Genetic Polymorphisms in the Angiotensin II Receptor Gene and Their Association with Open-Angle Glaucoma in a Japanese Population

Abstract

purpose. The local renin–angiotensin system (RAS) is present in the ciliary body and plays a role in regulating aqueous humor dynamics and thus intraocular pressure (IOP). The purpose of this study was to determine whether gene polymorphisms in the RAS increase the risk of development of glaucoma in the Japanese.

methods. A case–control study was performed in 698 Japanese subjects: 190 patients with primary open-angle glaucoma (POAG), 268 patients with normal-tension glaucoma (NTG), and 240 normal subjects. Ten polymorphisms in seven genes—AGT/Thr174Met and AGT/Met235Thr; REN/I8-83G→A; ACE/insertion(I)-deletion(D); CMA/−1930A→G; AGTR1/−731T→G, AGTR1/−521C→T, and AGTR1/1166A→C; AGTR2/3123C→A; and CYP11B2/−344T→C were examined. The age, IOP, and visual field defects, all at diagnosis, were examined to determine whether they were associated with the polymorphisms. The effects of oral angiotensin II receptor blocker (ARB) on IOP were examined in association with the AGTR1 and AGTR2 polymorphisms in 20 normal subjects.

results. Of the 10 polymorphisms, the AGTR2/3123C→A polymorphisms had a significantly different distribution in female patients with NTG; the frequency of the CA+AA genotypes was significantly higher than in female control subjects (P = 0.0095 for CC versus CA+AA). Although no significant difference was seen in the clinical characteristics of female patients with NTG who carried the AGTR2/3123C→A genotype, patients with CC in the AGTR2 gene had significantly worse visual field scores if they carried ACE/ID+DD (i.e., D carriers; P = 0.012). ARB significantly lowered IOP in normal subjects, but the male subjects with the AGTR2/3123A genotype had significantly less lowering of IOP than those with the C genotype (P = 0.014).

conclusions. Angiotensin II receptor gene polymorphisms may be associated with the risk of glaucoma in the Japanese population.

Open-angle glaucoma (OAG), the second most common cause of blindness worldwide, affects more than 100 million people, almost 2% of the global population older than 40 years. ¹ The disease is characterized by an elevation of intraocular pressure (IOP) to >21 mm Hg, resulting in an excavation of the optic disc, which is associated with visual field changes. Patients with these findings have a diagnosis of primary open-angle glaucoma (POAG). Normal-tension glaucoma (NTG) is a form of OAG in which the typical glaucomatous cupping of the optic nerve head and visual field loss are present, but IOP does not exceed 21 mm Hg at any time. ²  

The risk factors for glaucoma include high IOP, advanced age, ethnicity, positive family history, myopia, presence of diabetes and/or hypertension, and specific genetic factors. ^{3 4 5 6} Although the exact pathogenesis of glaucomatous optic neuropathy remains uncertain, IOP is generally considered to be a major risk factor, ⁷ and thus, current treatments for glaucoma consist of interventions to lower IOP. ⁸ However, in some patients with glaucoma—for example, those with NTG or advanced POAG—the reduction of IOP does not prevent progression of the disease, ^{9 10} which indicates that factors other than an elevated IOP are involved in the progression of glaucoma. ¹¹  

The association of glaucoma with various systemic vascular diseases including low systemic blood pressure, transient nocturnal decreases in blood pressure, hypertension, migraine, vasospasm, and diabetes have been reported. ^{6 11 12 13} The presence of optic disc hemorrhages in patients with NTG suggests that vascular insufficiency is probably involved in the development and progression of NTG. ^{13 14} Many patients with OAG have coexisting vascular disorders, and the most common is systemic hypertension, which occurs in 48% of the total OAG population. ¹⁵  

The renin–angiotensin–aldosterone (RAA) system is involved in vasoconstriction, regulation of electrolyte balance, and vascular remodeling. Local renin–angiotensin (RA) regulation is present in the eye. ^{16 17} Angiotensin II (ATII) is a potent vasoconstrictive agent, and recently two RAS components, angiotensin-converting enzyme (ACE) and ATII, have been identified in the human ciliary body and aqueous humor. ^{18 19} These findings suggest that the RA system (RAS) is probably involved in the regulation of aqueous humor dynamics and thus IOP. This interpretation is strongly supported by the observation that local or systemic ACE inhibitors ²⁰ and ATII receptor blockers (ARBs) lower IOP. ^{21 22}  

The purpose of this study was to determine whether single-nucleotide polymorphisms (SNPs) or insertion–deletion (I/D) polymorphisms in the seven RAA system genes are associated with OAG in the Japanese population. In addition, SNPs in the ATII receptor gene were studied to determine whether they are associated with the reduction of IOP after the oral administration of ARB. 

