Expression of the Functional Glucocorticoid Receptor in Mouse and Human Lens Epithelial Cells

Abstract

purpose. Studies have questioned the reported presence of a classic glucocorticoid receptor (GR) in the mammalian lens. The purpose of this study is to determine whether the functional GR is expressed in human and mouse lens epithelial cells.

methods. GR mRNA was determined by RT-PCR in freshly isolated human lens epithelia, mouse lens, immortalized human (HLE B-3) and mouse (αTN4) lens epithelial cells and in mouse lung, NIH-3T3 cells, and HeLa cells, which served as positive controls. Western blot analysis with the GR-specific antibody H-300 was performed on protein extracts from human lens epithelia, HLE B-3 cells, and αTN4 cells and from HeLa cells, NIH-3T3 cells, and partially purified GR, which served as positive controls. pGRE.Luc drives the expression of firefly luciferase. HLE B-3 and αTN4 cells were transfected with pGRE.Luc and cotreated with dexamethasone, with and without the competitive inhibitor RU-486.

results. PCR products of the expected size were detected in all samples, sequenced in both directions, and found to have 97% to 100% homology with the GR. A band in the appropriate molecular weight range was identified by Western blot analysis in the lens extracts. Active GR binding to the GRE was demonstrated by an increase in firefly luciferase expression in transfected cells treated with dexamethasone. The dexamethasone-induced increase in luciferase activity was inhibited with the addition of RU-486.

conclusions. These results demonstrate expression of the functional glucocorticoid receptor in mouse and human lens epithelial cells. This finding suggests that glucocorticoids may act on the mouse and human lens directly during normal lens development and/or cataractogenesis.

Glucocorticoids are steroid hormones that play a role in many physiological processes and are used clinically as anti-inflammatory agents in treatment of diseases such a rheumatoid arthritis and asthma. It has been well documented that prolonged use of glucocorticoids can lead to the formation of a steroid induced cataract. ^{1 2 3 4 5} The mechanism, however, is not known. 

Glucocorticoids exert their effects by binding to a specific intracellular receptor, the glucocorticoid receptor (GR). The ligand receptor complex dimerizes, translocates to the nucleus, and binds to the cis-acting element, the glucocorticoid response element (GRE), to modulate the expression of target genes. It is not known whether the steroid hormones act directly in lens tissue by binding to a GR or by affecting a secondary site. 

In 1978, a glucocorticoid-binding protein that exhibits the characteristics of a receptor was identified in bovine lens epithelium. ⁶ More recently, the presence of the receptor mRNA and protein was identified in human and rat lens epithelia by in situ hybridization and immunohistochemistry. ^{7 8} Although it appeared that the mammalian lens expressed the classic GR, its existence has been questioned. Last year, a report was published that demonstrated the binding of glucocorticoid to the bovine lens epithelium; however, the binding was nonspecific and did not exhibit the characteristics of a receptor. ⁹ Furthermore, metabolic studies yielded negative results and GR protein was not detected in the bovine lens epithelium, by using a polyclonal antibody. It was concluded that the bovine lens did not contain a classic GR and that glucocorticoids were unable to bind to the mammalian lens epithelium specifically. A later report demonstrated nonspecific binding of glucocorticoid to α-crystallin in the bovine lens. ¹⁰  

Given the conflicting reports, the purpose of this study was to determine whether the functional GR is present in the mammalian lens epithelium. We report the presence of the receptor mRNA and protein in the αTN4 immortalized mouse lens epithelial cell line, the HLE B-3 immortalized human lens epithelial cell line, and freshly isolated human lens epithelia and mouse lenses. We also identified, for the first time, the presence of the functionally active isoform of the GR and demonstrated a functional response to glucocorticoid treatment in transfected HLE B-3 and αTN4 lens epithelial cells. 

Methods

Tissue, Cell Culture, and Treatment

Freshly isolated human lenses were obtained from eye bank donor eyes. The epithelial layer was carefully separated from the fiber cells using a dissecting microscope. Whole lenses from C57B46 mice were used. All procedures complied with the Declaration of Helsinki and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 

HLE B-3 ¹¹ cells were maintained in phenol-red–free MEM with 20% serum. αTN4, ^{12 13} HeLa, and NIH-3T3 cells were maintained in phenol-red–free DMEM with 10% serum. Medium was replaced with medium containing a reduced amount of charcoal-stripped serum 16 hours before treatment. 

