19-kDa-interacting protein 1 Bnip2 AF035207 BNIP2 Apoptosis inhibitor 15q21.2
Retinoschisin Rs1h AF084562 XLRS1 Cell adhesion(?) Xp22.2 X-linked juvenile retinoschisis
(Xlrs1)
Translocase of outer mitochondrial membrane KIAA0016 D13641 TOM20 Mitochondrial protein import 1q42
(TOM20)
RFamide-related peptide Rfrp AB040289 (RFRP) Neuropeptide 7p21-p15
Elongation of very long chain fatty acids-like 4 (ElovL4) AF277094 ELOVL4 Fatty acid biosynthesis 6q14 Macular dystrophy (Stargardt disease 3)
(STGD3, STGD2, ADMD)
HSPC016: hypothetical protein (Hspc016) AF077202 HSPC016 3p21.33-3p21.1
Erythrocyte protein band 4.1-like 2 Epb4.112 AF044312 EPB41L2 Cytoskeleton, structural protein 6q23
(4.1G, NBL)
Capping protein alpha 2 Cappa2 U16741 CAPZA2 Cytoskeleton, actin-binding, actin filament organization 7q31.2-q31.3
Keratin complex 1, acidic, gene 13 Krt1–13 U13921 KRTI3 Cytoskeleton, organization, and biogenesis 17q21-q23
Table 1B.
 
Differentially Expressed Genes (continued)
Table 1B.
 
Differentially Expressed Genes (continued)
CD151 antigen Cd151 D89290 CD151 Transmembrane signaling and cell adhesion 11p15.5
(SFA-1, PETA-3)
Dynactin 6 Dctn6 AF124788 (WS-3) Mitochondrial biogenesis 8p12-p11
(p27, WS-3)
N-ethylmalemide sensitive fusion protein Nsf BC006627 NSF 17q21
(SKD2)
Membrane protein, palmitoylated 4 (MAGUK p55 subfamily member4) Mpp4 AB059357 MPP4 2q33.2
(Dlg6a)
1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat3 AK015906 AGPAT3 Metabolism of plasma lipoproteins 21q22.3
(D10Jhu12e)
ATPase, H+ transporting, lysosomal 1 Atp6c1 U13839 ATP6C Transporter 8p22-q21.3
Budding uninhibited by benzimidazoles 1 homologue, beta (S. cerevisiae) Bub1b AF107296 BUB1B Cell cycle, normal mitotic progression 15q15
FBJ osteosarcoma oncogene B Fosb X14897 FOSB Regulator of cell proliferation, differentiation, and transformation 19q13.32
Alpha glucosidase 2, alpha neutral subunit G2an U92793 (KIAA0088) 11q12.2
Heterogeneous nuclear ribonucleoprotein U Hnrpu AF073992 HNRPU RNA processing 1q44
Potassium large-conductance calcium-activated channel, subfamily M Kcnma1 U09383 KCNMA1 10q22
(mSlo1)
Lactate dehydrogenase 1, A chain Ldh1 U13687 LDHA Anaerobic glycolysis 11p15.4
(Ldha)
Myocyte enhancer factor 2C Mef2c L13171 MEF2C Transcription factor 5q14
Meningioma-expressed antigen 5 (hyaluronidase) Mgea5 AK014781 MGEA5 Glycoprotein degradation 10q24.1-q24.3
NMDA receptor-regulated gene 1 Narg1-pending AK017653 Unknown 4q28.3
(Tbdn-1)
Ornithine decarboxylase, structural Odc M10624 ODC1 Polyamine biosynthesis pathway 2p25
Origin recognition complex, subunit 6 homologue (Saccharomyces cervisiae) Orc6-pending AF139659 ORC6L 16q12
Pyruvate kinase 3 Pk3 X97047 PKM2 Glycolysis 15q22
Protease, serine, 18 Prss18 AB015206 Unknown
(Bssp)
Secretory carrier membrane protein 1 Scamp1 AK015706 SCAMP Exocytosis, vesicular transport 5q13.3-q14.1
Phosphoserine/threonine/tyrosine interaction protein Styx AK002822 STYX
(hStyxb)
Figure 3.
 
Gene expression analysis during disease progression. The Ndp cDNA and four other confirmed differential clones (representing Bcp, Pde, Rpr1, and Sag) were hybridized to virtual Northern blots containing whole-eye cDNA from wild-type and Ndp knockout mice at 0.5, 1, 3, 9, 12, and 24 months of age. The Ndp transcript is only present in wild-type mice. All others genes show normal expression up to 12 months. Only in the oldest (2-year-old) Ndp knockout mice were the expression levels drastically reduced. Gapdh served as the control.
Figure 3.
 