Subjects and Methods

Patients and Control Subjects

Blood samples were collected from 698 subjects at seven Japanese ophthalmologic institutions. The subjects included 190 patients with POAG, 268 patients with NTG, and 240 normal control subjects. None of the subjects was related to any other. The research procedures followed the tenets of the Declaration of Helsinki, and written informed consent was obtained after the nature and possible consequences of the study were explained. Where applicable, the research was approved by the local institutional human experimentation committee. 

The clinical features recorded in the patients with glaucoma were age at diagnosis, untreated maximum IOP (defined as IOP at diagnosis), and visual field defects at the initial examination (defined as visual field defects at diagnosis; Table 1 ). The severity of the visual field defects was scored from 1 to 5. ^{23 24} Data obtained with different perimeters were combined using a five-point scale defined as follows: 1, no alteration; 2, early defect; 3, moderate defect; 4, severe defect; and 5, light perception only or no vision. Field defects were judged to be early, moderate, or severe, according to the classification of Kosaki et al. ²⁵ and Hosoda et al., ²⁶ based on the results of Goldmann perimetry or the classification used by the Humphrey field analyzer. ²⁷ The former classification is the most widely used in Japan. 

The mean age at the time of blood sampling was 65.3 ± 11.9 (SD) years in the patients with POAG, 58.8 ± 13.4 years in the patients with NTG, and 69.7 ± 11.2 years in the normal subjects. The normal control subjects were selected to be significantly older than the patients with POAG (P < 0.001) and the patients with NTG (P < 0.001), to reduce the likelihood glaucoma developing in the control subjects at a later age (Table 1) . 

All patients underwent serial ophthalmic examinations, including IOP measurements by Goldmann applanation tonometry, Humphrey perimetric (30-2) or Goldmann perimetric measurements, gonioscopy, and optic disc examinations including fundus photographs. All the patients with glaucoma had the following characteristics: the presence of typical optic disc damage with glaucomatous cupping (cup-to-disc ratio, >0.7); loss of neuroretinal rim tissues of the optic disc; reproducible visual field defects compatible with the glaucomatous cupping; and open angles on gonioscopy. Among the patients with OAG, POAG was diagnosed if the patient had an IOP >21 mm Hg at any time during the follow-up period. Patients with exfoliative, pigmentary, or corticosteroid-induced glaucoma were excluded. 

The patients with NTG had an untreated peak IOP ≤21 mm Hg at all times including the three baseline measurements and that obtained during the diurnal testing (every 3 hours from 6 hours to 24 hours); peak IOP, with or without medication, consistently at <22 mm Hg throughout the follow-up period; and the absence of a secondary cause of glaucomatous optic neuropathy, such as a previously elevated IOP after trauma, steroid use, or uveitis. 

Control subjects were recruited from Japanese individuals who had no known eye abnormalities except cataracts. These 240 subjects were older than 40 years, with an IOP below 20 mm Hg, no glaucomatous disc changes, and no family history of glaucoma. 

The medical characteristics of the patients with glaucoma and control subjects are shown in Table 1 . The prevalence of patients with systemic hypertension in the POAG, NTG, and control groups varied from 20% to 25%, and the differences between the three groups were not significant (P < 0.05; by χ² test). 

Genotyping

Ten polymorphisms in the RAA system were examined in each subject with or without glaucoma. Renin (REN) I8-83G→A, ²⁸ angiotensin II receptor, type 1 (AGTR1) −731T→G, −521C→T, 1166A→C ^{29 30} ; angiotensin II receptor, type 2 (AGTR2) 3123C→A, ³¹ ; cytochrome P45011B2 (CYP11B2) −344T→C ³² ; and chymase (CMA) −1903A→G, ²⁹ were identified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). 