Dexamethasone and RU-486 were purchased from Sigma (St. Louis, MO) and were dissolved in 100% ethanol and diluted in medium according to manufacturer’s protocol. 

Reverse Transcription–Polymerase Chain Reaction and DNA Sequencing

Cells were grown to 90% to 100% confluence, and total RNA was isolated with extraction reagent (RNAzol; Tel-Test, Friendswood, TX), according to the manufacturer’s protocol. Freshly isolated tissue was homogenized in the extraction reagent. Isolated RNA was then aliquoted and stored at −80°C. Total RNA (1 μg) was reverse transcribed using an Oligo dT primer, and cDNA was amplified by the polymerase chain reaction (PCR). For each sample, primers for actin or GAPDH were used to determine the quality of the RNA. The sequences of mouse or human specific primers used in this study, along with their corresponding GenBank accession numbers, product sizes, and region of amplification are shown in Table 1 (http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). Primers were designed with the use of commercial software (GCG Wisconsin; Accelrys, San Diego, CA) or Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi; provided in the public domain by the Whitehead Institute, Massachusetts Institute of Technology, Cambridge, MA). The mouse- and human-specific primers were designed to amplify a GR-specific region on the N-terminal domain. PCR was performed with reverse transcriptase (Amplitaq; PerkinElmer Life Sciences, Boston, MA) on a thermocycler (GeneAmp PCR system 9700; Applied Biosystems, Foster City, CA) with the following protocol: 92°C 2 minutes, followed by 30 cycles of 94°C 1 minute, 56°C 1 minute, and 72°C 1 minute and ending with 72°C for 7 minutes. Human GRα primers were designed to span exon 8 and exon 9α to amplify the GRα-specific C-terminal domain. PCR was performed (Amplitaq Gold; PerkinElmer Life Sciences) with the following protocol: 92°C 5 minutes and 60°C 5 minutes, followed by 30 cycles of 94°C 1 minute, 56°C 1 minute, and 72°C 1 minute and ending with 72°C for 7 minutes. PCR products were resolved by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining. PCR products of the RT-PCR reactions were then purified (QIAquick; Qiagen, Valencia, CA) and sequenced in both directions, using the same primers that were used to generate the product. 

Western Blot Analysis

Whole-cell lysates were prepared in either HEGDM buffer (10 mM HEPES, 1 mM EDTA, 0.1% NP40, 10 mM Na molybdate, and 250 mM NaCl with protease inhibitors [Mini Complete Tablet; Roche Applied Science, Indianapolis, IN], for HLE B-3, αTN4, and NIH-3T3 cells and freshly isolated human lens epithelia, or lysis buffer (50 mM Tris, 300 mM NaCl, 0.5% Triton X-100 with protease inhibitors [Mini Complete Tablet; Roche Applied Sciences], for HeLa cells). Cells were scraped into PBS, centrifuged at 1000 rpm for 5 minutes, resuspended in buffer, and incubated on ice for 10 minutes. The sample was then centrifuged at 17,000g for 10 minutes at 4°C, and the supernatant was transferred to a new tube. Freshly isolated human lens epithelia were homogenized by 12 strokes of a homogenizer (Dounce; Kontes, Vineland, NJ). The homogenate was incubated on ice for 5 minutes and centrifuged at 14,000 rpm in a microfuge for 5 minutes at 4°C. Protein concentrations were measured using the Bradford method (Bio-Rad, Hercules, CA). HeLa nuclear extract was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). A 1:1000 dilution of a partially purified GR (RP-500; Affinity Bioreagents, Golden, CO); 1 μg of HeLa, HeLa nuclear, NIH-3T3, HLE B-3, and αTN4 extract; and 60 μg human lens epithelia extract were electrophorectically separated on 7.5% denaturing Tris-HCl gels (Bio-Rad), transferred to nitrocellulose membranes (Bio-Rad), blotted with the GR-specific primary antibody H-300 and goat anti rabbit secondary antibody (both from Santa Cruz Biotechnology). Detection was preformed with enhanced chemiluminescence (NEN Life Sciences, Boston, MA). 

