Localization of Age-Related Macular Degeneration-Associated ARMS2 in Cytosol, Not Mitochondria

Abstract

purpose. To analyze the relationship between ARMS2 and HTRA1 in the association with age-related macular degeneration (AMD) in an independent case–control dataset and to investigate the subcellular localization of the ARMS2 protein in an in vitro system.

methods. Two SNPs in ARMS2 and HTRA1 were genotyped in 685 cases and 269 controls by a genotyping assay. Allelic association was tested by a χ² test. A likelihood ratio test (LRT) of full versus reduced models was used to analyze the interaction between ARMS2 and smoking and HTRA1 and smoking, after adjustment for CFH and age. Immunofluorescence and immunoblot were applied to localize ARMS2 in retinal epithelial ARPE-19 cells and COS7 cell transfected by ARMS2 constructs.

results. Both significantly associated SNP rs10490924 and rs11200638 (P < 0.0001) are in strong linkage disequilibrium (LD; D′ = 0.97, r ² = 0.93) that generates virtually identical association test and odds ratios. In separate logistic regression models, the interaction effect for both smoking with ARMS2 and with HTRA1 was not statistically significant. Immunofluorescence and immunoblot show that both endogenous and exogenous ARMS2 are mainly distributed in the cytosol, not the mitochondria. Compared with the wild-type, ARMS2 A69S is more likely to be associated with the cytoskeleton in COS7 cells.

conclusions. The significant associations in ARMS2 and HTRA1 are with polymorphisms in strong LD that confer virtually identical risks, preventing differentiation at the statistical level. ARMS2 was mainly distributed in the cytosol, not in the mitochondrial outer membrane as previously reported, suggesting that ARMS2 may not confer risk to AMD through the mitochondrial pathway.

Age-related macular degeneration (AMD; Online Mendelian Inheritance in Man [OMIM] 603075; http://www.ncbi.nlm.nih.gov/Omim/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) affects the central part of the human retina and causes a progressive degeneration in detailed central vision. Currently, AMD is the leading cause of visual impairment and blindness in developed countries. Epidemiologically, AMD is a common complex disorder. Present studies suggest that both environmental and genetic factors contribute to AMD. ^{1 2} Of the many postulated environmental factors, cigarette smoking has the strongest influence on risk for AMD. ^{2 3} Genetically, among a list of proposed chromosomal regions, the loci at 1q32 and 10q26 have been repeatedly and consistently linked to the disease in multiple studies. ^{4 5 6 7 8} Subsequently, the Y402H variant in the CFH (complement factor H, OMIM 134370) gene, located on 1q32, was discovered as the first major AMD susceptibility allele. ^{9 10 11 12 13 14}  

In contrast, it has been difficult to identify with certainty the susceptibility variation(s) responsible for linkage and association to the locus on chromosome 10, region q26. There are three genes located in this region, PLEKHA1 (pleckstrin homology domain containing, family A, member 1, OMIM 607772), ARMS2 (age-related macular degeneration susceptibility 2, OMIM 611313), and HTRA1 (HtrA serine peptidase 1, OMIM 602194). Each of these three genes, especially the latter two, has been suggested to be the susceptibility gene. ^{15 16 17 18} Unfortunately, the polymorphisms in ARMS2 (rs10490924; nonsynonymous A69S change) and HTRA1 (rs11200638; promoter polymorphism) associated with AMD are in such strong linkage disequilibrium (LD) that their effects are indistinguishable in statistical analyses. ^{15 16 17 18} Studies, including ours, have demonstrated a statistical interaction between smoking and 10q26 genes, especially ARMS2, in the association with AMD, suggesting ARMS2 as the most likely candidate for the second major AMD susceptibility gene. ^{6 19 20}  

Recently, Kanda et al. ²¹ reported that SNP rs10490924 (ARMS2 A69S) alone could explain the bulk of the association between the chromosomal 10q26 region and AMD. In vitro experiments showed that ARMS2 localizes to the mitochondrial outer membrane. Based on these observations, they suggested that ARMS2 is the AMD susceptibility gene and may confer risk through the mitochondrial pathway. 