The biosynthesis of aldosterone is controlled by aldosterone synthase encoded by the CYP11B2 gene and is regulated by the concentrations of angiotensin II and potassium. Chymase is a major angiotensin-II-forming enzyme in human hearts, and a chymase gene is associated with atherosclerosis. ³³  

Polymorphisms in the ACE I/D were detected by PCR and agarose gel electrophoresis. To avoid false identification of the ACE I/D polymorphism, allele I was amplified specifically, according to the protocol of Lindpaintner et al. ³⁴ Genomic DNA was isolated from peripheral blood lymphocytes by phenol-chloroform extraction. The primer sets and restriction enzymes used are listed in Table 2 . Angiotensinogen (AGT) Thr174Met (T174M) and Met235Thr (M235T) were genotyped (Invader assay; Third Wave Diagnostics Molecular Diagnostics, Madison, WI). ³⁵  

Effect of Oral Angiotensin II Receptor Blocker on IOP in Normal Subjects and Its Association with SNPs in the AGTR1 and AGTR2 Genes

This part of the study was performed on 20 healthy volunteers (13 men and 7 woman; age range, 23–28 years) without systemic and eye diseases. In the morning (10:00 A.M.), each subject was given either 12 mg oral candesartan cilexetil (Blopress; Takeda Chemical Industries, Osaka, Japan) or a placebo, in a randomized, crossover, double-blind fashion. 

The baseline heart rate, systolic–diastolic arterial pressure (SBP/DBP), and IOP were recorded. The subjects then received oral candesartan cilexetil or placebo, and measurements were repeated hourly for 6 hours and then after 24 hours. One month later, each subject received the alternative treatment. Only the right eye was measured and analyzed. 

The ocular perfusion pressure (OPP) ³⁶ is defined as the difference between the pressure in the arteries entering the tissue and the veins leaving it. The OPP can be approximated by the following formula, using the mean blood pressure (BPm) and IOP.  

\[\mathrm{OPP}\ {=}\ 2/3\ {\times}\ \mathrm{BPm}\ {-}\ \mathrm{IOP},\ \mathrm{where\ BPm}\ {=}\ \mathrm{DBP}\ {+}\ 1/3\ {\times}\ (\mathrm{SBP}\ {-}\ \mathrm{DBP}).\]

 

A search for polymorphisms in AGTR1 and AGTR2 was performed in the 20 subjects and the correlation determined between the changes in IOP. The research adhered to the tenets of the Declaration of Helsinki. Written informed consent was obtained after the nature and possible consequences of the study were explained. Where applicable, the research was approved by the institutional human experimentation committee for analysis of DNA. 

Statistical Analysis

The presence of the Hardy-Weinberg equilibrium was tested by the χ² test. The frequencies of the genotypes and alleles were compared between patients and control subjects by χ² analysis. Odds ratios (ORs) for a disease, assuming a dominant (major homozygote versus others) or a recessive genetic model (minor homozygote versus others), and the 95% confidence interval (CI) were calculated adjusting for age by logistic regression. 

Multivariate analyses were performed with a logistic regression model to confirm the association between the three clinical variables and the genotype. To determine the combined effects of two polymorphisms, comparisons between groups were performed by Kruskal-Wallis test, followed by multiple comparisons testing using the Scheffé test. Statistical analysis was performed on computer (SPSS Inc., Chicago, IL). P < 0.05 was considered to be statistically significant. 

Statistical analysis of the results after administration of ARB was also performed (StatView; SAS Institute, Cary, NC), using the repeated-measures ANOVA. ANOVA with Bonferroni correction was used for statistical analysis of each IOP. P <0.0004 was considered to be statistically significant. 

Results

Genotype Distribution of Polymorphisms in the RAA System in Japanese Subjects

The distributions of the genotypes of candidate gene polymorphisms in patients with glaucoma and control subjects are shown in Table 3 . All the genotype frequencies were consistent with the populations being in Hardy-Weinberg equilibrium. Of the 10 polymorphisms in the RAA system, two had a significantly different distribution of genotype frequencies: AGTR1/−713T→G for POAG (P = 0.021) and AGTR2/3123C→A for NTG (P = 0.045). The significant difference in the 3123C→A polymorphism was found only in female patients with NTG. 

The genotypic ORs for POAG or NTG and 95% CI, assuming a dominant genetic model adjusted for age, are shown in Figure 1 . For a dominant genotype model, the frequency of the CA+AA genotypes in the AGTR2/3123C→A polymorphism was significantly higher in female patients with NTG (71.2%) than in female control subjects (56.7%; P = 0.0095 for CC versus CA+AA; OR = 2.18; 95% CI = 1.21–3.93). This polymorphism was not associated with glaucoma in male subjects. In the recessive model, there was no significant difference in the genotype frequency in the 10 polymorphisms (data not shown). Although the AGTR1/-713T→G polymorphism had a significantly different distribution of genotype frequencies among the TT, TG, and GG in patients with POAG (Table 3) , it was not significantly different in a dominant model or a recessive model. The frequency of GG genotype was higher in patients with POAG (3.2%) than in control subjects (0.4%, P = 0.071 for TT+TG versus GG). 

