Human wild-type (WT)-RS1 cDNA and C59S, R141C, C142W, and C142S mutants in pCEP4 (Invitrogen, Carlsbad, CA) have been described.
10 Quick change site-directed mutagenesis (Stratagene, La Jolla, CA) was used to introduce the following amino acid substitutions into RS1 (T185K, R141H, R141G, R141A, R141K, R141E, R141Q, R141V, R141S, D158N). The myc tag was inserted into WT-RS1 cDNA following the leader sequence (after aa 23) by PCR amplification of RS1 fragments containing a 5′ untranslated region, the N-terminal part of RS1 from position 1 to 69 (aa 1–23), the N-terminal half of the myc tag sequence, and an
AseI restriction site using primers P1 and P3 and amplification of a fragment consisting of an
AseI site, the C-terminal half of the myc tag and the C-terminal part of RS1 position 70 to 675 (aa 24–224), and a 3′ untranslated region using primers P2 and P4. Purified fragments were digested with
AseI (New England Biolabs, Pickering, ON, Canada) and ligated with T4 ligase (NEB). The resultant product was reamplified by PCR and cloned in pCEP4 using
XhoI and
HindIII. Primers used were as follows, with the
AseI restriction site marked in bold letters: P1, AGCAGAGCTCGTTTAGTGAACCG; P2, GTGGTTTGTCCAAACTCATC; P3, GAA
ATTAATCAGTGAGGAAGATCTGTCTACCGAGGATGAAGGCG; P4, CTG
ATTAATTTCTGCTCCGATAATCCCAATGTGGCTTC. All constructs were sequenced to verify the desired mutation and the absence of random mutations.