To extend the findings by Kanda et al., we repeated their case–control analysis in our independent data set and attempted to replicate their in vitro findings. 

Material and Methods

Samples

The independent case–control sample set contained 685 patients with AMD and 269 unrelated control subjects, of which 456 patients and 234 control subjects had smoking data, as shown in Table 1and described in detail elsewhere. ²² All participants were non-Hispanic Caucasians. All patients and control subjects underwent an eye examination and had stereoscopic fundus photographs graded according to a modified version of the age-related eye disease study (AREDS) grading system, as described previously. ²³ Briefly, grades 1 and 2 represent control subjects. Grade 1 eyes have no evidence of drusen or small nonextensive drusen without pigmentary abnormalities, whereas grade 2 eyes may show signs of extensive small drusen, nonextensive intermediate drusen, and/or pigmentary abnormalities. Grade 3 AMD eyes have extensive intermediate drusen or large, soft drusen with or without drusenoid retinal pigment epithelial detachment. Grade 4 AMD eyes exhibit geographic atrophy, and grade 5 eyes have exudative AMD, which includes nondrusenoid retinal pigment epithelial detachment, choroidal neovascularization, and subretinal hemorrhage or disciform scarring. Individuals were classified according to status in the more severely affected eye. Approval for the study was obtained from the appropriate institutional review boards at Vanderbilt University Medical Center, Duke University Medical Center, and the University of Miami Miller School of Medicine; all study participants gave informed consent, and the research adhered to the tenets of the Declaration of Helsinki. 

DNA Extraction and SNP Genotyping

Genomic DNA was extracted from whole blood (PureGene system; Gentra Systems, Minneapolis, MN). Primers and probes were designed on computer (Primer Express 2.0 program; Applied Biosystems, Inc. [ABI], Foster City, CA). Two SNPs, including rs10490924 and rs11200638, were genotyped (Taqman Assay; ABI). The fluorescence generated during the PCR amplification was detected with a sequence detection system (the Prism 7900HT; ABI) and was analyzed with SDS software (ABI). Quality control samples were duplicated within and between plates, and we required that 95% of individuals assayed receive a genotype for SNPs to be used in further analyses. 

Statistical Analysis

We verified that all SNPs were in Hardy-Weinberg equilibrium (HWE) and examined the HWE and LD in both the overall dataset and separately in cases and controls, using Haploview software (data not shown). ²⁴ We assessed the association of each SNP with AMD using the 2 × 2 χ² test for allelic association and estimated age-adjusted odds ratios using logistic regression. We used conditional analyses to test for the effect of ARMS2 A69S in rs11200638 carriers and vice versa. The effects of ARMS2 A69S and HTRA1 rs11200638 were estimated in separate logistic regression models after adjustment for age, smoking status, and the Y402H variant in CFH, assuming an additive genetic model for each locus. Smokers (those who had smoked at least 100 cigarettes) were coded 1 and nonsmokers (those who had smoked fewer than 100 cigarettes over their lifetime) were coded 0. We tested for interactions between smoking and ARMS2 A69S or HTRA1 rs11200638 by comparing full and reduced logistic regression models with a likelihood ratio statistic (LRT, twice the difference in the deviance of the full compared with reduced logistic regression models) and determined significance by comparing the LRT with a χ² distribution with 1 degree of freedom. All case–control analyses were performed with commercial software (Intercooled Stata 9.1; StataCorp LP, College Station, TX). 

Polyclonal Antibody Generation

One polyclonal antibody was custom produced against synthetic peptides of ARMS2 by Bethyl Laboratories (Montgomery, TX). The targeted C-terminal peptide is CSPAGTQRRFQQPQHHLT (amino acids 82–98). Rabbits were immunized at multiple SC sites multiple times. Antibodies were purified by using immunoaffinity columns. Endogenous ARMS2 protein was detected by immunofluorescence in ARPE-19 cells with the primary antibody against ARMS2. 