Transfections

Plasmid pGRE.Luc (Clonetech, Palo Alto, CA) contains three copies of the GRE enhancer element fused to the TATA-like promoter region from the HSV-TK promoter and drives the expression of the firefly luciferase reporter gene. Plasmid pTal.Luc (Clonetech) contains the promoter region from the HSV-TK promoter but has no enhancer elements, and thus served as a negative control. Plasmid pRL-SV40 (Promega, Madison, WI) contains the SV40 early enhancer-promoter region driving expression of the renilla luciferase reporter gene and served to normalize transfection efficiencies. Cells were seeded at 0.1 × 10⁶ cells per well in a 24-well plate 24 hours before transfection. Cells were cotransfected with the pRL-SV40 and the pGRE.Luc or pTal.Luc, using a lipophilic transfection reagent (Lipofectamine 2000; Invitrogen, Carlsbad, CA). Transfection media was changed after 5 hours, and, 16 hours later, cells were treated with 100 nM dexamethasone, 1 μM dexamethasone, or vehicle for 24 hours. Some cells were also treated with 1 μM RU-486. A luciferase assay system (Dual Luciferase Reporter Assay System; Promega) was used according to the manufacturer’s instructions to assay cell extracts. Luciferase activity was measured on a luminometer (Packard LumiCount; Packard Instrument Company, Downers Grove, IL). 

Results

To determine the expression of the GR mRNA in lens epithelial cells, RT-PCR was preformed on total RNA extracted from the αTN4 mouse lens epithelial cell line, the HLE B-3 human lens epithelial cell line, and freshly isolated mouse lens and human lens epithelia. Total RNA was also extracted from NIH-3T3 cells, ¹⁴ HeLa cells, ^{15 16} and freshly isolated mouse lung tissue, ¹⁷ which served as the positive control, because they have been shown to contain the classic GR. Mouse specific or human specific primers designed to amplify the N-modulatory region of the GR were used to amplify the GR message. The N-modulatory region has little homology with other steroid receptors and confers specificity on the GR. ¹⁸ The expected 314-bp product was detected in freshly isolated mouse lens tissue and αTN4 cells and comigrated with the products detected in the positive control NIH 3T3 cells and freshly isolated mouse lung (Fig. 1A) . RT-PCR reactions without reverse transcriptase served as a negative control to show the absence of DNA (data not shown). Low levels of product were obtained from the PCR of the four mouse samples. To sequence the products, each sample was amplified multiple times. Products of similar samples were pooled for visualization and sequencing (Fig. 1A) . PCR products from all four samples were sequenced in both directions and found to have greater than 98% identity with previously published sequences of the mouse GR. 

The human primers yielded the expected 502-bp product in both HLE B-3 cells and freshly isolated human lens epithelia, which comigrated with the product detected in the positive control HeLa cells (Fig. 1B) . Minus RT assays served as a negative control. All three products were sequenced in both directions and found to have 100% homology to previously published sequences of the human GR. 

The presence of the GR message in human and mouse lens epithelial cells suggests that the protein may be present. To determine the expression of the GR protein in lens epithelial cells, protein extracts from αTN4, HLE B-3, NIH-3T3, HeLa cells, freshly isolated human lens epithelia, and a partially purified GR were resolved by SDS-PAGE on a 7.5% polyacrylamide gel. GR protein was visualized by Western blot analysis with H-300, a polyclonal antibody that recognizes an epitope corresponding to amino acids 121-420 of the N-modulatory region of the GR of human origin. H-300 cross-reacts with the GR of human, mouse, and rat. Bands in the appropriate molecular weight range were identified in HLE B-3, αTN4, and freshly isolated human lens epithelia, comigrating with the bands identified in the positive control partially purified GR, HeLa, and NIH 3T3 cells (Fig. 2) . 

Two isoforms of the GR have been reported, GRα and -β. ^{19 20} The two isoforms are highly homologous and differ only on the C-terminal domain, due to an alternative splicing event at exon 9. The C terminus of the α isoform contains the full hormone-binding domain, is able to bind hormone, and is considered the functionally active isoform of the GR. ²⁰ The β isoform is truncated in the C-terminal hormone-binding domain, is unable to bind hormone, and is not functionally active. ^{20 21} To determine whether the functionally active α isoform of the receptor was present in lens epithelial cells, RT-PCR was performed using primers designed to amplify hGRα. The expected 359 bp PCR product was detected in HLE B-3 and human lens epithelia and comigrated with the product identified in the positive control HeLa cells (Fig. 3) . RT-PCR reactions without reverse transcriptase served as a negative control to show the absence of DNA contamination (data not shown). To sequence the product, each sample was amplified multiple times, and products of similar samples were pooled for visualization and sequencing (Fig. 3) . All three PCR products were sequenced in both directions and found to be 100% identical with previously published sequences of the human GRα. 

