Syndromic Choroideremia: Sublocalization of Phenotypes Associated with Martin-Probst Deafness Mental Retardation Syndrome

Abstract

purpose. To identify the mutation leading to syndromic choroideremia (CHM) in two families and to define fundus autofluorescence (FAF) in CHM carriers.

methods. The ophthalmic and clinical phenotype was investigated including FAF, neuropediatric, otorhinolaryngologic, cardiologic, and nephrologic examinations of three male patients (age, 11–46 years) and three female carriers (age, 11–46 years) from two families. Genomic DNA amplification (PCR) of the REP1 gene as well as adjacent loci was used to determine the molecular basis of the phenotype.

results. Analysis of genomic DNA revealed large deletions that asymmetrically flank REP1 in both families, ranging from a minimum size of 6.3 and 8.5 mega base pairs (Mbp) to a maximum size of 9.7 and 14.1 Mbp, respectively. In addition to CHM, patients from these families exhibited mild syndromic features, including mental and motor retardation and low-frequency hearing loss. FAF showed a distinctive pattern characterized by small areas of reduced and increased autofluorescence in all female carriers.

conclusions. Both CHM families are the first to be described with large deletions that manifest with a mild syndromic phenotype. The location of the deletions indicates that they may allow sublocalization of the syndromic features to the most proximal region of X-linked distal spinal muscular atrophy (DSMAX) and Martin-Probst deafness mental retardation syndrome (MPDMRS). The FAF pattern is specific to CHM carriers and thus will help to identify and differentiate between carriers of other X-linked recessive carrier states such as in X-linked retinitis pigmentosa.

Choroideremia (CHM; Mendelian Inheritance in Man [MIM] 303100; National Center for Biotechnology Information, Bethesda, MD) is an X-linked inherited retinal degeneration characterized by a progressive degeneration of photoreceptors, retinal pigment epithelium (RPE), choriocapillaris, and eventually the choroid. ^{1 2} Night blindness develops in affected males during the teenage years. As the disease progresses, they experience peripheral visual loss that advances to severe constriction of the visual fields and loss of visual acuity leading to blindness in the late stages. Mental or motor retardation does not occur in the disease. Carriers usually do not manifest significant clinical symptoms but show scattered pigment deposits or focal areas of RPE atrophy. ^{3 4} Sporadic cases of severely manifesting carriers are known. ^{5 6} This variability of clinical manifestation is a result of lyonization. ⁷  

CHM is caused by mutations in the REP1 gene ^{8 9 10} that encodes the 653 amino acid long Rab escort protein-1 (REP1). The entire gene encompasses 186 Kb on the X-chromosome and is transcribed into mRNA of 5.442 Kb. REP1 acts as a regulator of Rab GTPases involved in intracellular vesicular transport. ^{11 12} It is ubiquitously expressed in the body, including photoreceptors, RPE, and choroid. ¹³ The pathogenesis of CHM is still unclear. Different disease mechanisms have been proposed that suggest rods ¹⁴ or the RPE ¹⁵ to be the primary site of damage, as well as independent degeneration of the photoreceptors and RPE. ¹⁶  

Causative mutations in the CHM gene result in an absent or nonfunctional REP1 and include: small deletions, ^{17 18 19 20 21 22 23 24 25 26} small insertions, ^{19 20 21 22 23 27} nonsense, ^{17 18 19 20 21 22 23 24 26 28 29 30 31 32} frame shift, ^{20 22 24 25 26} or splice-site mutations. ^{17 19 20 21 22 26 33 34} X-autosomal translocations in three female patients with choroideremia have also been described. ^{35 36 37} Mutations affecting larger regions include insertion of an L1 element ²¹ and gross deletions ranging from a few exons (Küsters U, et al. IOVS 1996;37:ARVO Abstract S107) ^{17 19 21 26} to deletions of the entire gene. ^{10 38 39}  

The latter accounts for approximately 25% of all REP1 mutations published so far. No correlation has been found between the size of the deletion and the severity of CHM. Strikingly, missense mutations in REP1 have not been identified. 

