Roles for KCC Transporters in the Maintenance of Lens Transparency

Abstract

purpose. To determine whether the potassium chloride cotransporter (KCC) family is expressed in the rat lens and to ascertain whether the transporters are involved in the regulation of lens volume and transparency.

methods. RT-PCR was performed on RNA extracted from fiber cells to identify members of the KCC family expressed in the lens. Western blot analysis and immunocytochemistry, using KCC isoform-specific antibodies, were used to verify expression at the protein level and to localize KCC isoform expression. Organ-cultured rat lenses were incubated in isotonic artificial aqueous humor (AAH) that contained either the KCC-specific inhibitor [(dihydronindenyl)oxy] alkanoic acid (DIOA), the KCC activator N-ethylmaleimide (NEM), or the chloride channel inhibitor 5-nitro-2-(3-phenylpropylamino) benzoic acid (NPPB) for up to 18 hours. Lens wet weight was monitored, and lens transparency and tissue morphology were recorded with dark-field and confocal microscopy, respectively.

results. Molecular experiments to characterize KCC isoform expression showed that KCC1, -3, and -4 were all expressed in the lens at both the transcript and protein levels and that KCC2 was not. Immunocytochemistry indicated that the three KCC isoforms exhibited distinct differentiation-dependent expression patterns, with KCC1 and -3 being restricted to the lens cortex, whereas KCC4 was found throughout the entire lens, including the lens core. In the lens cortex, most of the labeling for all KCC isoforms was cytoplasmic, whereas in the lens core, KCC4 labeling was associated with the membrane. Incubation of lenses in 100 μM DIOA for 18 hours caused lenses to increase their wet weight and induced a cortical opacity that was caused by extensive damage to peripheral fiber cells located up to 150 μm in from the lens capsule, whereas deeper fiber cells appeared unaffected by DIOA exposure. Lower concentrations of DIOA (10 μM) revealed that this damage was initiated primarily by the swelling of peripheral fiber cells. In contrast, NPPB-treated lenses exhibited a deeper zone (>100 μm) of cell damage that was initiated by the dilation of the extracellular space between fiber cells. Exposure of lenses to the KCC activator NEM caused cell shrinkage in peripheral fiber cells but extensive cell swelling in deeper fiber cells. Peripheral cell swelling caused a differential recruitment of KCC isoforms from a cytoplasmic pool to the plasma membrane. DIOA-induced cell swelling increased the association of KCC4 with membrane, whereas hypotonic cell swelling dramatically increased the association of KCC1 with the membrane.

conclusions. The rat lens expresses three KCC transporter isoforms (KCC1, -3, and -4) in a differentiation-dependent manner. Modulation of transporter activity and subcellular localization suggests that multiple KCC transporters mediate KCl efflux in peripheral fiber cells in a dynamic fashion. These results indicate that, in addition to Cl⁻ channels, KCC transporters play a role in mediating a circulating flux of Cl⁻ ions, which contributes to the maintenance of lens transparency through controlling the steady state volume of lens fiber cells.

The maintenance of lens transparency is critically dependent on the ability of the lens to regulate the volume of its constituent fiber cells. Fiber cell swelling or shrinkage not only disrupts the regular arrangement of these cells, but also changes the solubility of the crystallin proteins, thereby producing light scattering and eventually lens cataract. ¹ Earlier studies have shown that lenses placed in hypotonic medium initially swell, but then undergo a regulatory volume decrease (RVD) through the loss of K⁺ and Cl⁻ ions. ² More recently, the role that Cl⁻ ions play in this process has been further investigated by culturing rat lenses in the presence of a range of Cl⁻ channel inhibitors, including 5-nitro-2-(3-phenylpropylamino) benzoic acid (NPPB). ^{3 4 5} In these experiments, exposure of lenses cultured under both hypotonic and isotonic conditions to Cl⁻ channel inhibitors produced an increase in lens volume. ³ This indicates that, under normal isotonic conditions, a constitutively active flux of Cl⁻ ions exists in the lens that regulates fiber cell volume and thereby maintains lens transparency. 

Mathias et al. ⁶ predicted the existence of such a circulating flux of Cl⁻ on the basis of measured radial changes in membrane potential and a knowledge of the Nernst potential for Cl⁻, E_Cl. This analysis of E_Cl predicted that Cl⁻ efflux would predominate in peripheral fiber cells, whereas Cl⁻ influx would occur in deeper fiber cells. Support for the existence of such a circulating flux was provided by the morphologic examination of the damage phenotype induced by exposure of organ-cultured lenses to NPPB. ⁴ NPPB-treated lenses exhibited two distinct damage phenotypes: an initial deeper (150–300 μm) zone of extracellular space dilations, due to the blockage of Cl⁻ influx, and a more peripheral zone of mild cell swelling, caused by the inhibition of Cl⁻ efflux. To verify the involvement of chloride channels in these two processes, Webb et al. ⁷ conducted patch clamp experiments on isolated fiber cells. Fiber cells that were greater than 120 μm in length originated from the zone of extracellular space dilations and exhibited an outwardly rectifying chloride conductance that was blocked by Cl⁻ channel inhibitors. In contrast, shorter, more peripheral fiber cells isolated from the zone of cell swelling appeared to lack constitutively active Cl⁻ channels (Donaldson PJ, et al. IOVS 2005;46:ARVO E-Abstract 1129), ⁸ suggesting that a nonconductive Cl⁻ transport system mediates Cl⁻ efflux in these cells, at least in isotonic conditions. 