Plasmids Constructs and Mutagenesis

ARMS2 expression constructs were made from RT-PCR and TA cloning into GFP or His-tag vectors. Human retinal RNA was reverse transcribed to cDNA. The fresh PCR products were cloned into pcDNA3.1-NT-GFP, pcDNA3.1-CT-GFP, and pcDNA3.1-His according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). The PCRs were applied by using the following three pair primers: NT-GFP-forward: ATGCTGCGCCTATACCCAGG; NT-GFP-reverse: TCACCTTGCTGCAGTGTGGATGAT; CT-GFP-forward: ATGCTGCGCCTATACCCAGG; CT-GFP-reverse: TTGCTGCAGTGTGGATGATAG; HIS-Tag-forward: ATGCTGCGCCTATACCCAGG; HIS-Tag-reverse: CCTTGCTGCAGTGTGGATGATAGAC. 

The PCR product was separated on an agarose gel and extracted, purified, and cloned with a TA cloning kit (Invitrogen). Finally, the pcDNA3.1-CT-GFP-A69S construct was generated with a site-directed mutagenesis kit (Quickchange XL; Stratagene, La Jolla, CA) by using forward mutagenic primer (5′-CACACTCCATGATCCCAGCTTCTAAAATCCACACTGAGCTCTGC-3′) and a complementary reverse mutagenic primer (5′- GCAGAGCTCAGTGTGGATTTTAGAAGCTGGGATCATGGAGTGTG-3′). All the resultant constructs were verified by sequencing. 

Cell Culture and Transfection

Human retinal epithelial ARPE-19 and Green monkey kidney epithelial COS7 cells were obtained from American Type Culture Collection. ARPE-19 cells were maintained in DMEM-F12 medium, and COS7 cells were maintained in DMEM. Both culture media contained 10% FBS. COS7 Cells were cultured in six-well plates with coverslips and transiently transfected 2 μg pcDNA3.1 ARMS2 constructs by using the appropriate amount of lipophilic transfection reagent (Lipofectamine LTX; Invitrogen) according to the manufacturer’s instructions. 

Immunofluorescence

ARPE-19 cells were cultured in six-well plates with coverslips. After seeding for 24 hours, the cells were washed by PBS twice and fixed by 4% paraformaldehyde for 15 minutes at room temperature, then incubated with 10% normal donkey serum (Jackson ImmunoResearch, West Grove, PA) in PBS. The cells were subsequently incubated for 2 hours at room temperature with the ARMS2 antibody (1:200) in PBS. After washing with PBS, the cells were then incubated with FITC-conjugated donkey anti-rabbit IgG (1:500; Jackson ImmunoResearch) for another 2 hours. ARPE-19 cells were either costained with a red mitochondrial dye and rhodamine phalloidin (mitoTracker Red and Rhodamine phalloidin; Invitrogen) or double immunostained with anti-tubulin, anti-calnexin, anti-golgin, and anti-LAMP1 antibodies, respectively. Cy3-conjugated donkey anti-mouse IgG (1:200; Jackson ImmunoResearch) was used as a second immunofluorescence. 

After transfection for 24 hours, COS7 cells were either costained with red mitochondrial dye–rhodamine phalloidin or double immunostained with the antibodies just mentioned. Double-fluorescence images were acquired with a confocal microscope (LSM510; Carl Zeiss Meditec, Dublin, CA). 

Mitochondrial Isolation and Immunoblot

Mitochondria were extracted from ARPE-19 cells with a benchtop mitochondria isolation kit (MitoProfile; Mitoscience, Eugene, OR) according to the manufacturer’s instructions. Briefly, ARPE-19 cells at 90% confluence were detached from the 100-mm dish and centrifuged at 1000g for 3 minutes. The cells were resuspended with reagent A followed by homogenization. The homogenate was centrifuged at 1000g for 10 minutes. The pellet was added to reagent B, homogenized, and spun down again. The combined supernatants were further centrifuged at 12,000g for 15 minutes. The resultant supernatant was collected as cytosol and the pellet was removed and dissolved in reagent C as mitochondria. Cytosol and mitochondrial proteins were resolved on 4% to 20% SDS-polyacrylamide gels (Bio-Rad, Hercules, CA), transferred to nitrocellulose membranes, and immunoblotted with anti-ARMS2, anti-porin, and anti-β-actin antibodies. Proteins were visualized by using chemiluminescence. 