Gene expression analysis during disease progression. The Ndp cDNA and four other confirmed differential clones (representing Bcp, Pde, Rpr1, and Sag) were hybridized to virtual Northern blots containing whole-eye cDNA from wild-type and Ndp knockout mice at 0.5, 1, 3, 9, 12, and 24 months of age. The Ndp transcript is only present in wild-type mice. All others genes show normal expression up to 12 months. Only in the oldest (2-year-old) Ndp knockout mice were the expression levels drastically reduced. Gapdh served as the control.
Figure 4.
 
Light micrographs of mouse retinas from a 16-month-old male wild-type (A), a 24-month-old male Ndp knockout (B), and a 29-month-old female homozygote Ndp knockout (C) mouse. The retinas of Ndp knockout animals (B, C) showed a drastic degeneration of all retinal cell layers, particularly of the photoreceptor inner and outer segments. Sections were stained with toluidine blue. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; OS, outer segment; RPE, retinal pigment epithelium. Scale bar, 50 μm.
Figure 4.
 
Light micrographs of mouse retinas from a 16-month-old male wild-type (A), a 24-month-old male Ndp knockout (B), and a 29-month-old female homozygote Ndp knockout (C) mouse. The retinas of Ndp knockout animals (B, C) showed a drastic degeneration of all retinal cell layers, particularly of the photoreceptor inner and outer segments. Sections were stained with toluidine blue. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; OS, outer segment; RPE, retinal pigment epithelium. Scale bar, 50 μm.
The authors thank Wolfgang Mann and Roland Kirchner for advice on microarray technology and data analysis; Renate Kirschner, Ulrich Luhmann, and Christina Zeitz for helpful discussions and critical reading of the manuscript; and Ralph Schulz, Jens Fassen, Gerhild Lüder, and Rudi Lurz for technical assistance. 
Warburg M. Norrie’s disease: a new hereditary bilateral pseudotumour of the retina. Acta Ophthalmol. 1961;39:757–772.
Warburg M. Norrie’s disease: a congenital progressive oculo-acoustico-cerebral degeneration. Acta Ophthalmol. 1966;89(suppl)1–147.
Berger W, Meindl A, van de Pol TJR, et al. Isolation of a candidate gene for Norrie disease by positional cloning. Nat Genet. 1992;1:199–203. [CrossRef] [PubMed]
Chen Z-Y, Hendriks RW, Jobling MA, et al. Isolation and characterization of a candidate gene for Norrie disease. Nat Genet. 1992;1:204–208. [CrossRef] [PubMed]
Berger W, van de Pol D, Warburg M, et al. Mutations in the candidate gene for Norrie disease. Hum Mol Genet. 1992;1:461–465. [CrossRef] [PubMed]
Schuback DE, Chen Z-Y, Craig IW, Breakefield XO, Sims KB. Mutations in the Norrie disease gene. Hum Mutat. 1995;5:285–292. [CrossRef] [PubMed]
Chen Z-Y, Battinelli EM, Fielder A, et al. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy. Nat Genet. 1993;5:180–183. [CrossRef] [PubMed]
Shastry BS, Pendergast SD, Hartzer MK, Liu X, Trese MT. Identification of missense mutations in the Norrie disease gene associated with advanced retinopathy of prematurity. Arch Ophthalmol. 1997;115:651–655. [CrossRef] [PubMed]
Black GCM, Perveen R, Bonshek R, et al. Coats’ disease of the retina (unilateral retinal telangiectasis) caused by somatic mutation in the NDP gene: a role for norrin in retinal angiogenesis. Hum Mol Genet. 1999;8:2031–2035. [CrossRef] [PubMed]
Meitinger T, Meindl A, Bork P, et al. Molecular modelling of the Norrie disease protein predicts a cystine knot growth factor tertiary structure. Nat Genet. 1993;5:376–380. [CrossRef] [PubMed]
Berger W, van de Pol D, Bächner D, et al. An animal model for Norrie disease (ND): gene targeting of the mouse ND gene. Hum Mol Genet. 1996;5:51–59. [CrossRef] [PubMed]
Chen Z-Y, Adams JC, Ropers H-H, Brown MC, Berger W, Corey DC. Inner ear pathology in the Norrie knockout mouse supports the role of norrin as a growth factor required for survival and maintenance of cells. Am J Hum Genet. 1998;63(suppl)2057.
Richter M, Gottanka J, May CA, Welge-Lüssen U, Berger W, Lütjen-Drecoll E. Retinal vasculature changes in Norrie-disease mice. Invest Ophthalmol Vis Sci. 1998;39:2450–2457. [PubMed]
Ruether K, van de Pol D, Jaissle G, Berger W, Tornow RP, Zrenner E. Retinoschisis-like alterations in the mouse eye due to gene targeting of the Norrie disease (ND) gene. Invest Ophthalmol Vis Sci. 1997;38:710–718. [PubMed]
Diatchenko L, Lau YF, Campbell AP, et al. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA. 1996;93:6025–6030. [CrossRef] [PubMed]
Chen Y, Dougherty ER, Bittner ML. Ratio-based decisions and the quantitative analysis of cDNA microarray images. Biomed Opt. 1997;2:364–374. [CrossRef]
Bonfield JK, Smith K, Staden R. A new DNA sequence assembly program. Nucleic Acids Res. 1995;23:4992–4999. [CrossRef] [PubMed]
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. [CrossRef] [PubMed]
Lee JH, Takahashi T, Yasuhara N, Inazawa J, Kamada S, Tsujimoto Y. Bis, a Bcl-2-binding protein that synergizes with Bcl-2 in preventing cell death. Oncogene. 1999;18:6183–6190. [CrossRef] [PubMed]
Nir I, Kedzierski W, Chen J, Travis GH. Expression of Bcl-2 protects against photoreceptor degeneration in retinal degeneration slow (rds) mice. J Neurosci. 2000;20:2150–2154. [PubMed]
Crawford MJ, Krishnamoorthy RR, Rudick VL, et al. Bcl-2 overexpression protects photooxidative stress-induced apoptosis of photoreceptor cells via NF-kappaB preservation. Biochem Biophys Res Commun. 2001;281:1304–1312. [CrossRef] [PubMed]
Schneider TJ, Fischer GM, Donohoe TJ, Colarusso TP, Rothstein TL. A novel gene coding for a Fas apoptosis inhibitory molecule (FAIM) isolated from inducibly Fas-resistant B lymphocytes. J Exp Med. 1999;189:949–956. [CrossRef] [PubMed]
Figure 1.
 