Complex phenotypes were found in a minor fraction of patients with CHM who showed larger deletions varying from 5 to 12 mega base pairs (Mbp). ^{8 40} Deletions of this size can cause syndromic CHM in the sense of a contiguous gene syndrome. ^{41 42} Such large deletions are associated with a severe clinical phenotype including choroideremia, severe mental retardation, agenesis of the corpus callosum, cleft lip and palate, and sensorineural deafness. ^{43 44}  

To this group of patients with syndromic CHM with complex phenotypes, we add two families with two novel, large interstitial deletions of at least 6.3 to 8.5 Mbp manifesting with CHM, motor retardation, moderate mental retardation, and hearing loss. In contrast to the previously described contiguous gene deletion syndromes, the syndromic features in these two families are rather mild. This is the first report on large deletions manifesting with such a mild syndromic phenotype. In addition, we describe a characteristic fundus autofluorescence (FAF) pattern in CHM carriers. 

Methods

Patients and Clinical Investigation

Two unrelated families (three affected males, three carrier females) were included in the study. The pedigrees are illustrated in Figure 1 . 

Informed consent was obtained before examination and blood draws. The study adhered to the tenets of the Declaration of Helsinki. Members of family G (I-2, II-1, II-2 and II-3) and of family H (II-5, III-2, III-3 and III-4) underwent a complete ophthalmic examination including Goldmann perimetry and Panel D15 color vision test. FAF was recorded with a standard confocal scanning laser ophthalmoscope (Heidelberg Retina Angiograph [HRA]; Heidelberg Engineering, Heidelberg, Germany). Full-field electroretinograms (ERG, maximum flash intensity, 2 cd · s/m²; Nicolet, Madison, WI) and multifocal electroretinograms (mfERG; VERIS 4.8, Electro-Diagnostic Imaging, Redwood City, CA) were performed with binocular stimulation, according to ISCEV (International Society for Clinical Electrophysiology of Vision) standards ⁴⁵ and guidelines. ⁴⁶  

The diagnosis of choroideremia was based on clinical and functional findings and was confirmed by genetic analysis, as described later in the following section. If indicated, patients underwent an interdisciplinary work-up including neuropediatric, otorhinolaryngologic, cardiologic, and nephrologic examinations. 

DNA Preparation and Analysis

Genomic DNA was isolated from 3 mL venous blood by standard techniques (Chemagic Magnetic Separation Module I; Chemagen, Baesweiler, Germany). Primers were designed with the Primer 3 public domain software (Primer 3: http://frodo.wi.mit.edu/ developed by Steve Rozen and Helen Skaletsky, Whitehead Institute and Howard Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, MA) and synthesized (Microsynth, Balgach, Switzerland). The sequences are listed in Table 1 . 

PCR conditions for 50 to 100 ng of genomic DNA template were as follows: Activation of the polymerase (HotFire; Solis BioDyne, Tartu, Estonia) for 15 minutes at 95°C was followed by denaturing at 95°C, annealing at 60°C, and extending at 72°C in 35 cycles, each step lasting 1 minute. Final extension at 72°C was continued for 10 minutes. Amplified DNA fragments were visualized after gel electrophoresis through 1% agarose in the presence of ethidium bromide. For each primer combination, a nontemplate (water) control sample was included. Based on the map view of the National Center for Biotechnology Information (NCBI) human genome build 36.2 (available at http://www.ncbi.nlm.gov/mapview/map_search.cgi?taxid=9606), a list of loci was established. Not every locus between LOC401602 and NAP1L3 was tested because of sequence duplications between X- and Y-chromosome. 

Results

Ophthalmic Observations in Patients with Choroideremia

Family G.

The 15-year-old patient (II-1) (Fig. 1)reported having nyctalopia since early childhood. His best corrected visual acuity was 20/50 (right eye) and 20/30 (left eye) in standard room illumination. He had mild subcapsular posterior cataracts. Fundus examination showed peripheral to midperipheral loss of choriocapillaris, peripapillary sclerosis of the choroidal vasculature, normal retinal vessels, and normal optic nerve heads (Figs. 2A 2B) . Goldmann perimetry revealed arcuate scotomas extending from the periphery to the center. The Panel D-15 test showed several errors along the protan and deutan axes in accordance with a known protanomaly. The scotopic ERG amplitudes and the single-flash cone response were not detectable, and a discrete Fourier transform of the flicker response did not reveal significant cone responses. MfERG amplitudes were reduced to one fifth of the norm. FAF could not be recorded from the patient due to fixation problems. 

Examination results for the patient’s two brothers (II-2 and II-3) were normal including those of functional tests. 

Family H.