One such potential Cl⁻ efflux pathway is via the multigene potassium chloride cotransporter (KCC) family. KCC transporters were originally identified as the electroneutral pathway responsible for the RVD that occurred in response to exposing a variety of cell types to hypotonic solutions. ⁹ In these cells, the increase in volume activates KCC transporters, stimulating the extrusion of K⁺ and Cl⁻ ions that produces an obligatory loss of water, which enables cell volume to return toward normal. Subsequent molecular studies determined that the KCC family comprises four isoforms that have several other functions in addition to RVD. KCC1 is activated by changes in cell volume. It is the most ubiquitously expressed of the family and is commonly referred to as the “housekeeping” isoform. ¹⁰ KCC2 is the neuron-specific isoform, which is proposed to have a role in active chloride extrusion to ensure effective postsynaptic inhibition. ¹¹ KCC3 is widely expressed, but it is only weakly activated by changes in cell volume, suggesting its activity is modulated by other stimuli. ¹² This view is supported by Shen et al., ¹³ who showed that while KCC3 was not activated by cell swelling, its activity could be increased by insulin-like growth factor-1, which leads to a stimulation of cell growth in NIH/3T3 cells. The remaining isoform, KCC4, is highly expressed in the kidney ¹⁴ and the brain. ¹⁵ KCC4-knockout mice exhibit deafness due to rapid degeneration of auditory hair cells and renal tubular acidosis. ^{16 17}  

The activity of KCC transporters and therefore cell volume can be manipulated pharmacologically with the specific inhibitor [(dihydronindenyl)oxy] alkanoic acid (DIOA) ¹⁸ and the activator N-ethylmaleimide (NEM). ^{19 20} In the lens, Diecke and Beyer-Mears ²¹ used these reagents to assess whether KCC transporters contribute to volume regulation in cultured lens epithelial cells. They found that, on exposure to a hypotonic solution, lens epithelial cells underwent a RVD that was inhibited by DIOA. Furthermore, the application of NEM under isotonic conditions activated a KCl efflux that resulted in the shrinkage of lens epithelial cells. These results suggest that KCC transporters are expressed in the lens epithelium and mediate a K⁺-dependent Cl⁻ efflux that modulates epithelial cell volume. 

To determine whether KCC transporters also contribute to the maintenance of fiber cell volume, we investigated whether they are expressed in lens fiber cells and whether they contribute to Cl⁻ fluxes in the rat lens. In our study, fiber cells expressed multiple KCC isoforms in a differentiation-dependent manner and pharmacological modulation of KCC caused an increase in lens volume through the disruption of the ability of cortical fiber cells to regulate their volume correctly. These results indicate that in addition to Cl⁻ channels, ⁷ cortical fiber cells use KCC transporters to modulate their cellular volume, thereby preserving the ordered tissue architecture necessary for the maintenance of lens transparency. 

Materials and Methods

Chemicals

Phosphate-buffered saline (PBS) tablets, DIOA, fluorescein isothiocyanate–conjugated wheat germ agglutinin (FITC-WGA, Triticum vulgaris), tetramethyl rhodamine isothiocyanate–conjugated wheat germ agglutinin (TRITC-WGA), and NEM were obtained from Sigma-Aldrich (St. Louis, MO); NPPB from Research Biochemical Incorporated (Natick, MA); and the primary antibodies and antigenic peptides for all KCC isoforms from Alpha Diagnostics International (San Antonio, TX). All antibodies were raised against unique sequences in the cytoplasmic N-terminus of each KCC isoform. The secondary antibody, goat anti-rabbit conjugated to Alexa 488, was obtained from Molecular Probes, Inc. (Eugene, OR). PCR primers were commercially synthesized (Invitrogen-Life Technologies, Gaithersburg, MD). 

Animals

All experiments involved 21-day-old Wistar rats, which were killed by CO₂ asphyxiation and spinal dislocation. All animals were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Rat lenses were extracted from eyes and placed in either sterile dimethyl pyrocarbonate (DMPC)-treated PBS for extraction of RNA or into artificial aqueous humor (AAH) for organ-culture experiments. 

RT-PCR

Extracted lenses were first rolled on filter paper to remove adherent tissue and then decapsulated to remove epithelial cells that were attached to the capsule. The remaining fiber cell mass was immediately placed in a stabilization reagent (RNAlater; Invitrogen, Carlsbad, CA) before total RNA isolation. Total RNA was extracted from fiber cells (RNAqueous kit; Invitrogen) according to the manufacturer’s protocols. Total RNA from positive control tissues (kidney and brain) was extracted (TRIzol; Invitrogen-Gibco, Grand Island, NY) according to standard protocols and reverse-transcribed (ThermoScript RT-PCR system; Invitrogen). cDNA synthesis was made from 1 μg/μL total RNA with 5 mM Oligo(dT)₂₀ in a total of 20 μL with DMPC-treated H₂O. Total RNA was denatured at 65°C for 5 minutes and then cooled on ice. Ten microliters of the mix was added to a 10-μL reaction volume containing final concentrations of 1× first-strand buffer, 10 mM dithiothreitol (DTT), 2 mM dNTPs, and 40 U ribonuclease inhibitor (RNaseOUT; Invitrogen). Fifteen units of reverse transcriptase (ThermoScript; Invitrogen) was added to the positive control mix. cDNA synthesis was performed at 60°C for 60 minutes, and the enzyme was deactivated by a 5-minute incubation at 85°C. cDNA mix (2 μL) was used for PCR amplification. Amplification reaction mixture contained 1× PCR buffer, 0.2 mM dNTPs, 1 to 2.5 mM MgCl_2, 2 units Taq DNA polymerase (Platinum; Invitrogen), and 0.2 μM sense and antisense primers from the primer sets listed in Table 1 . After initial denaturation for 2 minutes at 94°C, the KCC products were amplified with the thermocycling conditions listed in Table 1 . After a final elongation step of 72°C for 7 minutes, the PCR products were analyzed by electrophoresis on 0.8% agarose gels. A kit (QIAquick Gel Extraction Kit; Qiagen, Hilden, Germany) was used to extract PCR products from gels for direct sequencing. 