Results

ARMS2 or HTRA1 Association with AMD

Both rs10490924 and rs11200638 were strongly associated with AMD (P < 0.0001, Table 2 ). The strong LD between these two SNPs (D′ = 0.97, r ² = 0.93) makes it impossible to determine which variant is the biologically relevant one by statistical modeling, as both variants produce nearly identical association test statistics and odds ratios (Table 2) . Using conditional analyses to evaluate models of these two SNPs, the significant association of one SNP is lost after adjustment for the effect of the other association, and vise versa (data not shown). As smoking has been shown to modify the association of 10q26 genes with AMD by our group and others, ^{6 19 20} we tested for interaction between rs10490924 and rs11200638 and smoking in separate logistic regression models, adjusting for age and CFH genotype. Not unexpectedly, due to the strong LD, LRT statistics were again similar for both SNPs (rs10490924 LRT = 2.89 and rs11200638 LRT = 2.71), but in this updated analysis with larger sample size the interaction effect with smoking was not statistically significant (rs10490924-smoking P = 0.09 and rs11200638-smoking P = 0.10). 

Localization of ARMS2

To test whether ARMS2 is imported into the mitochondria, we generated a polyclonal antibody targeting the C terminus (82–98 amino acid sequence). Immunofluorescence showed that endogenous ARMS2 is not colocalized with mitochondrial marker at all in epithelial retina ARPE-19 cells. Experiments using preimmune serum and blocking peptide confirmed the specificity of this immunostaining (Fig. 1) . By overexpressing GFP-tagged and HIS-tagged ARMS2 constructs, we further studied exogenous ARMS2 localization in COS7 cells which share most common cell biological characteristics with the COS1 cells (ATTC, Manassas, VA) used by Kanda et al. ²¹ Confocal images clearly showed no colocalization of both endogenous and exogenous ARMS with the mitochondrial marker (Fig. 2) . Immunoblot further confirmed that ARMS2 was present only in the cytosolic but not the mitochondrial cellular fraction as shown in Figure 3 . 

To confirm the subcellular targeting of ARMS2, we applied in silico analyses. Characteristic features of the mitochondrial targeting signals are several positively charged amino acid residues with a few intervening uncharged amino acids at the N terminus of mitochondrial protein precursors. ²⁶ ARMS2 lacks charged amino acids at both the N terminus (1 of the first 10-amino-acid sequence) and C terminus (2 of the last 10-amino-acid sequence). We used the program WoLF PSORT (http://wolfpsort.org/) ²⁷ to predict the signal targeting activities of the ARMS2. The analysis suggests a multisubcellular localization of ARMS2, including cytosol and nucleus, but not mitochondria (Table 3) . Another bioinformatics tool MitoProt II (http://ihg2.helmholtz-muenchen.de/ihg/mitoprot.html/ provided in the public domain by the Helmholtz Center, Munich, Germany) predicts the probability of ARMS2 for mitochondrial targeting is 0.0185, whereas the probability for the positive control mitofusin 2 is 0.7226, and the negative control EGF is 0.0063. 

To determine ARMS2 subcellular targeting, we then colabeled ARPE-19 and COS7 cells with markers of the nucleus, microtubules, actin, Golgi apparatus, endoplasmic reticulum, and lysosome. These double immunofluorescences demonstrated that most ARMS2 existed in the cytosol of the perinuclear region. Although a small portion of ARMS2 was detected in the nucleus, there was no colocalization within the cellular organelles investigated or the cell cytoskeleton system (Figs. 1 2) . And immunostaining of the transfected COS7 cells shows the specificity of ARMS2 antibody with staining largely colocalized with GFP or His-tag signals. All these results suggest that ARMS2 does not localize to the mitochondria, but is instead mainly a cytosolic protein. 