The 21-year-old patient (III-2) (Fig. 1)reported adaptation difficulties. His best corrected visual acuities were 20/20 (right eye) and 20/25 (left eye) in standard room illumination. He had normal anterior segments. Fundus examination showed peripheral to midperipheral loss of choriocapillaris, peripapillary sclerosis of the choroidal vasculature, normal retinal vessels, and normal optic nerve heads with a peripapillary chorioretinal atrophy, the macula was relatively hyperpigmented (Figs. 2C 2D) . Goldmann perimetry revealed an arcuate scotoma (I/4) from 50° to 45° in the right eye. The saturated Panel D-15 test was without errors in both eyes. There was one error during unsaturated testing of the right eye and four errors of the left eye. The scotopic ERG signals were not detectable, and photopic responses were reduced to one fourth of the norm. MfERG amplitudes were reduced without local preferences, yet in the normal range. FAF was almost intact in the macula but severely reduced in the midperiphery to periphery (Figs. 2E 2F) . 

The 18-year-old sibling patient (III-3) had adaptation problems and mild nyctalopia. His best corrected visual acuities were 20/20 (both eyes) in standard room illumination. He had normal anterior segments. Fundus examination showed peripheral to midperipheral loss of choriocapillaris, normal retinal vessels, and normal optic nerve heads, the macula was relatively hyperpigmented (Figs. 2G 2H) . Goldmann perimetry results were normal. The saturated Panel D-15 test showed four errors in the right eye, six errors during unsaturated testing of the right eye, and five errors in the left eye, respectively. The scotopic ERG was reduced, and peak times of the photopic responses were prolonged. MfERG amplitudes were normal, yet showed a pathologic perifoveolar peak time increase. FAF was almost intact in the macular area but was severely reduced in the midperiphery to periphery (Figs. 2I 2J) . 

General Clinical Data of the Patients with Choroideremia

Family G.

Delayed motor and mental development became obvious during patient II-1’s first years of life. At the age of 4 years, a microhematuria episode was noted. Metabolic diseases were ruled out by serologic (thyroid stimulating hormone, triiodothyronine T3, thyroxine T4, circulating T3 and T4, electrolytes, creatinine, glucose, glutamic pyruvic transaminase, C-reactive protein, and total protein), blood (differential blood count), and urinary (uric acid, carbonic acid, fatty acids, and monosaccharides) assays. Cranial magnetic resonance imaging at age 7 was normal. Consequently, the diagnosis was global developmental delay of unknown origin. During the patient’s visit to our department, he displayed gait problems. His mother reported that he had learned to walk in his 24th month of life and was attending a special school for learning-impaired children. The patient underwent neuropediatric, nephrologic, and otorhinolaryngologic examinations. There was no hint of muscle disease. The gait problem and the mild mental retardation were attributed to general delayed development. A beginning of auditory hair cell damage affecting the low-frequency hearing was found in audiometry. The nephrologic examination was unremarkable except for a pelvic dilatation without functional impact. 

Family H.

Patient II-2 had had problems with motor coordination since infancy. He had learned to walk in his 18th month of life and showed delayed speech development with ongoing dyslalia. He had attended a special-needs school to graduate from a minimum-requirement school. In a neuropediatric examination he showed reduced facial expression, unilateral postural destabilization, dysdiadochokinesis, and delayed finger tapping. 

His brother, patient II-3, displayed fine motor-skill problems during the third to fourth years of life. He had learned to walk in the 15th month of life. He graduated from a minimum-requirement school. A neuropediatric examination was unremarkable. Both brothers were not available for otorhinolaryngologic testing. 

DNA Analysis

Family G.

DNA amplification of all REP1 coding exons (1–15) from the proband (II-1) and his mother (I-2) revealed fragments of expected sizes only in the mother, indicative of a deletion of the entire coding region of REP1 (data not shown). In searching for the break points, we amplified DNA markers within various distances to REP1 (Fig. 3 , Table 2 ). 

Of the proximal markers CXorf43, FAM121A, and POF1B, only CXorf43 was amplified in the patient (Fig. 3) . 

The distal markers DACH2, KLHL4, CPXCR1, and NAP1L3 did not amplify, but PCR fragments specific to the DIAPH2 locus were present (Fig. 3) . From these data, we concluded that the proband carried a minimal-sized deletion of ∼8.5 Mbp (Fig. 4) . Based on the presence of the markers CXorf43 and DIAPH2, the maximum size of the deletion was estimated as 14.1 Mbp (Fig. 4) . 