Inactive GR is found in the cytoplasm. The GR is activated by binding to its hormone substrate. Bound receptors dimerize, translocate to the nucleus, and bind to GREs to modulate the expression of target genes. To determine whether the lens GR is functional, the ability of the GR to bind the GRE in the presence of dexamethasone, a synthetic glucocorticoid, was determined. HLE-B3 and αTN4 cells were transfected with the reporter vector pGRE.Luc. This reporter vector contains three GREs fused to a TATA-like promoter of the HSV-TK. Binding of the activated GR to the GRE drives the expression of a firefly luciferase. The cells were cotransfected with the pRL-SV40 vector to normalize for transfection efficiency. As a negative control, cells were transfected with the pTAL.Luc vector, a vector containing no enhancer elements. Transfected HLE B-3 cells were treated with 1 μM dexamethasone or vehicle for 24 hours before assaying luciferase activity. HLE B-3 transfected with pGRE.Luc and treated with dexamethasone consistently showed a more than fivefold increase in luciferase activity over the control (Fig. 4) . 

To verify that the increase in luciferase activity is due to the binding of the GR to the GRE, the GR antagonist RU-486 was used. RU-486 is a competitive inhibitor of dexamethasone for the GR. ²² HLE B-3 and αTN4 cells were cotransfected with pGRE.Luc and pRL.Luc and cotreated with 100 nM dexamethasone and 1 μM RU-486. Transfected cells treated with 100 nM dexamethasone showed a more than fourfold increase in luciferase activity over controls in HLE B-3 cells (Fig. 5A) and a more than threefold increase in luciferase activity in αTN4 cells, over the control (Fig. 5B) . RU-486 prevented the increase in luciferase activity (Fig. 5) . 

Discussion

The present study was undertaken to determine the presence of the GR in the mammalian lens. The results presented confirm and extend findings in previous studies that demonstrate GR mRNA and protein in human lens and for the first time identify GR mRNA in the mouse lens. This is the first report to demonstrate that the lens GR is functional. 

The GR was previously identified in the rat and human lens epithelium through in situ hybridization. ^{7 8} Our results confirmed the presence of GR mRNA in freshly isolated human lens epithelia and identified for the first time the expression of the GR in αTN4 and HLE B-3 immortalized lens epithelial cell lines and in freshly isolated mouse lens through more direct biochemical methods. The RT-PCR products of these reactions were sequenced and found to have 98% to 100% identity with previously published sequences of the GR. This suggests that the GR present in the mouse and human lens epithelium is similar to the classic GR identified in other cell types and tissues. 

The GR is a protein of M_r 85,000 to 97,000 that is expressed in low concentrations in most mammalian cells. ^{23 24} The GR protein was previously identified in the human lens epithelium by using two different monoclonal antibodies. ^{7 8} However, the validity of these results has been questioned. The GR protein could not be identified in the bovine lens by Western blot analysis with a polyclonal antibody, clone 57, that cross reacts with the human, rat, and mouse GR. ⁹ It is not known whether this antibody is able to cross-react with the bovine receptor, and no positive control was shown. Our data confirmed the presence of the GR protein in the freshly isolated human lens epithelium by using a polyclonal antibody, H-300, which cross-reacts with the human, rat, and mouse GR. We also identified the GR protein in the HLE B-3 and αTN4 cell lines. We do not know whether the lower amount of GR mRNA and protein in freshly isolated human lens epithelia, compared with HLE B-3 cells, is due to an instability of the mRNA or protein or to a lower amount of GR expression. We did not examine the expression of the receptor protein in the mouse lens, because of scarcity of the material. 