ARMS2 A69S and the Cell Skeleton

To explore the biological effects of ARMS2 A69S, we made GFP-tagged-ARMS2-A69S constructs. After transfection in COS7 cells, ARMS2 containing A69S replacement was not localized in mitochondria (Fig. 4)or any other cellular organelles (data not shown). In fact, some ARMS2 A69S seemed to be colocalized and distributed along the cytoplasmic skeleton including microtubule and actin (stained by phalloidin, Fig 4 ). The biological effect of this association between ARMS2 A69S and microtubule/actin is unclear. 

Discussion

Linkage of AMD to chromosome 10, region q26, has been confirmed in multiple studies. ^{4 5 6 7 8} Each of three genes, PLEKHA1, HTRA1, and ARMS2 in this region has been suggested as a susceptibility gene for AMD by several association analyses. Of note, two independent studies identified SNP rs11200638, located at a proposed promoter region for HTRA1, as the most likely AMD susceptibility variant. In these studies, the risk allele of rs11200638 was correlated with higher HRTA1 expression levels in peripheral lymphocytes. ^{17 18} Contrary to these findings, Kanda et al. ²¹ found that rs11200638 had no significant impact on HTRA1 promoter activity in cell lines and retinal tissues. After evaluating 45 tag SNPs spanning PLEKHA1, ARMS2 and HTRA1 gene in 466 cases and 280 controls, they reported that rs10490924 could explain the bulk of the association between the 10q26 region and AMD, whereas rs11200638 could not. They concluded that it is ARMS2, not HTRA1, is the most likely susceptibility gene for AMD. 

From our independent case–control dataset, both rs10490924 and rs11200638 are strongly associated with AMD, while also being in strong LD. We cannot confirm that rs10490924 alone is directly responsible for the association between the 10q26 region and AMD in our statistical analyses. The contribution of these two SNPs in the association with AMD is statistically indistinguishable. We also tried to determine the susceptibility gene from their interaction with environmental risk factors. In our previous study, smoking has been shown to modify the association of the ARMS2 gene with AMD, whereas SNP rs11200638 of HTRA1 was not included in that dataset. ¹⁹ In this updated analysis with larger sample size, the interaction effect with smoking was not statistically significant for both SNPs. We believe that the available statistical methods cannot separate the role of ARMS2 or HTRA1 in AMD as indicated in a previous study. ²¹ Future biological function studies on ARMS2 and HTRA1 may provide more evidence to determine their status in AMD. 

The concept of ARMS2 localizing at mitochondria, as reported by Kanda et al. ²¹ is very attractive for this degenerative disease. However, in our study, immunofluorescence and immunoblot analysis showed that that endogenous ARMS2 was not localized in the mitochondria of retinal epithelial ARPE-19 cells. Furthermore, exogenous ARMS2 was not localized in the mitochondria of COS7, after the cells were transfected with N-terminal or C-terminal GFP-tagged or C-terminal-HIS-tagged ARMS2 constructs. In our experimental system, most of ARMS2 was clearly localized in the cytosol, and a small portion in the nucleus. No mitochondrial ARMS2 was detected. The colocalization image of ARMS2 with a mitochondrial marker in the human retina reported by Fritsche et al. ²⁸ is not convincing, because of the low resolution and low magnification. In our experimental system, we are unable to replicate the mitochondrial targeting of ARMS2 in COS cells and retina epithelium as reported before. ^{21 28} The reason for this conflict probably lies in the difference between the ARMS2 fragmental peptides used in antibody preparation. However, the largely colocalized fluorescence of GFP/His-tag with our ARMS2 antibody staining further confirmed the specificity and consistency of endogenous and exogenous ARMS2 cytosolic localization in COS7 and ARPE-19 cells. 

Furthermore, in silico analyses showed very low probability of ARMS2 importing to mitochondria. Of interest, compared to wild-type, ARMS2 A69S is more likely colocalized with cellular skeleton including microtubule and actin, suggesting that the replacement of alanine by serine may induce a gain of function that causes interaction with the cytoskeleton. The biological meaning of the ARMS2 A69S association with microtubule/actin awaits further study. 