Three clinical characteristics of the patients with glaucoma—age, IOP, and visual field score at diagnosis—were examined to determine whether they were associated with the 10 polymorphisms in the RAA system. The patients with glaucoma did not show a significant association between clinical characteristics and 10 SNPs (data not shown, except in Table 4 ). 

Clinical Characteristics of NTG Patients with the AGTR2/3123C→A and ACE I/D Polymorphisms

No significant association of clinical characteristics (age, IOP, and visual field score) was detected between female glaucoma patients with CC and those with CA+AA genotypes (Table 4) . The visual field score had a tendency to be worse in patients with NTG with CC genotype than in those with CA+AA genotypes (P = 0.107). 

However when combined with ACE (I/D) polymorphisms, female patients with NTG who carried CC in the AGTR2 gene as well as ID+DD in the ACE gene had significantly worse visual field scores than did the patients with the other three combined genotypes (P = 0.012; Table 5 , Fig. 2 ). This effect was not observed in patients with POAG (data not shown). 

Effect of an Oral Angiotensin II Receptor Blocker on IOP and Its Association with the AGTR2 Genotype

The changes in IOP after oral candesartan cilexetil or placebo are shown in Figure 3A . IOP in the subjects who received the placebo was not altered significantly. However, as early as 1 hour after oral candesartan cilexetil, IOP had fallen significantly and remained low for 5 hours (P < 0.0001) compared with placebo. Candesartan cilexetil did not significantly affect perfusion pressure (Fig. 3B) . No significant changes in SBP, DBP, and heart rate were detected after a single oral dose of candesartan cilexetil or placebo (data not shown). 

The changes in IOP after oral candesartan cilexetil in each of the 20 subjects are shown in Figure 3C . There was no significant association between the effects of candesartan cilexetil and the three SNPs in the AGTR1 gene in the 20 control subjects (Table 6) . For the AGTR2 genotype, however, four men with the A genotype showed a reduction of IOP by 2.3 ± 0.5 mm Hg, which was the same amount as that of subjects who received placebo and a significantly lesser decrease in IOP than in the nine men with the C genotype (5.0 ± 1.1 mm Hg, P = 0.014). No woman had the AA genotype in this study. 

Discussion

Although most cases of glaucoma are classified as POAG or NTG of unknown cause, multiple environmental and genetic factors are likely to be involved in the pathogenesis of glaucoma. SNPs can be used to detect linkage disequilibrium reliably between a marker genotype and a disease of multifactorial origin. ³⁷ Using these markers, candidate genes of the RAA system, including REN, AGT, ACE, AGTR1, AGTR2, CYP11B2, and CMA, have been investigated in association studies concerning essential hypertension and other cardiovascular diseases. ^{28 29 30 31 32}  

The RAS has been strongly implicated in the pathogenesis of essential hypertension, cardiovascular disease, progressive renal disease, and diabetic retinopathy. ³⁸ The major biologically active product of the RAS is ATII, which is produced from AGT by the sequential action of renin and ACE or chymase. ATII, the final effecter in RAS activity, is both a powerful vasoconstrictor and a potent mediator of cellular proliferation and extracellular matrix protein synthesis and accumulation. ³⁹ These effects contribute to progressive fibrotic disease in various organ systems. The effects of ATII are mainly receptor mediated at AGTR1 and AGTR2. ³⁹ Administration of ATII by intravenous or anterior chamber routes results in a significant increase in IOP in rats. ^{40 41} In humans, systemic ATII receptor blockers lower the IOP. ^{21 22}  

The RAA system contains at least seven genes. Initially, we selected candidate polymorphisms in association with glaucoma as follows: (1) polymorphisms associated with cardiovascular diseases in the Japanese population, because the frequency of polymorphisms varies among races; (2) heterozygosity of polymorphisms >0.1 in Japanese; and (3) polymorphisms associated with the function of the gene, if possible, or polymorphisms located in the promotor region. We did not select polymorphisms that are rare in Japanese. Our study, designed to detect the involvement of 10 SNPs of the RAA system in glaucoma, showed that the AGTR2 polymorphism was associated with NTG. Other gene polymorphisms in the RAA system were not associated with POAG or NTG. It is uncertain whether the −713T→G polymorphism in the AGTR1 gene is actually associated with POAG, because neither a dominant model nor a recessive model of this polymorphism showed any significant difference in the genotype frequency. However, as the frequency of the GG genotype was higher in patients with POAG (3.2%) than in control subjects (0.4%), further studies are needed to confirm this finding or to identify other functional variants of the AGTR1 gene. 