Western Blot Analysis

Crude membrane proteins were extracted from eight decapsulated rat lenses and one kidney. Tissue was homogenized in 1mL homogenate solution (5 mM Tris [pH 8.0], 5 mM EDTA, and 5 mM EGTA), then pelleted in a (SS34 rotor; RC 5C; Sorvall, Newtown, CT) at 12,000 rpm for 20 minutes. The pellets were washed twice in storage buffer (5 mM Tris [pH 8.0] 2 mM EDTA, and 100 mM NaCl), resuspended in the storage buffer to a concentration of approximately 4 mg/mL, and stored at −20°C. Crude fiber membranes from the outer cortex, inner cortex, and inner core of the lens were also prepared from 10 to 15 decapsulated lenses, with a microscope and a pair of sharpened tweezers. The superficial layers of fiber cells were peeled away and pooled as the outer cortex fraction. The remaining inner cortical fiber cells were removed to reveal a hard mass, which corresponded to the core of the lens. All three fractions were homogenized, washed, and stored, as outlined for the preparation of total crude fiber membranes. Proteins were first separated on a 10% SDS-polyacrylamide gel and transferred onto nitrocellulose membranes (Hybond-C; GE Healthcare, Arlington Heights, IL) by electrophoresis for 90 minutes at 170 mA. Membranes were stained (1% Ponceau, 1% acetic acid in double-distilled H₂O; milliQ; Millipore, Bedford, MA) to confirm transfer and integrity of proteins, washed in double-distilled H₂O membranes, and then incubated overnight at 4°C in blocking solution (1% BSA and 0.1% Tween-20 in TBS: 2 mM Tris-HCl, 140 mM NaCl [pH 7.6]). Membranes were subsequently incubated for 2 hours with KCC primary antibodies diluted in Tris-buffered saline (TBS; KCC1, 1:1000; KCC2, -3, and -4, 1:500). Antibody labeling of the membranes was visualized with chemiluminescence, per the manufacturer’s instructions (ECL; GE Healthcare). 

Immunohistochemistry

Organ-cultured lenses were fixed in 0.75% paraformaldehyde in PBS for 24 hours and cryoprotected with established procedures. ²² Subsequently, lenses were frozen in optimal cutting temperature (OCT) compound (Tissue-Tek; Sakura Finetek, Torrance, CA) and 10-μm sections were cryocut (CM3050; Leica Microsystems, Wetzlar, Germany) and placed on poly-l-lysine (Sigma-Aldrich)-coated microscope slides. Nonspecific binding was inhibited by placing sections in blocking solution (3% BSA and 3% normal goat serum) for 1 hour and washing them in PBS (three times, 5 minutes each). All antibodies were diluted in blocking solution. Primary antibodies (1:500) were added to the sections, which were then incubated for 2 hours at room temperature. After PBS washes (six times, 5 minutes each), sections were incubated with the secondary antibody, goat anti-rabbit conjugated to Alexa 488 (Molecular Probes), at a dilution of 1:200. Fiber cell membranes were labeled with WGA-conjugated TRITC diluted to 1:25 in PBS for 1 hour at room temperature. After final washes in PBS (six times, 5 minutes each), slides were mounted (Citifluor; Agar Scientific, Stansted, UK), and sealed against moisture loss. Negative control sections were subjected to identical procedures except for the absence of primary antibody, or incubation in a 1:50 dilution mix of peptide and 1:500 dilution of primary antibody for 1 hour, instead of the primary antibody alone. The subsequent treatments were identical with those just outlined. Sections were viewed with a confocal laser scanning microscope (TCS SP2; Leica Lasertechnik, Heidelberg, Germany). Labeling patterns were collected separately using the microscope software (SCANware; Leica) and merged (Photoshop 6.0; Adobe Systems, Mountain View, CA). 

Lens Culture Experiments

Lenses were extracted and placed in AAH (125 mM NaCl, 4.5 mM KCl, 10 mM NaHCO₃, 2 mM CaCl₂, 0.5 mM MgCl₂, 5 mM glucose, 20 mM sucrose, 1% penicillin/streptomycin, and 10 mM HEPES [pH 7.4]; osmolality 300 mmol/kg) for 1 hour at 37°C. Lenses which developed opacities during this preincubation period were discarded. Some six to eight transparent lenses were transferred to either fresh AAH (control) or to AAH containing either DIOA (10 or 100 μM), NPPB (10 or 100 μM), or NEM (1 mM) and incubated for up to 18 hours at 37°C. DIOA and NEM were dissolved in AR grade ethanol, whereas NPPB was dissolved in dimethyl sulfoxide (DMSO; 0.1% vol/vol). Lenses incubated in AAH with only the solvents exhibited no changes in tissue architecture. Hypotonic AAH (osmolality 150 mmol/kg) was identical with AAH but contained only 50 mM NaCl. At appropriate time points, lenses were fixed in 25% Karnovsky’s solution (1% paraformaldehyde, 50 mM sodium cacodylate, 1.25% glutaraldehyde [pH 7.4]; osmolality 300 mmol/kg in PBS) for 4 hours at room temperature. Lens transparency was assessed with a dissecting microscope fitted with dark field optics. Fixed lenses were then gently rolled on filter paper (Whatman; Eastman Kodak, Rochester, NY) to remove any adherent tissue. Lenses were then superglued to the plate of a vibrating knife microtome (Leica VT1000; Technical Products International Inc., St. Louis, MO), in either axial or equatorial orientation, and 170-μm-thick sections cut. Sections were incubated in FITC-WGA (5 μL/mL in PBS) overnight in the dark at room temperature. After six 5-minute washes in PBS, sections were mounted onto glass slides (Citifluor; Agar Scientific), and sealed with nail polish to prevent dehydration. Membrane labeling was visualized on sections using confocal microscopy. 