Subtraction efficiency test. Virtual Northern blot analysis of four RsaI fragments from different mRNAs on wild-type and knockout mice cDNAs before and after subtraction (forward: tester is wild-type; reverse: tester is knockout). The concentrations of the housekeeping transcripts (Gapdh and mt-Nd1) were considerably lower after forward and reverse subtraction. The clone inserts 90 and 975 are RsaI fragments from different mRNAs that are absent or significantly reduced in knockout tissue. The abundance of both fragments was highly enriched during forward subtraction.
Figure 1.
 
Subtraction efficiency test. Virtual Northern blot analysis of four RsaI fragments from different mRNAs on wild-type and knockout mice cDNAs before and after subtraction (forward: tester is wild-type; reverse: tester is knockout). The concentrations of the housekeeping transcripts (Gapdh and mt-Nd1) were considerably lower after forward and reverse subtraction. The clone inserts 90 and 975 are RsaI fragments from different mRNAs that are absent or significantly reduced in knockout tissue. The abundance of both fragments was highly enriched during forward subtraction.
Figure 2.
 
(A) cDNA microarray hybridization with subtracted targets. The microarray containing 3072 PCR-amplified cDNA clones from the forward-subtraction library and controls was hybridized with fluorescently labeled forward-subtracted (Cy3) and reverse-subtracted (Cy5) targets. Green signals: genes with a higher expression in the forward-subtracted target; red signals: false positives or artifacts of the subtraction process; and yellow signals: transcripts with an equal expression in both targets. Of the 3072 clones in the microarray, 1565 fulfilled the criteria for differential expression. White boxes: cDNA clones from the forward-subtraction library representing RsaI fragments of the indicated transcripts. (B) Confirmation of differential expression on virtual Northern blot analysis. Selected cDNA clones were hybridized on Southern blots containing equal amounts of PCR-amplified cDNA from whole eyes of 2-year-old wild-type and Ndp knockout mice, respectively. A clone for alcohol dehydrogenase family-3 (Ahd3), which exhibits identical expression levels in wild-type and Ndp knockout mice served as a control. (C, D) Hybridization of cDNA microarrays with PCR-amplified whole-eye cDNA targets derived from animals at 4 weeks (C) and 2 years (D) of age. The cDNAs from wild-type and Ndp knockout mice were fluorescently labeled with Cy3 and Cy5, respectively, and cohybridized to the microarray. Numerous differentially expressed clones were detected late in disease (D), but not in young Ndp knockout mice (C).
Figure 2.
 