We found a gender-specific association between the AGTR2/3123C→A polymorphism and NTG. Women with NTG who had the CA+AA genotype (i.e., A carriers) were significantly more likely to develop NTG than those with the CC genotype (non-A carriers; P = 0.0095). Although there was no difference between three clinical features and genotypes of the AGTR2/3123C→A, only the visual field score was significantly worse (P = 0.012) in the female patients with NTG with the CC genotype than those with the CA+AA genotype if they were D carriers of the ACE gene. These results indicate that the effect of the AGTR2 polymorphism on the progression of visual field defects in NTG may depend on the ACE I/D polymorphism. As for that polymorphism, the D allele was associated with increased plasma ACE concentration, which appears to result in increased ATII formation in the plasma. ⁴² Genetic interaction may be essential for the development or the susceptibility to diseases. ^{43 44 45 46} As the IOP at diagnosis in female patients with NTG was not associated with this effect, the progression of visual field defects may be independent of IOP in the RAS in these patients. 

Although the gender-specific association cannot be readily explained, some previous studies have shown a similar gender-specific tendency or association between this polymorphism and hypertension ⁴⁷ and hypertrophic cardiomyopathy. ⁴⁸ However, the pattern of frequencies of the genotypes in hypertensive patients differed from that in patients with NTG. Women with the AA genotype were significantly more likely to have hypertension than those with the CC+CA genotype, in this Japanese group (P = 0.0058). ⁴⁷  

Because the AGTR2/3123C→A polymorphism is located in the 3′ noncoding region of the gene, the amino acid sequence of the receptor is not altered. The AGTR2/3123C→A polymorphism may be in linkage disequilibrium with an unidentified functional variant of the AGTR2 gene. Alternatively, the polymorphism may be in linkage disequilibrium with a nearby gene responsible for associations with the clinical end points. Further study is necessary to identify the new functional polymorphisms associated with the AGTR2/3123C→A polymorphism. 

Of interest, the AGTR2 polymorphism was associated with NTG only in women, whereas the AGTR1 polymorphisms were likely to be associated with POAG. Accordingly, different pathogenetic mechanisms appear to exist in these two diseases, although clinically they are considered to represent parts of a continuum. AGTR1 mediates the vasopressive and aldosterone-secreting effects of ATII. Furthermore, AGTR1 may mediate aqueous humor dynamics and therefore affect IOP, ⁴⁹ which is strongly supported by the lowering of IOP by systemic use of an ARB. ^{21 22} However, the function of AGTR2 is unknown. This receptor is apparently involved in the morphogenesis of the central nervous system and the urinary tract. Allelic variants of AGTR2 have been associated with mental retardation, ⁵⁰ and there is also a strong association between allelic variants and increased incidence of congenital anomalies of the kidney and lower urinary tract. ⁵¹ Yamada et al. ⁵² hypothesized that AGTR2 mediates programmed cell death (apoptosis) which is considered to play an important role in developmental biology. 

The effect of the ARB losartan potassium on IOP has demonstrated that drug administration significantly reduces IOP in normal subjects who do or do not have hypertension and in patients with POAG with or without hypertension. ²¹ The total outflow facility increased significantly in all subjects, and SBP decreased only in hypertensive patients. These results suggest that the mechanism is not mediated by a decrease in blood pressure, but rather is more specific, confirming the role of the RAS in the regulation of IOP. ²¹ We studied the effect of another ARB, candesartan cilexetil, on IOP and demonstrated a reduction in IOP for 5 hours after administration. 

Miller et al. ⁵³ demonstrated a relationship between the AT1R/1166A→C polymorphism and the renal hemodynamic response to losartan potassium in a Canadian group. In our study, we examined a relationship between the presence of three AGTR1 polymorphisms or of one AGTR2 polymorphism and the degree of reduction of IOP by candesartan cilexetil. No relationship was observed for the three AGTR1 polymorphisms and IOP reduction. For the AGTR2/3123C→A polymorphism, however, nine men with the C allele (5.0 ± 1.1 mm Hg, P = 0.014) had a significantly greater reduction in IOP than did four men with the A allele (2.3 ± 0.5 mm Hg). Further studies are needed to determine the genetic locus responsible for this effect. 

In conclusion, the polymorphisms of the angiotensin II receptor gene in the RAS may be a major genetic risk factor for the development or progression of glaucoma in the Japanese population. The RAS-related genetic background influencing susceptibility may differ between patients with POAG and those with NTG. 