Results

Molecular Identification of KCC Isoforms in the Lens

Although functional measurements had indicated that KCC transporters were expressed in cultured lens epithelial cells, ²¹ we wanted to determine first whether they were also expressed in rat lens fiber cells. The gene sequences of the four rodent isoforms of KCC (KCC1–4) were aligned, and the variable regions were used to design isoform-specific PCR primer sets (Table 1) . PCR conditions were first optimized for each primer set using appropriate control tissues, and optimal PCR conditions were then applied to cDNA reverse transcribed from lens fiber cells (Fig. 1A) . PCR products of the expected size were obtained for KCC1, -3, and -4 from rat lens fiber cells. No product was found for the neuron-specific isoform KCC2 ^{11 23} in fiber cells, even though it was detected in the brain. The identity of all PCR products was confirmed by sequencing (data not shown). In all cases, no PCR products were amplified from RT-negative controls. To verify that KCC1, -3, and -4 were not only present at the transcript but also at the protein level, Western blot analysis was performed with commercially available isoform-specific antibodies (Fig. 1B) . Protein bands of the appropriate size range were detected for KCC1 (∼120 kDa), ¹⁰ KCC3 (∼127 kDa), ²⁴ and KCC4 (∼140 kDa) ¹⁵ in the crude rat lens fiber cell membrane preparations. Consistent with our RT-PCR results, no product was detected for KCC2 in lens fiber cells, even though a band of the correct size (∼123 kDa) was detected in brain tissue. ¹⁰ To confirm that antibodies were specific to each isoform, antigenic peptide competition assays were performed. For each KCC isoform, preabsorption with its specific antigenic peptide eliminated KCC protein bands on their respective Western blot analysis, whereas preincubation with nonspecific KCC antigenic peptides had no effect (data not shown). 

Differential Expression of KCC Isoforms in the Rat Lens

Having confirmed that KCC transporters were expressed in the rat lens at both the transcript and protein levels, we wanted to determine where in the lens these isoforms are expressed. Detection was achieved by double labeling equatorial cryosections with the membrane marker TRITC-WGA, and each of the KCC isoform-specific antibodies (Fig. 2) . In all cases, labeling was not detected in control experiments in which we used no primary antibody or when the primary antibody was preincubated with its corresponding antigenic peptide (data not shown). KCC1 labeling was restricted to the epithelial cells and peripheral fiber cells in the outer cortex of the lens (Fig. 2A) . At higher resolution, it appeared that most of the KCC1 labeling in epithelial cells (Fig. 2B) , and peripheral fiber cells (Fig. 2C)was associated with the cytoplasm. No KCC1 labeling was found in the lens core (Fig. 2D) . Consistent with our RT-PCR and Western blot results, no signal was detected in sections labeled with KCC2 antibodies (data not shown). KCC3 labeling also extended into the cortex (Fig. 2E) , but to a greater depth (up to ∼200 μm) than KCC1. KCC3 labeling in the epithelium (Fig. 2F)and cortical fiber cells (Fig. 2G)was again predominately cytoplasmic, but there was also significant membrane labeling. No KCC3 labeling was found in the lens core (Fig. 2H) . In contrast to both KCC1 and -3, KCC4 labeling was detected throughout the lens from the periphery to the core (Fig. 2I) . At higher resolution, it was apparent that KCC4 labeling in the epithelium and peripheral fiber cells (Fig. 2J)was again predominately cytoplasmic, although some membrane labeling was apparent. With increasing depth into the lens, KCC4 labeling underwent a transition from cytoplasmic to membranous (Fig. 2K)in the deeper cortex before becoming entirely membranous in the core (Fig. 2L) . 

To confirm the differentiation-dependent expression of the KCC1, -3, and -4, we performed Western blot analysis of fiber cell membranes prepared from different regions of the lens (Fig. 3) . Consistent with the immunolabeling experiments, KCC1 was predominately present in the outer cortex, and KCC3 was found equally in both the outer and inner cortex. Both isoforms were absent from the lens core. In contrast, KCC4 was found in all three lens regions. Of interest, KCC4 in the core appeared as a doublet, suggesting that it may undergo some form of posttranslational modification. Taken together, our molecular identification and localization studies suggest that KCC1, -3, and -4 exist as separate cytoplasmic and membranous pools in the lens cortex. All isoforms were expressed in the epithelium, but the extent to which they were expressed in fiber cells varied with lens depth, thereby suggesting that KCC isoform-specific expression varied as a function of fiber cell differentiation. Finally, KCC4 is the only isoform found in the core of the lens. 