Polymorphisms in ARMS2 and HTRA1 are strongly associated with AMD, whereas the strong LD in the genomic region prevents determining which gene really drives the association at the statistical level. We cannot confirm that ARMS2 localizes at the mitochondrial outer membrane, as previously reported. We suggest that ARMS2 may not act through the mitochondrial pathway to confer risk of AMD—if ARMS2 is the true AMD gene in the 10q26 region. 

 Supported by National Institutes of Health Grant EY12118 (MAP-V, JLH).

 Submitted for publication December 1, 2008; revised January 23, 2009; accepted May 6, 2009.

 Disclosure: G. Wang, None; K.L. Spencer, None; B.L. Court, None; L.M. Olson, None; W.K. Scott, None; J.L. Haines, None; M.A. Pericak-Vance, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Demographic, Clinical, and Genetic Characteristics of Study Population

Variable	Cases	Controls
Number	456	234
Age at Examination, y (mean ± SD)	75.9 ± 7.5	66.4 ± 8.1
Race, % Caucasian	100	100
Sex, % female	61.8	54.7
Smoking, % ever yes	60.7	49.1
rs1061170, Y402H freq risk allele C, %	58.6	42.1

 The total independent case–control sample set contained 685 AMD cases and 269 unrelated controls, of which 456 cases and 234 controls have smoking data.

Table 2.

 

Association of ARMS2 rs10490924 and HTRA1 rs11200638 with AMD

SNP	Case MAF	Control MAF	χ2	P	Age-Adjusted Odds Ratio	95% Confidence Interval
rs10490924	41.7	26.2	24.9	<0.0001	2.09	1.63	2.67
rs11200638	41.4	25.8	24.8	<0.0001	2.07	1.62	2.65

 MAF, minor allele frequency.

Figure 1.

 

Immunostaining of ARMS2 in ARPE-19 cells. ARMS2 was not localized within the mitochondria. Furthermore, ARMS2 was not colocalized with the markers for other subcellular organelles and the cytoskeleton. These include the Golgi apparatus (anti-golgin), endoplasmic reticulum (anti-calnexin), lysosome (anti-LAMP1), microtubule (anti-γ-tubulin), F-actin (phalloidin), and nucleus (DAPI). Most ARMS2 was mainly localized in the perinuclear region, and no specific organelle was found to host ARMS2. Preimmune serum and blocking peptide attenuating the anti-ARMS2 antibody showed negative staining.

Figure 2.

 

Exogenous ARMS2 was not found in any specific organelles. COS7 cells were transfected with N- or C-terminal GFP tagged, His-tagged ARMS2 constructs and GFP control construct. GFP- and His-ARMS2 were mainly localized in the perinuclear region, whereas the GFP control was distributed uniformly within the cells. Co-immunostaining with markers of different cellular organelles showed that no specific organelle hosts ARMS2. In immunostaining analysis, the ARMS2 antibody largely colocalized with GFP or His-tag staining.

Figure 3.

 

ARPE-19 cells were homogenized and mitochondria were separated from the cytosolic fraction by centrifugation. The ARMS2 antibody was probed against ARPE-19 cell lysate on a Western blot and showed a band of the expected size only in the cytosol, not in the mitochondrial fraction. The blot was reprobed with porin, which constitutes a mitochondrial membrane protein, and β-actin.

Table 3.

 

Prediction of Distribution of ARMS2 into Subcellular Organelles

Subcellular Organelles	% of ARMS2 Distribution
		Complete Protein Sequence Used for Prediction	N-terminal 45-Amino-Acid Sequence Used for Prediction
Cytosol	37	23
Nucleus	54	31
Cytosol-nucleus	34	10
Secretory vesicles	0	7
Mitochondria	0	0

Figure 4.

 

ARMS2 A69S colocalized with microtubule (anti-tubulin) and actin (stained by phalloidin), but it did not colocalize with the mitochondria.

The authors thank all the patients, their families, and the control subjects who participated in the study. A subset of the participants was ascertained while Margaret A. Pericak-Vance was a faculty member at Duke University.