Appendix 1

The Writing Group members for The Glaucoma Gene Research Group who had complete access to the raw data needed for this report and who bear authorship responsibility are Kouhei Hashizume, Yukihiko Mashima, Tomoyo Fumayama, Yuichirou Ohtake, Itaru Kimura, Kazuhide Yoshida, and Karin Ishikawa (Department of Ophthalmology) and Koichi Miyaki (Department of Preventive Medicine and Public Health), all at the Keio University School of Medicine. 

The Glaucoma Gene Research Group members at the DNA and Data Center are Yuichiro Ohtake, Kumiko Soma, Tomihiko Tanino, and Daijiro Kurosaka, Department of Ophthalmology, Keio University School of Medicine, Tokyo, Japan; Kenji Nakamoto and Noriko Yasuda, Department of Ophthalmology, Tokyo Metropolitan Police Hospital, Tokyo, Japan; Kotaro Suzuki, Ryosuke Kawamura, Hidenao Ideta, Ideta Eye Hospital, Kumamoto, Japan; Takuro Fujimaki and Akira Murakami, Department of Ophthalmology, Juntendo University School of Medicine, Tokyo, Japan; Ryo Asaoka and Yoshihiro Hotta, Department of Ophthalmology, Hamamatsu University School of Medicine, Hamamatsu, Japan; Takahisa Koga and Hidenobu Tanihara, Department of Ophthalmology and Visual Science, Kumamoto University Graduate School of Medical Sciences, Kumamoto, Japan; Takashi Kanamoto and Hiromu Mishima, Department of Ophthalmology and Visual Science, Graduate School of Medical Sciences, Hiroshima University, Hiroshima, Japan; and Takeo Fukuchi and Haruki Abe, Division of Ophthalmology and Visual Science, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan. 

 Supported by a grant for Research on Eye and Ear Sciences from the Ministry of Health Labour and Welfare of Japan.

 Submitted for publication September 16, 2004; revised February 5, 2005; accepted March 3, 2005.

 Disclosure: K. Hashizume, None; Y. Mashima, None; T. Fumayama, None; Y. Ohtake, None; I. Kimura, None; K. Yoshida, None; K. Ishikawa, None; N. Yasuda, None; T. Fujimaki, None; R. Asaoka, None; T. Koga, None; T. Kanamoto, None; T. Fukuchi, None; K. Miyaki, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Demographic and Medical Characteristics among Patients with Glaucoma and Control Subjects

	POAG (n = 190)	NTG (n = 268)	Control (n = 240)
Demographic characteristics
Age at diagnosis (mean ± SD), y	58.4 ± 12.0	56.1 ± 13.1
Age at blood sampling (mean ± SD), y	65.3 ± 11.9	58.8 ± 13.4	69.7 ± 11.2
Familial history of glaucoma (n)	65/188 (34.6%)	88/264 (33.3%)	0/240 (0.0%)
Male/female (n)	108/82	129/139	113/127
IOP at diagnosis (mm Hg)	26.6 ± 6.1	16.5 ± 2.5
Visual field score at diagnosis	3.09 ± 0.90	2.79 ± 0.69
Medical characteristics (n)
Hypertension	45/178 (25.3%)	53/260 (20.4%)	56/240 (23.3%)
Cardiovascular disease	8/178 (4.5%)	7/260 (2.7%)	15/240 (6.3%)
Lipid metabolism disorders	14/171 (8.2%)	16/257 (6.2%)	14/240 (5.8%)
Migraine	3/175 (1.7%)	11/260 (4.2%)	1/240 (0.4%)

Table 2.

 

Primer Pair Sequences Used for PCR Amplification and Restriction Enzymes of Polymorphic Sites in the RAS