Family H.

DNA amplification of REP1 exon 10 from the proband (III-2) and his mother (II-5) revealed a fragment of expected size in the mother, but not in the proband, suggesting a deletion of REP1 (data not shown). As described for family G, we used various flanking loci (Figs. 3 4 ; Table 2 ) to identify the extent of the deletion. With the marker CXorf43, a fragment of expected size was amplified from both DNA samples, mother and affected son. Marker FAM121A did not yield a fragment from DNA of the affected son. Markers DACH2, KLHL4, CPXCR1, USP12P2, and PABPC5, which are distal to REP1, were absent. From this, we conclude that the deletion had a minimum size of approximately 6.3 Mbp. Since amplification of marker LOC401602 was successful in both samples, the maximum deletion size was determined to be 9.7 Mbp (Figs. 3 4) . DNA analysis from patient III-3 revealed a pattern identical to that found for proband III-2. Sibling carrier III-4 showed the same DNA amplification pattern as the mother II-5 (data not shown). 

Ophthalmic Observations in the Carriers

The age of the three carriers at the time of diagnosis was 44 (family G, I-2), 46 (family H, II-5), and 10 (family H, III-4) years. They did not have any ophthalmic or other medical symptoms. Carrier II-5 showed signs of bronchial asthma and allergies against pollen and animal fur. Visual acuities, anterior segments, visual fields, and color vision tests were normal. Scotopic and photopic full-field ERG and mfERG amplitudes were normal; however, the central mfERG amplitude was slightly diminished in individual I-2, and scotopic full-field ERG amplitudes of individual III-4 were at the lower normal limit. The fundi showed mottling of the RPE, discrete peripheral RPE clumping and small areas of chorioretinal atrophy (Figs. 5A 5B 5E 5F 5I 5J) . 

In all three carriers, FAF displayed speckles, small areas of reduced or increased autofluorescence, and an otherwise normal autofluorescence (Figs. 5C 5D 5G 5H 5K 5L) . In the youngest carrier III-4, the speckled pattern was rather subtle (Figs. 5K 5L) . 

Discussion

In two families with syndromic CHM, we detected two novel large deletions of at least 8.5 and 6.3 Mbp to at most 14.1 and 9.7 Mbp, respectively. Patients in both families exhibited a mild but complex phenotype. Furthermore, a unique FAF pattern was found in CHM carriers. 

FAF Pattern in CHM Carriers

FAF is used to monitor the natural autofluorescence of lipofuscin that accumulates in RPE cells after ingestion of rod outer segments and can be recorded in vivo by a confocal scanning laser ophthalmoscope. ^{47 48 49} Some retinal dystrophies show distinctive changes in FAF, which can be displayed as a radial pattern in XLRP ⁵⁰ or a ring-shaped pattern of increased FAF, indicative of autosomal RP, X-linked cone-rod dystrophy, ⁵¹ autosomal dominant cone-rod dystrophy, ⁵² or macular dystrophies such as Stargardt disease. ^{53 54} To date, FAF data on choroideremia carriers are very limited. The characteristic flecked autofluorescence pattern observed in our carriers seems to be specific to choroideremia carriers and has not been described in any other retinal dystrophy so far. A normal background autofluorescence is flecked by some spots of decreased and others of increased autofluorescence. Spots of decreased autofluorescence are likely to correspond to small patches of photoreceptor loss associated with RPE atrophy. Spots of increased autofluorescence are possibly due to increased lipofuscin accumulation in RPE cells due to the high turnover rate of photoreceptor outer segments ^{47 55} or to impaired phagocytosis. ⁵⁶ An age-dependent intensifying of the autofluorescence pattern seems possible, since the youngest carrier (family H, III-4) showed only very subtle changes compared with the adult carriers. 

These three new cases of altered autofluorescence in choroideremia carriers confirm the preliminary results of Wegscheider et al. who reported similar findings in five independent carriers (Wegscheider E, et al. IOVS 2005;46:ARVO E-Abstract 4088) and Renner et al., ⁶ who described one carrier. 