When the human GR was cloned in 1985, two highly homologous cDNA clones that differed in the C-terminal domain were identified. ²⁰ The two isoforms, α and β, contain identical sequences through amino acid 727, but diverge because of an alternative splicing event at exon 9. ²¹ The α form contains an additional 50 amino acids on its C-terminal domain, forming a full hormone-binding domain. The β form contains a nonhomologous 15-amino-acid sequence on its C-terminal domain. The GRα is the predominantly expressed isoform and functions as a ligand dependent transcription factor. The ability of both natural and synthetic glucocorticoids to act on a target tissue and elicit a biological response is dependent on the presence of the GRα. The GRβ is unable to bind hormone and does not activate glucocorticoid-responsive promoters. ^{20 25} However, the GRβ has a widespread tissue distribution and acts as a dominant negative repressor of GRα, inhibiting GRα transactivation of target genes. ²⁶ The use of primers that recognize the receptor in the N-modulatory GR-specific region fails to distinguish between the expression of the GRα and -β. Negative findings in the functional studies ⁹ could be explained by the absence of GRα expression or an overexpression of the dominant negative GRβ. For the GRβ to completely inactivate GRα, GRβ must be expressed in excess of GRα. We report the presence of the GRα isoform in the HLE B-3 and human lens epithelial cells. Preliminary studies using primers designed to amplify the hGRβ-specific C-terminus showed a very low GRβ product level in HLE B-3 cells. The low level of hGRβ is similar to that identified in the positive control HeLa cells. We were unable to identify the β isoform in the freshly isolated human lens epithelia, probably because of the extremely low level of hGRβ expression. Our results show that the mRNA PCR product of the functionally active α isoform is obtained at a higher level than the β isoform in HLE B-3 cells and human lens epithelia. This RT-PCR product ratio is similar to the GRα and -β product ratio we identified in the HeLa cells, which have been reported to express a functional GR, ^{15 16} using the same primers and PCR conditions used for the lens cells. The presence of the two isoforms was not determined in the mouse samples because mGRα and -β sequences have not been published. Absence of the β isoform in mouse and rat has been reported. ²⁷ Our results suggest that the hGRα is the predominant isoform, that the ratio of GRα to GRβ in human lens cells is consistent with reports of a functional GR in other cell types, ^{20 28} and that the lens GR is functionally active. 

The mechanism of glucocorticoid action on the lens is not known. Prolonged use of glucocorticoid has been documented to result in the formation of posterior subcapsular cataract with the finding of nucleated epithelial cells in the posterior region of the lens. ^{1 2 3 4 5 29} Studies in chick embryos have suggested that glucocorticoids act on the lens indirectly. It has been hypothesized that glucocorticoids, being unable to act on the lens directly, act indirectly by binding to classic glucocorticoid receptors in the liver. ³⁰ Binding of the hepatic GRs results in the increase of blood lipid peroxides (LPO), ^{30 31} resulting in the increase in aqueous humor LPO and depletion of lens glutathione (GSH). ^{32 33 34} The oxidative stress caused by the depletion in GSH is thought to be involved in the formation of a steroid-induced cataract in chick embryos. However, glucocorticoid treatment of chick lenses results in nuclear opacities, not posterior subcapsular cataracts, suggesting a different mechanism of opacification. Another hypothesis involves a nonspecific action of glucocorticoid through the covalent addition of steroids to lens proteins which destabilizes protein confirmation to allow the oxidation and cross-linking of protein thiol groups. ^{35 36} This model may be related to the report that synthetic steroid dexamethasone binds α-crystalline nonspecifically and is responsible for the steroid binding observed in the bovine lens. ¹⁰ A membrane steroid-binding protein was recently identified in bovine lens epithelial cells. ³⁷ Although this receptor is able to bind glucocorticoid, its mRNA and protein sequence differ from the classic GR and from the steroid-binding receptor we have identified in the mouse and human lens epithelium. A membrane steroid binding protein may play a role in the formation of a steroid-induced cataract; however, a membrane steroid-binding protein must act by nongenomic actions. 

In considering the mechanism for a corticosteroid affect on the lens, it should be noted that glucocorticoids have been demonstrated in the aqueous humor. ^{38 39 40} Furthermore, expression of 11β-hydroxysteroid dehydrogenase type 1, which converts inactive corticosterone to active cortisol, the endogenous glucocorticoid, was found in the lens. ⁷ Therefore, our findings of a functional receptor in lens epithelial cells suggest that glucocorticoids act on the lens directly. 

Previously published reports have failed to identify changes in gene expression and DNA and protein metabolism in lens cells treated with glucocorticoids. ^{9 41} Our results show that the GR present in the mouse and human lens epithelial cells is able to bind to classic GRE and modulate the expression of a target gene. A statistically significant increase in luciferase activity was observed in cells transfected with the GRE vector in the presence of 1 μM and 100 nM dexamethasone, but not in the negative control vector. Furthermore, the increase in luciferase activity was inhibited when the cells were cotreated with the GR antagonist, RU-486. The results show that the lens GR was responsive to 100 nM dexamethasone, a more physiological concentration of GC, and that the increase in luciferase activity was due to the binding of the lens GR to a classic GRE. This is the first report to demonstrate that the lens GR is functionally active. Future work is designed to identify a biological effect of specific corticosteroid action in the lens. Preliminary studies show increased mRNA expression of glutamine synthetase and IκBα in lens epithelial cells treated with dexamethasone. 