(A) cDNA microarray hybridization with subtracted targets. The microarray containing 3072 PCR-amplified cDNA clones from the forward-subtraction library and controls was hybridized with fluorescently labeled forward-subtracted (Cy3) and reverse-subtracted (Cy5) targets. Green signals: genes with a higher expression in the forward-subtracted target; red signals: false positives or artifacts of the subtraction process; and yellow signals: transcripts with an equal expression in both targets. Of the 3072 clones in the microarray, 1565 fulfilled the criteria for differential expression. White boxes: cDNA clones from the forward-subtraction library representing RsaI fragments of the indicated transcripts. (B) Confirmation of differential expression on virtual Northern blot analysis. Selected cDNA clones were hybridized on Southern blots containing equal amounts of PCR-amplified cDNA from whole eyes of 2-year-old wild-type and Ndp knockout mice, respectively. A clone for alcohol dehydrogenase family-3 (Ahd3), which exhibits identical expression levels in wild-type and Ndp knockout mice served as a control. (C, D) Hybridization of cDNA microarrays with PCR-amplified whole-eye cDNA targets derived from animals at 4 weeks (C) and 2 years (D) of age. The cDNAs from wild-type and Ndp knockout mice were fluorescently labeled with Cy3 and Cy5, respectively, and cohybridized to the microarray. Numerous differentially expressed clones were detected late in disease (D), but not in young Ndp knockout mice (C).
Figure 3.
 
Gene expression analysis during disease progression. The Ndp cDNA and four other confirmed differential clones (representing Bcp, Pde, Rpr1, and Sag) were hybridized to virtual Northern blots containing whole-eye cDNA from wild-type and Ndp knockout mice at 0.5, 1, 3, 9, 12, and 24 months of age. The Ndp transcript is only present in wild-type mice. All others genes show normal expression up to 12 months. Only in the oldest (2-year-old) Ndp knockout mice were the expression levels drastically reduced. Gapdh served as the control.
Figure 3.
 
Gene expression analysis during disease progression. The Ndp cDNA and four other confirmed differential clones (representing Bcp, Pde, Rpr1, and Sag) were hybridized to virtual Northern blots containing whole-eye cDNA from wild-type and Ndp knockout mice at 0.5, 1, 3, 9, 12, and 24 months of age. The Ndp transcript is only present in wild-type mice. All others genes show normal expression up to 12 months. Only in the oldest (2-year-old) Ndp knockout mice were the expression levels drastically reduced. Gapdh served as the control.
Figure 4.
 
Light micrographs of mouse retinas from a 16-month-old male wild-type (A), a 24-month-old male Ndp knockout (B), and a 29-month-old female homozygote Ndp knockout (C) mouse. The retinas of Ndp knockout animals (B, C) showed a drastic degeneration of all retinal cell layers, particularly of the photoreceptor inner and outer segments. Sections were stained with toluidine blue. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; OS, outer segment; RPE, retinal pigment epithelium. Scale bar, 50 μm.
Figure 4.
 
Light micrographs of mouse retinas from a 16-month-old male wild-type (A), a 24-month-old male Ndp knockout (B), and a 29-month-old female homozygote Ndp knockout (C) mouse. The retinas of Ndp knockout animals (B, C) showed a drastic degeneration of all retinal cell layers, particularly of the photoreceptor inner and outer segments. Sections were stained with toluidine blue. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; OS, outer segment; RPE, retinal pigment epithelium. Scale bar, 50 μm.
Table 1.
 
Differentially Expressed Genes
Table 1.
 