According to these data and our findings, FAF promises to be a powerful means of identifying CHM carriers and of differentiating between X-linked retinitis pigmentosa carriers who show a radial FAF pattern. ⁵⁰  

Deletion Mapping: Understanding the Syndromic Aspect Displayed by the Two Families

The large deletions involving X-chromosome q21.1-q21.33 in our two families encompass several mapped syndromes, either in their entirety or only parts of them. REP1 (MIM 300390) is completely lacking, which correlates with the molecular and clinical findings in the families described herein, as well as with previously reported deletions of the REP1 gene leading to syndromic and nonsyndromic choroideremia. ^{39 57} The region carrying the premature ovarian failure syndrome (POF2B; MIM 300604) is also entirely deleted, but as all affected members in our families were males, the syndrome is not expected to become manifest. It is unlikely that the female carriers of the deletion will be affected by this syndrome, but it remains to be seen, although heterozygotes have not been described to manifest this syndrome. ⁵⁸  

The X-linked distal spinal muscular atrophy DSMAX syndrome (MIM 300489) is only partially affected by the deletions described herein, although the distal end may be completely included in the deletion (Fig. 4) . This syndrome has not yet been mapped to a particular gene. Rather, its region extends over 21 Mbp. It is an X-linked recessive progressive disorder causing atrophy of the upper and lower limbs. In addition to foot deformities, gait instability has been reported. ⁵⁹ Even though patient II-1 of family G had no diagnosed muscle disease, it is conceivable that his gait problems constitute part of the DSMAX syndrome, as may the delayed motor coordination of patients III-2 and III-3 from family H. As no cognitive or sensory impairment has been described to be part of this syndrome, the mental retardation diagnosed in the patients we have described appears unrelated to DSMAX. The fact that female carriers in our two families did not show signs of clinical conditions is consistent with reports that female carriers appear to be clinically normal. 

It seems more likely that these aspects are components of the Martin-Probst deafness-mental retardation syndrome (MPDMRS; MIM 300519). The entire chromosomal region assigned to this syndrome encompasses about 68 Mbp, of which only approximately 13% were deleted in our two families. A multitude of disorders such as congenital sensorineural hearing loss, mental retardation, short stature, congenital umbilical hernia, facial dysmorphism, abnormal teeth, widely spaced nipples, and abnormal dermatoglyphics all belong to this syndrome. Progressive pancytopenia in adulthood has also been observed. ^{60 61} The mental retardation of the male patients described in this study could be a component of MPDMR syndrome. In addition, the early stages of auditory hair cell damage for low frequencies diagnosed in patient II-1 from family G may also be accounted for by the MPDMR syndrome. We can exclude the possibility that this hair cell damage is related to the deafness mixed with perilymphatic gusher syndrome, POU3F4 (MIM 300039), since marker CXorf43 is present in the patients and hence the deletion may not extend to POU3F4 (Fig. 4) . Taken together, the partial overlap of the deletions described herein with previously reported syndromes may allow a sublocalization of particular phenotypes. 

Two further syndromes, coronary heart disease, susceptibility to, 3 (CHDS3; MIM 300464) and diaphanous homolog 2 (DIAPH2; MIM 300108) map only to the distal end of the potentially deleted region in family G. None of the characteristic phenotypical aspects ^{62 63} were noted in our patients, suggesting that the deletion may not extend this far distally. Fine mapping of the deletion by using additional molecular markers may support our interpretation. We were not able to conduct fine-mapping because we encountered difficulties with sequence specificity due to partial sequence duplications of this X-chromosomal region on the Y-chromosome. 

Large deletions have also been reported earlier to be associated not only with choroideremia but also with cleft lip and palate as well as mental retardation and deafness. ⁵⁷ While three of five syndromic deletions showed only partial overlap with deletions of our patients, two of the five (patient NP and XL62) covered the entire region deleted in both families reported herein. Of note, the phenotypes displayed in our families are considerably less severe. This lack of severity may in part be explained by the distal extension of the published deletions beyond the breakpoints seen in our patients. Similarly, the deafness phenotype reported by Cremers et al. ⁵⁷ and the here reported hearing loss of low frequencies are most likely of different origin, since the previously published deletions include the POU3F4 locus for deafness. 

An alternative explanation could be breakage, repair, and rejoining of previously unrelated, nonconsecutive DNA sequences. Detailed knowledge of DNA sequences adjacent to the deletion breakpoints may shed light on this possibility. The individual genetic background may also contribute to the variable phenotypes. 

