A Novel Specific Application of Pyruvate Protects the Mouse Retina against White Light Damage: Differential Stabilization of HIF-1α and HIF-2α

Abstract

Purpose.: To mimic hypoxia preconditioning by a novel specific pyruvate treatment and to study its retinal protection against white light damage.

Methods.: Six-to-eight-week-old BALB/c mice were exposed to strong white light calculated to produce photoreceptor degeneration. Some were given injections of pyruvate in a preordained protocol because evidence exists that proves pyruvate can affect the concentration of hypoxia inducible factor (HIF). Western blotting and real-time PCR were used to determine the concentration of proteins and mRNAs in retinas. Morphology was analyzed with toluidine blue staining and was plotted using a spidergraph. A free nucleosome cell death assay was used to examine apoptosis. Retina explant cultures were used to investigate the background mechanism.

Results.: Pyruvate administration stabilized hypoxia inducible factor (HIF)-1α but not HIF-2α. Expression of the downstream genes hemoxygenase-1 and erythropoietin mirrored the changes of the two HIFs, respectively. Importantly, pyruvate given not only before but also after exposure to light protected photoreceptors against apoptosis. In the retinal explant system, addition or depletion of pyruvate caused only changes of HIF-1α and prolyl hydroxylase (PHD)-2, while HIF-2α and PHD1 were not affected. However, under hypoxic conditions, HIF-2α was stabilized by pyruvate but not HIF-1α.

Conclusions.: Pyruvate evoked a hypoxia-like response under normoxic conditions and was retina-protective against strong white light. This response included stabilization of HIF-1α but not HIF-2α. This differential stabilization might be related to the distinct preference of their degrading enzyme of PHD2 and PHD1 in response to pyruvate treatment.

Exposure to strong artificial light sources can trigger photoreceptor apoptosis, a form of cell death found in various retinal dystrophies. ^1,2 Hypoxic preconditioning has been reported to inhibit apoptotic cell death in various tissues including the retina. ³ Hypoxia inducible factors (HIFs) have been found in many tissues. As the name implies, their concentration is regulated by ambient oxygen tension. HIFs consist of heterodimers in which the alpha subunits are regulated by oxygen levels. Three isoforms have been found: HIF-1α, -2α, and -3α. It is becoming clear that these isoforms bear distinct tissue specificities that determine the specific tissue response in different hypoxic circumstances. ⁴ HIF transcription factors regulate their target genes in a cooperative and nonredundant way. Erythropoietin, one of the best studied HIF target genes, is mainly regulated by HIF-2α, ⁵ whereas the expression of hemoxygenase-1 is mainly controlled by HIF-1α. Both genes are relevant for tissue hypoxic protection. Erythropoietin not only stimulates proliferation and differentiation of erythroid progenitor cells but also protects neuronal cells against apoptotic cell death. Hemoxygenase-1 is an enzyme producing substances involved in antioxidative mechanisms. ⁶ Under normoxia, the HIF-α subunits are rapidly degraded by the ubiquitin-proteosomal pathway. ⁷ Prolyl residues of the HIF-α proteins are hydroxylated by a group of HIF prolyl hydroxylases (PHDs). ⁸ Hydroxylated HIF-α proteins are recognized by an enzyme complex that includes von Hippel Lindau protein and an E3 ubiquitin ligase. ^9,10 Ubiquitination then directs HIF-a to rapid proteosomal degradation. Since efficient function of PHDs requires not only 2-oxoglutarate and iron but also oxygen as a cosubstrate, hypoxia results in the stabilization of HIF-α proteins and furthers their nuclear translocation. The heterodimer with the beta subunits triggers the transcription of the genes that are involved in the response to hypoxia. ¹¹ Previously, three PHDs have been identified. ⁸ These HIF-regulating enzymes target two critical prolyl residues residing within the N-terminal oxygen-dependent degradation domain (NODD) and the C-terminal oxygen-dependent degradation domain (CODD) of HIF-1α and HIF-2α. ¹²  