Pharmacological Modulation of KCC Activity

To determine whether these KCC transporters are functionally active and contribute to the maintenance of lens volume, organ-cultured lenses were incubated in the presence and absence of DIOA for up to 18 hours. Lenses incubated in isotonic AAH in the absence of DIOA maintained both their transparency and volume as assessed by dark-field microscopy and wet weight measurements, respectively (data not shown). In contrast, cultured lenses exposed to 100 μM DIOA for 18 hours showed a severe cortical cataract (data not shown) and exhibited a significant percentage increase (44.9% ± 4.7%, n = 5, P < 0.05) in their wet weight. This suggests that KCC transporters are constitutively active in the lens and that their inhibition causes fluid accumulation. To determine where this fluid accumulates, we examined the tissue architecture of DIOA-treated lenses by confocal microscopy. Although equatorial sections of control lenses displayed the typically crystalline distribution of fiber cells (Fig. 4A) , DIOA-treated lenses (100 μM) showed a zone of extensive tissue damage characterized by rupture of fiber cells that extended from the lens capsule to a depth of ∼150 μm into the lens cortex. The cellular morphology became essentially normal again deeper into the lens (Fig. 4B) . Reducing the concentration of DIOA to 10 μM clearly revealed that the damage induced by this drug consisted of two spatially distinct damage phenotypes: a predominant swelling of peripheral fiber cells, and a lesser inner zone of extracellular space dilations (Fig. 4C) . This DIOA-damage phenotype was different from that observed previously in lenses exposed under otherwise identical conditions to the chloride channel blocker NPPB. ⁴ Lenses treated with 100 μM NPPB exhibited only mild cell swelling in peripheral fiber cells, with the major site of damage located deeper than in DIOA-treated lenses (Fig. 4D) . Lowering the concentration of NPPB to 10 μM revealed that the deeper zone of NPPB-induced fiber cell rupture was initiated by dilations of the extracellular spaces between fiber cells located at an ∼150-μm depth from the capsule (Fig. 4E) . At this lower, more specific concentration of NPPB, the peripheral cell swelling observed in Figure 4Dwas eliminated, which suggests that the primary site of action for this drug is the inhibition of Cl⁻ channels that mediate the influx of Cl⁻ ions into deeper fiber cells. ⁷  

Two possible explanations exist for the ability of DIOA to induce two spatially distinct damage phenotypes. The first relates to the well-known nonspecificity of Cl⁻ transport inhibitors. Thus, whereas 10 μM DIOA is thought to be specific for KCC, ^{25 26 27} it is possible that in addition to its effects on KCC, DIOA also blocks other Cl⁻ transport proteins such as Cl⁻ channels and/or the Na⁺-K⁺-dependent Cl⁻ cotransporter (NKCC) that is known to be expressed in the lens. ²⁸ However, whole-cell patch-clamp recordings conducted in our laboratory show that DIOA does not alter the Cl⁻ conductance of fiber cells isolated from the zone of extracellular space dilations (Webb KF, personal communication, 2004). Furthermore, organ culturing of lenses in the presence of the NKCC inhibitor, bumetanide, did not cause swelling of peripheral fiber cells (Chee KN, unpublished data, 2004). An alternative explanation can be evoked by considering that the Cl⁻ equilibrium potential, which ultimately determines the direction of K⁺ and Cl⁻ transport, ²⁹ changes with distance into the lens, as suggested by Mathias ³⁰ and Mathias and Rae. ³¹ In this scenario, DIOA blockade of KCl efflux in peripheral cells would produce cell swelling, but in deeper cells inhibition of KCl influx causes ions and fluid to accumulate between fiber cells, resulting in extracellular space dilations. If this contention were correct, we would expect that an NEM-induced increase in KCC activity to cause shrinkage of peripheral fiber cells, due to an enhanced KCl efflux and obligatory water loss, whereas in deeper fiber cells stimulation of KCl influx would induce fluid uptake. Lenses cultured under isotonic conditions for 18 hours in the presence of NEM exhibited a significant increase in wet weight (42.5% ± 4.1%, n = 6, P < 0.05). NEM induced two distinctly different changes in tissue morphology (Fig. 5) . The most prominent change was the formation of a deeper zone of tissue liquefaction (Fig. 5A) .We have shown in previous studies that such localized tissue liquefaction can be induced by cell rupture initiated by either extracellular space dilations or cell swellings. ^{4 32 33} In this case the absence of extracellular space dilations and the appearance of cell swelling at the margins of the zone of tissue liquefaction indicates that the NEM-induced tissue liquefaction is induced by cell swelling consistent with the stimulation of KCl influx and subsequent fluid accumulation. 

Less obvious is that peripheral fiber cells in NEM-treated lenses appeared shrunken (Fig. 5B)relative to peripheral cells from control lenses (Fig. 5C) . To quantify the extent of cell shrinkage, the number of individual cells contained within the first 50 μm of a fiber cell column were counted in control (15.7 ± 3.7 cells/50 μm, n = 13) and NEM-treated lenses (22.7 ± 2.1 cells/50 μm, n = 3). This analysis showed that NEM produced a significant increase (P < 0.05) in the number of cells contained with in the first 50 μm, a result consistent with fiber cell shrinkage. This shrinkage of peripheral cells in NEM-treated lenses was in direct contrast to the cell swelling observed in DIOA-treated lenses (Fig. 4C) . All evidence taken together, the contrasting DIOA and NEM damage phenotypes supports our contention that the morphologic effects we observe are due to the specific modulation of KCC transporter activity not to some nonspecific effect of the pharmacological reagents used. Thus, it appears that KCC transporters are constitutively active in the lens under isotonic conditions and that the electrochemical gradient for Cl⁻ determines the direction of the Cl⁻ fluxes that they mediate. 