Conclusions

In this study we found an FAF pattern that is unique to CHM carriers and thus will be a powerful tool for identifying CHM carriers alongside funduscopy and to distinguish between carriers of other X-linked recessive mutations such as in retinitis pigmentosa. 

Further, we report two comparably large novel deletions in the range of minimally 6 Mbp to maximally 14 Mbp surrounding the REP1 gene, which is associated with choroideremia. To date few large deletions of similar size and localization have been characterized by severe syndromic features in addition to choroideremia. ⁵⁷ Our families are the first described as carrying large deletions yet showing rather mild clinical manifestations. 

Although our data do not narrow down the MPDMR syndrome locus, they potentially sublocalize the mild hearing defect as well as mental retardation and motor problems to the most proximal region of the locus for this complex syndrome. 

²  Contributed equally to the work and therefore should be considered equivalent authors.

 Submitted for publication March 18, 2008; revised April 23, 2008; accepted July 18, 2008.

 Disclosure: C.M. Poloschek, None; B. Kloeckener-Gruissem, None; L.L. Hansen, None; M. Bach, None; W. Berger, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Figure 1.

 

Pedigrees of family G (left) and family H (right). Filled symbols: affected status; centered dots: carriers. Generations are designated by roman numerals, and individuals by arabic numerals. The five-digit numbers below individuals represent laboratory identifiers assigned before DNA extractions.

Table 1.

 

PCR Primer Information

Locus	Forward	Reverse
CXorf43	ttgcccactactggggatta	ccagggaagtgaagctgttt
FAM121A	TGGGTGTTGGCTTGTAATGA	TCCCCCACCTAATAGCTCAA
POF1b	ctggcttcatccctgacatt	agggacctcccagatgttct
REP1 exon1	tcaaccctccaggctaaatg	ccaaagtcgtctccgttgat
REP1 exon2	caagcaaggatgggtctctt	tgggcggatatagaaatgga
REP1 exon3	acctgctaaatgcccatgtc	cgcacccgagctctatttat
REP1 exon4	ttctttggtgactctgaggtga	aaattcggaggcgttaaggt
REP1 exon5.1	tctgagtcacataagcaaaacg	agcattttcatgtgagcacttt
REP1 exon5.2	ccaatacagttcccctgtctg	TTTTCCCCTGTCACTTCAGC
REP1 exon6	atggatcaggttttgctgct	ccacggaggactggaattta
REP1 exon7	actgatggacggtgatgtga	tgggagcccttgaaatacag
REP1 exon8	tgtcctttgtgaggtctgtga	aagctcaaaaagaggccaca
REP1 exon9.1	tggctcttgcttagggacac	gcttggatgaccaggagcta
REP1 exon9.2	gattttcgggggataattgg	ttgtgtttgggatatgtgtgtg
REP1 exon10	tgtgtcagaaaacatggaattg	ggcttccctaaaaccagacc
REP1 exon11	gacttggttttgggaggtga	gctaggcaaaatggggagac
REP1 exon12	gagcatcatgtcggtgctaa	gcagcccaaatggactaaga
REP1 exon13	tgggtacttgttgggtacttcc	cccacatgtttaggcagaca
REP1 exon14	catggcttaatcggtaataggc	attcccacgatggaactcat
REP1 exon15	tgaggtactgccatccttga	AAGGAAAATCCCCTTTTGGA
DACH2	tagaggagtcagggcgagaa	ggagagccaagaaacgagtg
KLHL4	tgctccaaatctgctgaaaa	gtgcagctcaaccagacaaa
CPXCR1	gttttgtgggcattgtgatg	gacccagagcgacaactctc
PABPC5	GCTGTTTGGCCCATAGCTTA	AGACCACATAAGGCGGAATG
LOC401602	ATCTCTCTGAGCCCCTCCTC	TACAGCATTAGCCACCACCA
NAP1L3	TTTTCTGCCCATCTCTGGTC	GGAAGGCTCAGGTACCCTCT
DAIPH2	AACAACTTTGGCCATGAAGG	tgcatgccgggtttattatt

 Sequences of forward and reverse primers for PCR are given from 5′ to 3′. Capital letters represent exon sequences.

Figure 2.