Pyruvate is a metabolic intermediate in the glycolysis pathway. In mitochondria of aerobic organisms, pyruvate is bound to coenzyme A and oxidized to CO₂. When oxygen is not present in sufficient quantities, pyruvate is metabolized to lactate. ¹³ Therefore, pyruvate lies at the fork between the hypoxia and normoxia pathways. In comparison, other hypoxia- related intermediates such as lactate do not possess this kind of property: Lactate lies at the end of anoxic metabolic pathway and, unlike pyruvate, does not bind to PHDs. ¹⁴ The explanation above demonstrates why we have developed a method of mimicking hypoxia by using an oversupply of pyruvate in experimental situations. The rationale was to differentially stabilize HIF-1α and HIF-2α and thus exploit the distinct enzyme preference of PHD isoforms on HIFs in the retina. 

Materials and Methods

Mice

Five- to eight-week-old BALB/c mice, 18 to 22 g, were provided by the Animal Breeding Center of the Chinese Academy of Medical Sciences. The animals were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. All animals were maintained in a 12-hour alternating light-dark cycle. At least four animals were randomly distributed to each treatment group in the study. Equal numbers of both sexes were used for each experiment. 

Pyruvate Treatment

Freshly prepared sodium pyruvate solution in saline (Sigma-Aldrich Co., Beijing, China) was injected three times in total with a 2-hour interinjection interval (injections at 0, 2, and 4 hours). The dosage was set at 2, 2, and 4 g/kg for the three injections, respectively. The first and last injections were given intraperitoneally (0.2 mL) whereas the second injection was placed subcutaneously (0.2 mL). Negative controls were sham-injected with physiological saline solution. Retinas of mouse pups (postnatal day 1) were chosen as positive controls for examination of HIF-1α level. ³  

Light Damage

For preconditioning, 2 hours after the last pyruvate injection, mice were exposed to 5800 lux of white fluorescent light at the same time for 2 hours. Light exposure was performed in a box with reflecting surfaces, equipped with two fluorescent tubes (cool white, 40 W). During exposure, the mice had free access to food and water. Mice for the quantitative studies (cell death detection, PCR, and Western blotting) were allowed to recover in darkness for 24 hours before being euthanatized; other mice were kept for another 4 days for retinal morphology analysis. For postconditioning, the first pyruvate injection was started directly after the light exposure with the same regime and dosage as the preconditioning. 

Histology and Morphometry

Whole eyeballs were enucleated and fixed in 2.5% glutaraldehyde. The ora serrata was marked with electronic tweezers at 12 o'clock position for orientation. The eye was then bisected from the superior to inferior region through the optic disc. One half was embedded in Epon 812 for semi-thin section preparation (0.5 μm); the other half was embedded for conventional paraffin section (5 μm). All sections were counterstained with 0.1% toluidine blue. Paraffin sections were used to measure the thickness of the outer nuclear layer. This was accomplished with a microscope (Nikon, Yokohama, Japan) in conjunction with image-analysis software (Eclipse 90i/80i; Nikon). Measurements were made in 18 sites, 9 in the superior and 9 in the inferior retina, distributed as uniformly as possible. Measurements were made on four mice in each experimental group, averaged, and plotted with a spidergraph. 

Cell Death Detection

Twenty-four hours after light insult for the preconditioning, eyeballs were enucleated, and the whole retinas were isolated for estimation of apoptotic cell death. For the postconditioning, this took place 24 hours after the last pyruvate injection. When apoptosis occurs genomic DNA is cleaved, and the fragments escape into the cytoplasm. The quantity of fragmented DNA in the cytoplasm was determined by ELISA (Cell Death Detection Kit; Roche Diagnostics, Shanghai, China) in accordance with the manufacturer's recommendation. 