Gene	Polymorphism	Primer Sequences	Annealing Temp (°C)	Product Size (bp)	Restriction Enzyme	Digested Products (bp)
REN	18-83G→A	TGAGGTTCGAGTCGGCCCCCT	68	250	MboI	G: 250
		TCGCCAAACATGGCCACACAT				A: 171+ 79
ACE	I/D 1st step	GCCCTGCAGGTGTCTGCAGCATGT	63	D: 319
		GGATGGCTCTCCCCGCCTTGTCTC		I: 597
	I/D 2nd step	TGGCAGCACAGCGCCCGCCACTAC	67	D/D: no product
		TCGCCAGCCCTCCCATGCCCATAA		I: 335
AGTR1	1166A→C	GAGGTTGAGTGACATGTTCGAAAC	60	253	DdeI	A: 253
		CGTCATCTGTCTAATGCAAAATGT				C: 155+ 98
	−521C→T	CGTGATGTCTTTATCTGGTTTTG	60	270	SspI	C: 270
		CGAACTTTGGTAATACAGTTGTGG				T: 144+126
	−713T→G	AAACTACAGTCACCCTACTCACCT	55	292	HinfI	T: 170+122
		TTCTTCACAAACTCTTCCAA				G: 292
AGTR2	3123C→A	GGATTCAGATTTCTCTTTGAA	53	340	AluI	C: 340
		GCATAGGAGTATGATTTAATC				A: 227+113
CYP11B2	−344C→T	CAGGAGGGATGAGCAGGCAGAGCACAG	63	404	HaeIII	C: 333+ 71
		CTCACCCAGGAACCTGCTCTGGAAACATA				T: 404
CMA	−1903A→G	GGAAATGTGAGCAGATAGTGCAGTC	51	285	BstXI	A: 285
		AATCCGGAGCTGGAGAACTCTTGTC				G: 195+ 90

Table 3.

 

Genotype Distribution of Polymorphisms in the RAA System in Patients with glaucoma and Control Subjects

AGT T174M	Genotype Frequency					P *	AGT M235T	Genotype Frequency					P
		TT	TM	MM					MM	TM	TT
POAG (n = 150)	115 (76.7)	34 (22.7)	1 (0.7)	0.3101	POAG (n = 171)	4 (2.3)	56 (32.8)	111 (64.9)	0.9185
NTG (n = 213)	178 (83.6)	32 (15.0)	3 (1.4)	0.1122	NTG (n = 206)	9 (4.4)	57 (27.6)	140 (68.0)	0.4626
Control (n = 210)	172 (81.9)	38 (18.1)	0 (0.0)		Control (n = 208)	5 (2.4)	64 (30.8)	139 (66.8)

REN I8-83G→A	Genotype Frequency					P	ACE I/D	Genotype Frequency					P
		GG	GA	AA					II	ID	DD
POAG (n = 190)	123 (64.7)	64 (33.7)	3 (1.6)	0.1085	POAG (n = 190)	87 (45.8)	82 (43.2)	21 (11.1)	0.7921
NTG (n = 268)	164 (61.2)	90 (33.6)	14 (5.2)	0.2837	NTG (n = 268)	111 (41.4)	133 (49.6)	24 (9.0)	0.5154
Control (n = 240)	163 (67.9)	66 (27.5)	11 (4.6)		Control (n = 240)	102 (42.5)	110 (45.8)	28 (11.7)

CMA −1903A→G	Genotype Frequency					P	CYP11B2 −344T→C	Genotype Frequency					P
		AA	AG	GG					CC	CT	TT
POAG (n = 190)	121 (63.7)	59 (31.1)	10 (5.3)	0.6083	POAG (n = 139)	62 (44.6)	60 (43.2)	17 (12.2)	0.9740
NTG (n = 268)	179 (66.8)	75 (28.0)	14 (5.2)	0.4634	NTG (n = 186)	89 (47.8)	81 (43.5)	16 (8.6)	0.3810
Control (n = 240)	157 (65.4)	75 (31.3)	8 (3.3)		Control (n = 170)	74 (43.5)	74 (43.5)	22 (12.9)

AGTR1 −521C→T	Genotype Frequency					P	AGTR1 −713T→G	Genotype Frequency					P
		CC	CT	TT					TT	TG	GG
POAG (n = 190)	135 (71.1)	44 (23.2)	11 (5.8)	0.2982	POAG (n = 190)	159 (83.7)	25 (13.2)	6 (3.2)	0.0206†
NTG (n = 268)	179 (66.8)	84 (31.3)	5 (1.9)	0.4388	NTG (n = 268)	219 (81.7)	49 (18.3)	0 (0.0)	0.5160
Control (n = 240)	165 (68.8)	67 (27.9)	8 (3.3)		Control (n = 240)	192 (80.0)	47 (19.6)	1 (0.4)

AGTR1 1166A→C	Genotype Frequency					P
		AA	AC	CC
POAG (n = 190)	159 (83.7)	31 (16.3)	0 (0.0)	0.1968
NTG (n = 268)	228 (85.1)	39 (14.6)	1 (0.4)	0.4343
Control (n = 240)	197 (82.1)	40 (16.7)	3 (1.3)

AGTR2 (Female) 3123C→A	Genotype Frequency					P	AGTR2 (Male) 3123C→A	Genotype Frequency			P
		CC	CA	AA					C	A
POAG (n = 82)	39 (47.6)	30 (36.6)	13 (15.9)	0.7562	POAG (n = 108)	62 (57.4)	46 (42.6)	0.4916
NTG (n = 139)	40 (28.8)	75 (54.0)	24 (17.3)	0.045†	NTG (n = 129)	81 (62.8)	48 (37.2)	0.8925
Control (n = 127)	55 (43.3)	53 (41.7)	19 (15.0)		Control (n = 113)	70 (61.9)	43 (38.1)

 Data are the number of subjects with the percentage of the total group in parentheses.