Differentially Expressed Genes
Gene Name Gene Symbol (Alternate Symbols) Accession Number Human Orthologue Function Human Chromosome Disease
Cyclic nucleotide gated channel, cGMP-gated Cncg U19717 CNGA1 Phototransduction 4p12-cen Retinitis pigmentosa
Rod photoreceptor 1 (phosducin) Rpr1 L08075 PDC Phototransduction lq25-q31.1
(Rpr-1, Pdc)
Phosphodiesterase, gamma-subunit Pde6g Y00746 PDE6G Phototransduction 17q25
(Pdeg)
Phosphodiesterase, beta-subunit Pde6b X60133 PDE6B Phototransduction 4p16.3 Retinitis pigmentosa, night blindness
(rd, rd1, Pdeb)
Guanylate kinase 1 Guk1 U53514 GUK1 Phototransduction lq32-q41
(GMK)
Rhodopsin (rod opsin, L opsin, long-wavelength sensitive opsin) Rho M55171 RHO Phototransduction 3q21-q24 Retinitis pigmentosa, night blindness
(Ops, RP4, Opn2)
Opsin 1 (cone pigment), blue cone pigment Opn1sw U49720 OPN1SW Phototransduction 7q31.3-q32 Colorblindness (tritanopia)
(Bcp)
Guanine nucleotide binding protein, alpha transducing 1 (rod transducin) Gnat1 U38504 GNAT1 Phototransduction 3p21 Night blindness
(transducin, Tralpha)
Guanine nucleotide binding protein, alpha transducing 2 (cone transducin) Gnat2 L10666 GNAT2 Phototransduction 1p13
Recoverin Rcvrn X66196 RCV1 Phototransduction 17p13.1
(CAR, S-modulin)
Guanylate cyclase activator la Guca1a L36860 GUCA1A Phototransduction 6p21.1 Cone dystrophy
(Guca1, Gcap1)
Arrestin, retinal S-antigen Sag M24086 SAG Phototransduction 2q37.1 Night blindness (Oguchi disease)
(Irbp)
Interphotoreceptor matrix proteoglycan 1 Impg1 AF229929 IMPG1 Retinal adhesion, photoreceptor survival 6q14.2-q15
(SPACR, IMP150)
Peripherin 2 (retinal degeneration slow) Prph2 X14770 RDS Structural photoreceptor protein 6p21.2-cen Retinitis pigmentosa, macular dystrophy, retinitis punctata albescens, pattern dystrophy
(Rd2, Rds)
Rod outer segment membrane protein 1 Rom1 M96760 ROM1 Structural photoreceptor protein 11q13 Retinitis pigmentosa, digenic
Calcium binding protein 5 Cabp5 AF169161 CABP5 Calcium binding, calcium homeostasis 19q13.33
Calumenin Calu U81829 CALU Calcium binding, protein folding, and sorting 7q32
Prominin Prom AF039663 PROML1 4pter-p15.31 Early-onset severe retinal degeneration
Guanine nucleotide binding protein (G protein), gamma 1 subunit Gng1 U38495 Unknown Signal transduction, G-protein–coupled receptor signaling
(G(y)1)
ADP-ribosylation-like 6 (ADP-ribosylation-like factor homologue) Arl6 AF031903 Unknown Signal transduction, Arf-like small GTPase (vesicle transport, endocytosis)
GTP binding protein 3 Gtpbp3-pending AF325354 CRFG 10p15-p14
(Crfg)
LGN protein (HSU54999) U54999 HSU54999 Guanine nucleotide exchange factor 1p36.13-q23.3
Table 1A.
 
Differentially Expressed Genes (continued)
Table 1A.
 