In Vitro Retina Culture

The enucleated eyeballs from healthy BALB/c mice were briefly dipped into 70% ethanol, washed with phosphate-buffered saline, and transferred into a Petri dish containing Dulbecco's modified Eagle's medium (DMEM; Invitrogen-Gibco, Shanghai, China) with 15% fetal bovine serum (FBS) and antibiotics (100 U/mL penicillin and 0.1 mg/mL streptomycin). A circular cut was made along the ora serrata using microscissors. The cornea, lens, and vitreous body were removed. Under the microdissection microscope, the sclera (with the retina attached) was carefully cut at 3, 6, 9, and 12 o'clock with a scalpel to flatten the tissue and incubated overnight at 37°C in a humid chamber. It was then treated with 250 uM pyruvate for 4 hours, and then the medium was changed to one containing either 1 mM pyruvate or zero pyruvate and incubated for 2 hours. The retina was then peeled off from the sclera and stored at −80°C. Hypoxic conditions were generated by gradually reducing the ratio of oxygen and nitrogen in the air mixture to 2% O₂. Retinal tissue was then maintained hypoxic for 4 hours and in those experiments in which pyruvate 1 mM was given for 2 more hours. 

Real-Time PCR

Total retinal RNA was extracted (RNeasy mini kit; Qiagen, Valencia, CA) following the manufacturer's recommendation, and contaminating genomic DNA was removed (RNase-free DNase I; Qiagen). To synthesize cDNA for PCR amplification, we reverse transcribed 1 μg of total RNA with oligo-(dT) primer and reverse transcriptase (ReverTra Ace; Toyobo Co., Osaka, Japan). Real-time PCR was performed for semiquantitative analysis according to the standard protocol (SYBR Green PCR Master Mix; Toyobo Co.). The primers used are shown in Table 1. Amplifications were normalized to β-actin as an internal control. Relative expression levels were calculated using the ΔΔC _t method. Data shown are means ± SD of three sets of amplifications done in triplicate. For the calculation of copy numbers, each amplicon was gel purified after electrophoresis. Concentrations (ng/μL) of purified fragments were determined by spectrophotometry. Copy numbers per μL were calculated using the specific molecular weight of the amplified fragment. Fragments were diluted in yRNA (20 ng/μL) to 10⁹, 10⁸, 10⁷, 10⁶, 10⁵, 10⁴, 10³, 10², and 10 copies per μL. One microliter of diluted fragments was amplified in quintuplicates using the respective amplicon specific conditions (Table 1). A standard curve was generated and used to calculate the copy numbers of the respective mRNAs in retinal tissue. 

Table 1.

 

Primer Pairs Used for Polymerase Chain Reaction

Gene	Forward Primer	Reverse Primer
Hif-1α	TCATCAGTTGCCACTTCCCCAC	CCGTCATCTGTTAGCACCATCAC
Hif-2α	GGAGCTCAAAAGGTGTCAGG	CAGGTAAGGCTCGAACGATG
Hif-3α	CTGCAAGGTCGACAACTCCT	AGCAGCGAGGGAGCTAGG
PHD1	GAACCCACATGAGGTGAAGC	AACACCTTTCTGTCCCGATG
PHD2	CATTGTTGGCAGAAGGTGTG	CAAAGGACTACAGGGTCTCCA
PHD3	TGTCTGGTACTTCGATGCTGA	GCAAGAGCAGATTCAGTTTTTCT
β-actin	CAACGGCTCCGGCATGTGC	CTCTTGCTCTGGGCCTCG

Western Blotting

Whole retinas isolated from the right eyes were sonicated in cold Tris-HCl (pH 8.0). Protein content was determined using a protein assay kit (Bio-Rad, Shanghai, China). Proteins were separated by 10% gel electrophoresis and transferred electrophoretically onto a nitrocellulose membrane (Bio-Rad). The membranes were blocked for 30 minutes with 5% nonfat dry milk powder and incubated with primary antibodies at 4°C overnight. Primary antibodies used were rabbit anti-HIF-1α (Novus Biologicals, Littleton, CA; 1:1000); rabbit anti-HIF-2α (Novus Biologicals; 1:500); rabbit anti-hemoxgenase-1 (Stressgen, Victoria, Canada) ¹⁵ ; and rabbit anti-erythropoietin (Stressgen). Protein bands were visualized by supersensitive chemiluminescence (PerkinElmer, Boston, MA). Ponceau staining was used as loading controls. 