Differential Recruitment of KCC Isoforms to the Plasma Membrane

Our morphologic data imply that a pool of functionally active KCC transporters are located in the membranes of peripheral fiber cells (Figs. 4 5) . It is our contention that these KCC transporters mediate KCl efflux from the lens, and, when blocked by DIOA, the subsequent trapping of KCl results in an isosmotic cell swelling in peripheral fiber cells. If this contention is correct, we would expect swollen cells to exhibit significant membrane expression of KCC transporters. However, our localization data suggest that most of the KCC transporters in peripheral cells are located in the cytoplasm, not the plasma membrane (Fig. 2) . To investigate this apparent discrepancy more closely, the relative membrane expression patterns of each KCC isoform in peripheral cells from organ-cultured lenses incubated under isotonic conditions in either the presence or absence of DIOA for 18 hours was examined (Fig. 6) . For KCC1, it appears that there is a minimal association of the transporter with the membrane in the either the absence or presence of DIOA indicating that this isoform plays a minor role in mediating KCl efflux under isotonic conditions (Fig. 6 , top panel). Because KCC1 is known to be strongly activated by cell swelling, we investigated whether exposure to hypotonic AAH changed the subcellular distribution of KCC1. Hypotonic-induced cell swelling caused a massive recruitment of KCC1 from the cytoplasm to the membrane, indicating that this isoform primarily mediates KCl efflux under conditions of osmotic stress. In contrast, KCC3 although present in the membrane, did not appear to change its subcellular location in response to cell swelling induced by incubation of lenses in either DIOA or hypotonic AAH (Fig. 6 , middle panel). Finally, the membrane-abundant expression of KCC4 appeared to be increased in cells swollen by exposure to either isotonic AAH plus DIOA or hypotonic AAH (Fig. 6 , bottom panel). These experiments indicate two things. First, the colocalization of an amount of KCC3 and -4 with the membrane of peripheral fiber cells in control and DIOA-treated lenses indicates that the inhibition of these two isoforms may account for the observed cellular swelling observed in DIOA-treated lenses. Second, the ability of changes in cell volume to stimulate the recruitment of specific KCC isoforms from a presumably inactive cytoplasmic pool to an active membranous pool indicates that the regulation of KCC activity on cortical fiber cells is a dynamic process that can be massively upregulated if required. 

Discussion

The lens uses spatial differences in the expression of a variety of ion channels and transporters to establish a circulating flux of ions that generate an internal microcirculation system. ^{6 34} Our results suggest that KCC transporters in the rat lens contribute to this microcirculation and the control of lens volume. Although evidence for a role of KCC transporters in the regulation of cell volume in cultured lens epithelial cells has been published, ²¹ ours is the first study to show that KCC transporters are also functional in fiber cells and contribute to the maintenance of overall lens volume. This finding does not appear to be due solely to the activity of KCC transporters located in the epithelium, because we showed that KCC1, -3, and -4 were also expressed in fiber cells and that their pharmacological manipulation caused spatially distinct changes in fiber cell morphology. 

Previously, we showed that spatially distinct damage phenotypes observed after blocking Cl⁻ channels with NPPB could be explained by a circulating flux of Cl⁻ ions. ⁴ Based on measured radial changes in membrane potential and knowledge of the Nernst potential for Cl⁻, E_Cl, Mathias et al. ⁶ predicted that Cl⁻ efflux would predominant in peripheral fiber cells, whereas Cl⁻ influx would occur in deeper fiber cells (Fig. 7A) . In these deeper fiber cells, both NPPB (Fig. 7B)and DIOA (Fig. 7C)were capable of inducing extracellular space dilations, which we have interpreted as an indication of the inhibition of a Cl⁻ influx that results in a trapping of ions and fluid between fiber cells and the localized swelling of the extracellular space. A careful comparison of the extent of extracellular space dilations induced by DIOA and NPPB (Fig. 4)shows that tissue damage was more severe when Cl⁻ channels were blocked. Although this effect could be due to a difference in the rate of diffusion of DIOA and NPPB into lens, we believe this not to be the case considering the length of the incubation period (18 hours), and the observation that large-molecular-weight molecules freely permeate the lens cortex. ³⁵ Instead, this result suggests that Cl⁻ entry in deeper fiber cells occurs predominately via a channel-mediated pathway, with KCC transporters playing a minor role in fiber cells located in this area. In peripheral fiber cells the ability of low concentrations of DIOA, but not NPPB, to induce swelling of these cells, suggests that under isotonic conditions Cl⁻ efflux in this region is mediated predominantly by KCC transporters. 

The invoking of the existence of circulating Cl⁻ fluxes as an explanation for the spatially different DIOA damage phenotypes is supported by the effects of NEM on lens morphology. NEM caused cell shrinkage in peripheral fiber cells, but caused cell swelling in deeper fiber cells. This indicates that NEM-induced stimulation of KCC transporters increased Cl⁻ efflux and influx in peripheral and deeper fiber cells, respectively (Fig. 7D) . It has been shown in other cell types, that the stimulatory effects of NEM on KCC transporter activity are mediated indirectly via thiol inactivation of two kinases, which determine the phosphorylation status of KCC. ²⁷ Phosphorylation of the transporter by a serine-threonine kinase causes inactivation, whereas dephosphorylation with a PP1A phosphatase activates the transporter. ³⁶ NEM has been shown to act, not only by inactivating the serine-threonine kinase, but also via the inhibition of a second kinase that controls the activity of PP1A, thereby causing unabated activation of KCC through dephosphorylation. ^{37 38} In the present study, the effects of NEM on tissue architecture suggest that the lens contains a similar collection of kinases and phosphatases that may control lens volume by modulating the phosphorylation status of KCC transporters. Thus, the dephosphorylation of membrane resident KCC would be expected to increase transporter activity, but as shown in Figure 2 , most KCC is actually located in the cytoplasm of fiber cells in the lens cortex. However, as shown in Figure 6 , this pool of inactive cytoplasmic KCC transporters can be recruited to the plasma membrane under certain conditions, which suggests that KCC activity can be increased, not only through dephosphorylation of the protein, but also by increasing the number of transporters in the plasma membrane. Although, the recruitment of additional transporters from a cytoplasmic pool is a common strategy used to increase transporter activity, ^{39 40} this is, to our knowledge, the first report to show the recruitment of KCC. 