Differentially Expressed Genes (continued)
Zinc finger protein 289 (RIKEN cDNA 2310032E02 gene) Zfp289 AF229439 ZFP289 GTPase activating protein for Arf 11p11.2-p11.12
(2310032E02Rik)
Zinc finger protein 101 Zfp101 U07861 Unknown Regulation of gene transcription
Synaptosomal-associated protein, 25kDa Snap25 M22012 SNAP25 Exocytosis 20p12-p11.2
(sp)
N-myc downstream regulated 3 Ndr3 AB033922 FLJ13556
Karyopherin (importin) alpha 2 Kpna2 U34229 KPNA2 Intracellular protein trafficking 17q23.1-q23.3
(Rch1, importin pendulin)
FKBP-associated protein (Fap48) U73704 FAP48 Protein complex assembly, protein folding 1pter-p21.3
Guanine nucleotide binding protein, betal subunit Gnb1 U88324 Unknown
Muscleblind-like (Drosophila) Mbnl AF231110 MBNL RNA-binding protein 3q25
(EXP42, EXP40, EXP35)
CUG triplet repeat, RNA-binding protein 2 Cugbp2 AF090697 CUGBP2 RNA-binding protein 10p13
(Napor, ETR-3, Napor2)
RNA binding motif protein 7 (Rbm7) AF156098 RBM7 RNA-binding protein 11q23.1-q23.2
Fas apoptotic inhibitory molecule Faim AF130367 Unknown Apoptosis inhibitor
Bcl2-associated athanogene 3 (Bcl-2-interacting death supressor) Bag3 AF130471 BAG3 Apoptosis inhibitor 10pter-q21.3
(Bis)
BCL2/adenovirus E1B 19-kDa-interacting protein 1 Bnip2 AF035207 BNIP2 Apoptosis inhibitor 15q21.2
Retinoschisin Rs1h AF084562 XLRS1 Cell adhesion(?) Xp22.2 X-linked juvenile retinoschisis
(Xlrs1)
Translocase of outer mitochondrial membrane KIAA0016 D13641 TOM20 Mitochondrial protein import 1q42
(TOM20)
RFamide-related peptide Rfrp AB040289 (RFRP) Neuropeptide 7p21-p15
Elongation of very long chain fatty acids-like 4 (ElovL4) AF277094 ELOVL4 Fatty acid biosynthesis 6q14 Macular dystrophy (Stargardt disease 3)
(STGD3, STGD2, ADMD)
HSPC016: hypothetical protein (Hspc016) AF077202 HSPC016 3p21.33-3p21.1
Erythrocyte protein band 4.1-like 2 Epb4.112 AF044312 EPB41L2 Cytoskeleton, structural protein 6q23
(4.1G, NBL)
Capping protein alpha 2 Cappa2 U16741 CAPZA2 Cytoskeleton, actin-binding, actin filament organization 7q31.2-q31.3
Keratin complex 1, acidic, gene 13 Krt1–13 U13921 KRTI3 Cytoskeleton, organization, and biogenesis 17q21-q23
Table 1B.
 
Differentially Expressed Genes (continued)
Table 1B.
 
Differentially Expressed Genes (continued)
CD151 antigen Cd151 D89290 CD151 Transmembrane signaling and cell adhesion 11p15.5
(SFA-1, PETA-3)
Dynactin 6 Dctn6 AF124788 (WS-3) Mitochondrial biogenesis 8p12-p11
(p27, WS-3)
N-ethylmalemide sensitive fusion protein Nsf BC006627 NSF 17q21
(SKD2)
Membrane protein, palmitoylated 4 (MAGUK p55 subfamily member4) Mpp4 AB059357 MPP4 2q33.2
(Dlg6a)
1-acylglycerol-3-phosphate O-acyltransferase 3 Agpat3 AK015906 AGPAT3 Metabolism of plasma lipoproteins 21q22.3
(D10Jhu12e)
ATPase, H+ transporting, lysosomal 1 Atp6c1 U13839 ATP6C Transporter 8p22-q21.3
Budding uninhibited by benzimidazoles 1 homologue, beta (S. cerevisiae) Bub1b AF107296 BUB1B Cell cycle, normal mitotic progression 15q15
FBJ osteosarcoma oncogene B Fosb X14897 FOSB Regulator of cell proliferation, differentiation, and transformation 19q13.32
Alpha glucosidase 2, alpha neutral subunit G2an U92793 (KIAA0088) 11q12.2
Heterogeneous nuclear ribonucleoprotein U Hnrpu AF073992 HNRPU RNA processing 1q44
Potassium large-conductance calcium-activated channel, subfamily M Kcnma1 U09383 KCNMA1 10q22
(mSlo1)
Lactate dehydrogenase 1, A chain Ldh1 U13687 LDHA Anaerobic glycolysis 11p15.4
(Ldha)
Myocyte enhancer factor 2C Mef2c L13171 MEF2C Transcription factor 5q14
Meningioma-expressed antigen 5 (hyaluronidase) Mgea5 AK014781 MGEA5 Glycoprotein degradation 10q24.1-q24.3
NMDA receptor-regulated gene 1 Narg1-pending AK017653 Unknown 4q28.3
(Tbdn-1)
Ornithine decarboxylase, structural Odc M10624 ODC1 Polyamine biosynthesis pathway 2p25
Origin recognition complex, subunit 6 homologue (Saccharomyces cervisiae) Orc6-pending AF139659 ORC6L 16q12
Pyruvate kinase 3 Pk3 X97047 PKM2 Glycolysis 15q22
Protease, serine, 18 Prss18 AB015206 Unknown
(Bssp)
Secretory carrier membrane protein 1 Scamp1 AK015706 SCAMP Exocytosis, vesicular transport 5q13.3-q14.1
Phosphoserine/threonine/tyrosine interaction protein Styx AK002822 STYX
(hStyxb)
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×