Glucocorticoid use can lead to cataract. The finding of the functional GR in the human and mouse lens epithelium could lead to a better understanding of the mechanism of glucocorticoid action in the pathogenesis, treatment, and prevention of a steroid-induced cataract. 

 Supported by National Eye Institute Grant EY02299 (BJW) and an unrestricted grant from Research to Prevent Blindness, to the Department of Ophthalmology.

 Submitted for publication October 25, 2002; revised November 21, 2002; accepted December 5, 2002.

 Disclosure: V. Gupta, None; B.J. Wagner, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Sequences of Glucocorticoid Receptor Primers

Primer	Accession No.	Sequence	Product Size (bp)	Amplified Region (aa)
Mouse GR-F	X04435	CAAAGCCGTTTCACTGTCC	314	88–192
Mouse GR-R		ACAATTTCACACTGCCACC
Human GR-F	M11050	GAAACTCGAATGAGGACTGC	502	240–405
Human GR-R		GGAGGAGAGCTTACATCTGG
Human GRα-F	X03225	CTACCCTGCATGTACGACC	359	636–755
Human GRα-R		TCAGCTAACATCTCGGGG

Figure 1.

 

Expression of GR mRNA in mouse and human cells. (A) PCR products from freshly isolated mouse lens (lane 1), αTN4 mouse lens epithelial cells (lane 2), freshly isolated mouse lung (lane 3), and NIH-3T3 cells (lane 4) yielded the expected 314-bp product. These are pooled results from several PCR reactions. (B) PCR products from HeLa cells (lane 1), HLE B-3 human lens epithelial cells (lane 3), and freshly isolated human lens epithelia (lane 5) yielded the expected 502-bp product. Minus RT reactions (lanes 2, 4, 6) served as a negative control. Depicted are the results of a single PCR reaction.

Figure 2.

 

Expression of GR protein in lens epithelial cells. Western blot analysis was performed with H300, a polyclonal antibody specific for the GR. Bands identified in the HLE B-3 (lane 5), αTN4 (lane 6), and human lens (lane 7) protein extracts comigrated with the bands identified in the positive control partially purified GR (lane 1), HeLa total (lane 2), HeLa nuclear (lane 3), and NIH-3T3 (lane 4) extracts.

Figure 3.

 

Expression of GRα mRNA in human cells. PCR products from HeLa cells (lane 1), HLE B-3 cells (lane 2), and freshly isolated human lens epithelia (lane 3) yielded the expected 359-bp product. Results shown are from several pooled PCR reactions.

Figure 4.

 

Dexamethasone increased luciferase activity in HLE B-3 cells transiently transfected with pGRE.Luc. HLE B-3 cells were cotransfected with pGRE.Luc or pTAL.Luc (negative control) and with pRL.Luc to normalize transfection efficiencies. Transfected cells were cultured in the presence (+) or absence (−) of 1 μM dexamethasone for 24 hours. Firefly and renilla luciferase activities were measured in each sample. Data are the means of three transfection experiments, each performed in triplicate. Values were significantly different (two-tailed two sample t-test assuming unequal variances) from pGRE + Dexamethasone (*P < 0.0002; bars, SE; n = 9).

Figure 5.

 

RU-486 inhibited dexamethasone-induced luciferase activity in HLE B-3 and αTN4 cells transiently transfected with pGRE.Luc. (A) HLE B-3 cells cotransfected with pGRE.Luc and pRL.Luc were cotreated with 100 nM dexamethasone or vehicle and 1 μM RU-486 for 24 hours. Firefly and renilla luciferase activities were measured in each sample. Treatments yielded values that were significantly different from pGRE + Dexamethasone (*P < 0.00003; bars, SE; n = 9). (B) αTN4 cells cotransfected with pGRE.Luc or pTAL.Luc and pRL.Luc were cotreated with 100 nM dexamethasone or vehicle and 1 μM RU-486 for 24 hours before luciferase activities were measured. Treatments yielded values that were significantly different from pGRE + Dexamethasone (P < 0.05; bars, SE; n = 3).

The authors thank the members of the Department of Ophthalmology and the Ocular Cell Transplantation Laboratory for assistance in acquiring human lenses and the New Jersey Medical School Molecular Resource Facility for sequencing the PCR products.