Because the actions of DIOA and NEM do not specifically target individual KCC isoforms, the model presented in Figure 7does not distinguish between KCC isoforms. Therefore, it does not encapsulate the regional differences in KCC isoform expression patterns we have observed (Fig. 2)or the dynamic isoform-specific recruitment of KCC transporters (Fig. 6) . However, based on the known properties of KCC transporters in other tissues ²⁷ and the data presented in Figure 6 , it is interesting to speculate on the functional significance of the observed differential expression of KCC isoforms in the lens. The predominately cytoplasmic expression pattern of KCC1 in the lens cortex, plus its tendency to be activated by changes in cell volume, ¹⁰ indicate that this isoform is not normally involved in mediating KCl efflux under isotonic conditions. However, our observation that the amount of KCC1 in the membrane of peripheral fiber cells increases dramatically on incubation of lenses in hypotonic AAH, but not DIOA, suggests that the primary role of this isoform is to mediate the loss of KCl that occurs during RVD in peripheral fiber cells. In contrast, the levels of KCC3 in the membrane did not change dramatically when peripheral cells were swollen by exposure to either DIOA, or hypotonic solution, consistent with the idea that the primary function of KCC3 is not cell volume regulation, but the regulation of cell growth. ¹³ In NIH/3T3 cells overexpression of KCC3 led to an enhancement in cell proliferation that was abolished by DIOA. Furthermore, the addition of insulin-like growth factor (IGF)-1 to NIH/3T3 cells upregulated KCC3 expression levels and stimulated cell growth. ¹³ In lens explants IGF-1 is known to be important for the maintenance of fiber cell differentiation. ⁴¹ Thus, it is possible that an IGF-1-mediated upregulation of KCl influx mediated by KCC3 promotes the increase in cell volume that drives the massive elongation of differentiating fiber cells. ^{42 43} KCC4 appears to be the strongest candidate for mediating KCl efflux under isotonic conditions, because it has the strongest association with the membrane under normal conditions and its localization in the membrane can be increased by exposure to both DIOA and hypotonic solutions. 

Although all three KCC isoforms are expressed in the lens cortex and appear to have different functions in these cells, only KCC4 was detected in the lens core. The strong association of KCC4 with the membrane in the lens core suggests that this transporter is primarily active in this region. This initial accumulation of KCC4 in the cytoplasm of peripheral fiber cells followed by its insertion into the membrane of mature fiber cells, mirrors that seen for a variety of transporter proteins. ^{44 45} Because fiber cells have a limited ability to synthesize membrane proteins due to the degradation of cellular organelles and nuclei, ⁴⁶ we hypothesized that young fiber cells produce a cytoplasmic store of membrane proteins that can be inserted into the membrane at a later stage in the process of fiber cell aging and differentiation, thereby circumventing the inability of older fiber cells to synthesize membrane proteins de novo. ⁴⁷ Because we used Vibratome (Ted Pella, Irvine, CA) sections in our morphologic analysis, in which the lens core was lost during the sectioning procedure, determining whether KCC4 is actually functional in the core of the lens necessitates the development of novel assays to probe membrane transport in the lens core. 

In summary, we determined that members of the KCC transporter family contribute to the regulation of lens volume and therefore the maintenance of lens transparency. These results, plus our previous work on Cl⁻ channels, ^{4 5 7} indicate that Cl⁻ channels and transporters interact to modulate the steady state volume of the lens dynamically . Because cortical cataract is associated with an osmotic damage to lens fiber cells, ¹ the modulation of Cl⁻ channels and transporters may represent a strategy for the development of novel anticataract therapies. However, to implement this strategy fully, not only must the relative contributions of Cl⁻ channels and transporters involved in volume regulation be determined, but also how their activities are modulated in both the normal and cataractous lens. 

 Supported by the Health Research Council of New Zealand, Foundation for Research Science and Technology.

 Submitted for publication March 15, 2005; revised July 20 and October 3, 2005; accepted December 2, 2005.

 Disclosure: K. N. Chee, None; J. Kistle r, None; P.J. Donaldson, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Specific KCC PCR Primer Sets

Isoform	Accession Number	Oligonucleotide	Product Size (bp)	Thermocycling Conditions
KCC1	U55815	Sense (20 bp, position 1136)	859	35 cycles of:
		ACCTGTGGAGTGCTTACCTG		94°C for 30 sec
		Antisense (20 bp, position 1975)		69.7°C for 30 sec
		ATCCCATCACCCCACTCCTT		72°C for 30 sec
KCC2	U55816	Sense (22 bp, position 119)	401	35 cycles of:
		CTCAACAACCTGACGGACTG		94°C for 30 sec
		Antisense (22 bp, position 493)		55°C for 30 sec
		GCAGAAGGACTCCATGATGCCTGCG		72°C for 30 sec
KCC3	AF105366	Sense (20 bp, position 1081)	320	35 cycles of:
		ACGCACTCAAGGAATCAGCA		94°C for 30 sec
		Antisense (22 bp, position 1379)		60°C for 30 sec
		CGAGTTACAGAAGAATCCCCAT		72°C for 30 sec
KCC4	AF087436	Sense (20 bp, position 918)	504	35 cycles of:
		CTGTGTTGTGCTTTCTATCC		94°C for 30 sec
		Antisense (20 bp, position 1400)		60°C for 30 sec
		CTTCTGGGCGTCTTTGAGGT		72°C for 30 sec

Figure 1.