*   P < 0.05; by χ² test.

Figure 1.

 

Genotypic ORs for glaucoma and 95% CI in 10 polymorphisms in the RAA system, assuming a dominant genetic model (major homozygote versus others). *P = 0.0095.

Table 4.

 

Comparison of Clinical Characteristics of Female Patients with Glaucoma According to AGTR2 Genotypes

Phenotype Variable	CC	CA + AA	P *
POAG
Age at diagnosis (y)	59.2 ± 11.6 (n = 38)	61.3 ± 11.1 (n = 42)	0.424
IOP at diagnosis (mm Hg)	25.3 ± 4.3 (n = 35)	26.6 ± 5.9 (n = 39)	0.243
Visual field score at diagnosis	3.15 ± 0.96 (n = 39)	2.98 ± 0.89 (n = 43)	0.729
NTG
Age at diagnosis (y)	59.1 ± 13.3 (n = 38)	57.8 ± 11.6 (n = 98)	0.149
IOP at diagnosis (mm Hg)	16.0 ± 2.5 (n = 36)	16.5 ± 2.4 (n = 92)	0.32
Visual field score at diagnosis	2.85 ± 0.74 (n = 40)	2.64 ± 0.56 (n = 98)	0.107

*  Probability for logistic regression analysis.

Table 5.

 

Comparison of Clinical Characteristics of Female Patients with NTG, According to ACE (I/D) and AGTR2 Genotypes (3123C→A)

Clinical Characteristics at Diagnosis	ACE II			ID + DD			P
		CC	CA + AA	CC	CA + AA
Age (y)	63.6 ± 10.9 (n = 15)	57.0 ± 11.2 (n = 47)	56.2 ± 14.1 (n = 23)	58.5 ± 12.0 (n = 51)	0.313
IOP (mm Hg)	16.0 ± 2.2 (n = 16)	16.5 ± 2.6 (n = 43)	16.1 ± 2.7 (n = 20)	16.5 ± 2.2 (n = 49)	0.75
Visual field score	2.47 ± 0.51 (n = 17)	2.64 ± 0.53 (n = 47)	3.13 ± 0.76 (n = 23)	2.65 ± 0.59 (n = 52)	0.012†

*   P < 0.05 by Kruskal-Wallis test.

Figure 2.

 

Comparison of visual field scores of female patients with NTG, according to ACE (I/D) and AT2 genotypes (3123C→A). Probabilities were obtained by the Scheffé multi-comparison test.

Figure 3.

 

Variations in IOP and OPP after oral administration of the angiotensin II receptor blocker candesartan cilexetil (•) or a placebo (○). (A) IOP variations (mean ± SD). ANOVA with the Bonferroni correction, *P < 0.0001. (B) OPP variations (mean ± SD). (C) Reduction of IOP variations in 20 subjects.

Table 6.

 

Effects of Angiotensin II Receptor Blocker on IOP in Association with Genotypes of the Angiotensin II Receptor Genes

Polymorphisms	Genotype	Eyes (n)	Maximum Reduction of IOP (mm Hg)	P *
AGTR1 −713T→G	TT	18	4.9 ± 1.8
	TG	2	5.0 ± 4.2	0.898
	GG	0	0
AGTR1 −521C→T	CC	18	4.9 ± 1.8
	CT	1	2	0.117, †
	TT	1	8
AGTR1 1166A→C	AA	18	5.1 ± 2.0
	AC	2	5.2 ± 1.6	0.405
	CC	0	0
AGTR2 3123C→A	C (male)	9	5.0 ± 1.1	0.014, ‡
	A (male)	4	2.3 ± 0.5
	CC (female)	3	7.0 ± 1.0
	CA (female)	4	6.0 ± 1.6	0.354
	AA (female)	0	0

*  Probabilities by Mann-Whitney U test.

†  Probabilities by Kruskal-Wallis test.

‡   P < 0.05.

The authors thank Makoto Nagano (Research Department of the R&D Center, BML) for excellent technical assistance with the genotyping assay (Invader; Third Wave Diagnostics).