 

Fundus (left two columns) and FAF (right two columns) of the patients with choroideremia. (A, B) II-1 (family G), (C–F) III-2 (family H), and (G–J) III-3 (family H). Fundi showed peripheral to midperipheral loss of choriocapillaris, normal retinal vessels, and optic nerve heads, peripapillary sclerosis (black arrows: some of the sclerosed vessels) of the choroid in II-1, and relative hyperpigmentation of the macula (∗) in III-2 and III-3. FAF was decreased (darker) in areas of chorioretinal atrophy (E, F, I, J).

Figure 3.

 

Gel electrophoresis images of PCR fragments. PCR products are shown for families G and H. DNA template source: mother (M), patient (P), no-DNA control (nt). A molecular weight standard (S) was run on each gel to estimate fragment size. All PCR fragments were in the range of 200 to 700 bp. Above each set showing the DNA source, DNA marker loci are indicated. FAM121A, NAP1L3, and PABPC5 were deleted in the patients. CXorf43, DIAPH2, and LOC401602 were present in all DNA samples tested.

Table 2.

 

List of Genetic Loci Contained within and Flanking the Deletions

Locus	Description	Family G	Family H
RPS6KA6	Ribosomal protein S6 kinase, 90kDa, polypeptide 6	Present	Present
CXorf43	Chromosome X open reading frame 43	Present	Present
FAM121A	Family with sequence similarity 121A	Deleted	Deleted
SATL1	Spermidine/spermine N1-acetyl transferase-like 1
ZNF711	Zinc finger protein 711
POF1B	Premature ovarian failure, 2B	Deleted	Deleted
CHM	Choroideremia (Rab escort protein 1)	Deleted	Deleted
DACH2	Dachshund homolog 2 (Drosophila)	Deleted	Deleted
bA345E19.2	COP9 pseudogene
KLHL4	Kelch-like 4 (Drosophila)	Deleted	Deleted
RPSAP15	Ribosomal protein SA pseudogene 15
MRPS22P1	Mitochondrial ribosomal protein S22 pseudogene 1
CAPZA1P	Capping protein (actin filament) muscle Z-line, alpha 1 pseudogene
CPXCR1	CPX chromosome region, candidate 1	Deleted	Deleted
TGIF2LX	TGFB-induced factor 2-like, X-linked
USP12P2	Ubiquitin specific peptidase 12 pseudogene 2		Deleted
PABPC5	Poly(A) binding protein, cytoplasmic 5		Deleted
LOC728150	Similar to protocadherin 11 X-linked
LOC642784	Similar to eukaryotic translation initiation factor 4A, isoform 1
PCDH11X	Protocadherin 11 X-linked
KRT1BL1	Keratin 18-like 1
LOC401602	Similar to adaptor-related protein complex 2, beta 1 subunit		Present
LOC643310	Similar to heat shock 70kD protein binding protein
NAP1L3	Nucleosome assembly protein 1-like 3	Deleted	Present
LOC643371	Similar to Tubulin, Beta family member (tbb-1)
CALM1P1	Calmodulin 1 (phosphorylase kinase, delta) pseudogene 1
LOC648927	Similar to MYST histone acetyltransferase 2
LOC643486	Similar to testis-specific bromodomain protein
RPA4	Replication protein A4, 34kDa
DIAPH2	Diaphanous homolog 2 (Drosophila)	Present	Present

 The order of the markers is arranged from proximal to distal, according to the map information from NCB map view, ver. 36.2. The Description provides more detailed information of the loci. For families G and H, the presence or absence of tested markers positioned at various intervals is given.

Figure 4.

 

The Xq21 region containing REP1. Left: the minimum (shaded bar) and maximum extent (dotted lines) of the deletions (sizes given in Mbp) in family G (Fam G) and family H (Fam H) with corresponding genetic markers next to the ideogram are shown. Right: extent and names of mapped syndromes (vertical lines).

Figure 5.

 

Fundus (left two columns) and FAF (right two columns) of the choroideremia carriers. The fundi showed mottling of the retinal pigment epithelium, discrete peripheral RPE clumping, and small areas of chorioretinal atrophy (some marked with arrows in A, B, more subtle in the other fundi). There was a normal background autofluorescence with a characteristic speckled pattern of areas with reduced and increased autofluorescence. In the youngest carrier (III-4) these changes were very subtle. (A–D) Carrier I-2 (family G); (E–H) II-5 (family H); and (I–L) III-4 (family H).

The authors thank Jaya Balakrishnan, Esther Glaus, and Philippe Reuge for preparation of the genomic DNA.