 

Molecular identification of KCC isoforms in the rat lens. (A) Agarose gel showing RT-PCR products amplified with total RNA extracted from control tissues and rat lens fiber cells (F). PCR products were detected for KCC1 in kidney (K) and fiber cells; for KCC2 in brain (B), but not in fiber cells; for KCC3 in kidney and fiber cells; and for KCC4 in kidney and fiber cells. Negative control lanes which lacked reverse transcriptase (−) show no amplification. Far right and far left lanes: DNA ladders for analysis of PCR product size. (B) Western blot analysis showing the presence of KCC isoforms in crude rat lens membrane preparations. Protein bands of the appropriate size were detected for KCC1, -3, and -4, but not KCC2, in lens fiber cells (F). A band however, was detected for KCC2 in the control tissue brain (B), thereby confirming antibody activity.

Figure 2.

 

Differential expression of KCC isoforms in the rat lens. Image montages of equatorial cryosections doubled-labeled with KCC antibodies (green) and the membrane marker TRITC-WGA (red) showing the extent of KCC1 (A), KCC3 (E), and KCC4 (I) from the periphery to the core of the lens. High-power images of the areas indicated in each image montage show the subcellular distribution of KCC1 (B, C, D), KCC3 (F, G, H), and KCC4 (J, K, L) in the outer cortex (B, F, J), inner cortex (C, G, K), and core (D, H, L) of the lens. Only KCC4 labeling was detected in the membranes of fiber cells of the lens core (L).

Figure 3.

 

Western blot analysis of KCC1, -3, and -4 in different lens regions. KCC1 was present in the whole fiber (WF) cell protein, and exhibited strong expression in the outer cortical region (OC) and also expressed in the inner cortical (IC) fiber cells. KCC3 showed a similar distribution to KCC1, albeit at a lower level in the outer cortical fiber cells. KCC4 was present in whole fiber (WF) cell protein and outer (OC) and inner (IC) cortical and core (C) fiber cells.

Figure 4.

 

Comparison of DIOA- and NPPB-induced tissue damage in lens cortex. Equatorial vibratome-cut sections labeled with FITC-conjugated WGA obtained from organ-cultured rat lenses incubated in isotonic AAH (A) and 100 μM (B) or 10 μM DIOA (C), or 100 μM (D) or 10 μM NPPB (E). DIOA-induced tissue damage was limited to peripheral fiber cells (B). In contrast, 100 μM NPPB produced a deeper damage phenotype (D). By lowering the concentration of both drugs to 10 μM, more specific and localized tissue disruptions were observed. DIOA induced a cellular swelling of the peripheral fiber cells (C) and extracellular swelling deeper into the cortex (C, inset), whereas NPPB caused only extracellular swelling deeper in the cortex (E, inset).

Figure 5.

 

NEM induced damage in the lens cortex. Equatorial vibratome-cut sections labeled with FITC-conjugated WGA obtained from organ-cultured rat lenses incubated in isotonic AAH in the presence (A, B) or absence (C) of 1 mM NEM. Dramatic tissue liquefaction ( ) was the predominant damage phenotype in NEM-treated lenses (A). However, at higher magnification it was apparent that, in the lens periphery, NEM caused fiber cell shrinkage (B) relative to that in lens cultured in the absence of NEM (C). In NEM-treated lenses deeper fiber cells adjacent to the zone of tissue liquefaction appear swollen and distort fiber cell columns (arrows), indicating that tissue liquefaction is initiated by swelling and the subsequent bursting of cells in this zone.

Figure 6.

 

Recruitment to the membrane of KCC isoforms induced by cell swelling. Images of fiber cells from the lens periphery that are double-labeled with isoform-specific KCC antibodies (green) and the membrane marker TRITC-WGA (red). Cryosections obtained from organ-cultured rat lenses incubated for 18 hours in either isotonic AAH, isotonic AAH+10 μM DIOA or hypotonic AAH were labeled with KCC1, -3, and -4 antibodies as indicated. The far right column shows only antibody labeling for hypotonically treated lenses.

Figure 7.

 

Comparison of damage phenotypes. Schematic diagrams of normal lens (A) showing chloride gradients and the damage phenotypes obtained by incubating lenses in NPPB (B), DIOA (C), and NEM (D). In peripheral fiber cells, Cl⁻ gradients favor Cl⁻ efflux, whereas in deeper fiber cells, Cl⁻ influx is promoted (A). Blocking Cl⁻ influx via Cl⁻ channels (B) or KCC transporters (C) results in the formation of a zone of extracellular dilations. Blocking Cl⁻ efflux via KCC transporters (C) causes cellular swelling in peripheral fiber cells. In contrast, activation of KCC via NEM (D) enhances Cl⁻ efflux in the periphery and Cl⁻ influx in deeper cells, resulting in cell shrinkage and swelling, respectively. The dephosphorylation of KCC is proposed to underlie its activation, which is achieved by NEM’s inactivating two key kinases involved in modulating the phosphorylation status of KCC.