Statistics

Unpaired, two-tailed Student's t-tests for individual comparisons between control and experimental groups were used for statistical validations. Results are shown as mean ± SD. All calculations were performed using commercial software (GraphPad Prism; GraphPad Software, La Jolla, CA). 

Results

Pyruvate Treatment Stabilized HIF-1α Protein but Not HIF-2α and Protected Photoreceptors from Strong White Light Damage

The specific pyruvate treatment highly stabilized HIF-1α but not HIF-2α in the retina. Western blotting (Fig. 1A) demonstrated that each injection of pyruvate was associated with an increase of HIF-1α protein. Two hours after the final treatment, HIF-1α protein level in the adult retina was as high as in the positive control (Figs. 1A, B). After that, HIF-1α gradually dropped back to basic level within 6 hours (not illustrated in Fig. 1). No obvious long-term toxic effects were observed with the pyruvate-treated mice (data not shown). In contrast, HIF-2α protein remained unchanged (Figs. 1A, C). The increase of HIF-1α could be due to either an increase in the lifetime of the protein or increased production. To distinguish between these two possibilities, the mRNA of HIF-1α and -2α was examined. The results showed no significant change of either HIF mRNA in response to pyruvate treatment (Figs. 4B, C). Downstream gene expression of HIF-1α and -2α was examined to check if the stabilized protein of HIFs was transcriptionally active. Hemoxygenase-1 was significantly upregulated and peaked after the third injection, which mirrored the changing pattern of HIF-1α (Figs. 2A, B). Erythropoietin that has HIF-2α as its transcriptional factor kept unchanged (Figs. 2C, D). 

Figure 1.

 

Pyruvate treatment differentially affected HIF-1α and HIF-2α protein levels. (A) Western blot analysis showing HIFs protein levels at 0 hours (first), 2 hours (second), and 4 hours (third) time points. Neonatal mouse (postnatal day 1) was used as positive control. Ctrl (–) indicates sham-treated with saline; ruled horizontal bars indicate duplicates from samples 1, 2, and 3. (B, C) Densitometric quantification of HIFs protein accumulation. n = 4 per group, *P < 0.05, **P < 0.01; means ± SD are shown.

Figure 2.

 

Response of hemoxygenase-1 and erythropoietin to pyruvate. (A, C) Western blot analysis of hemoxygenase-1 and erythropoietin at 0 hours (first), 2 hours (second), and 4 hours (third) time points. (B, D) Densitometric quantification of hemoxygenase-1 and erythropoietin protein accumulation. Ctrl (–) indicating sham-treated with saline; ruled horizontal bars indicate duplicates from samples 1, 2, and 3. n = 4 per group, *P < 0.05, **P < 0.01; means ± SD are shown.

Since hypoxic preconditioning protects the retina against white light damage, we applied the pyruvate method on the light damage animal model to examine its hypoxia-mimetic effects. Compared to unexposed mice, retinas exposed to 5800 lux of white light showed a reduced number of photoreceptor cells with an almost complete removal of the photoreceptor outer and inner segments (Fig. 3A). The inferior hemisphere was the most affected region, as also indicated by the retina spidergraph (Fig. 3B). Pyruvate pretreatment essentially protected the retinal morphology, and when applied immediately after light exposure pyruvate also preserved the retinal morphology, though the effect seemed slightly weaker than preconditioning (Fig. 3). ELISA-based determination of free nucleosomes in the whole retina also reflected the morphologic findings on apoptotic cell death (Fig. 3C). We also performed a flashlight reflection test to check the retinal function. Animals in pyruvate-treated groups responded more rapidly and strongly to the flash in the darkness than the untreated ones (data not shown). 

Figure 3.

 

Both preconditioning and postconditioning with pyruvate protected the retina against white light insult. (A) Representative images from the inferior region of the retinas 5 days after light insult. “Ctrl” shows the sham-treated and unexposed retina; “light” for sham-treated and light-exposed; “Pyr-Pre” for pyruvate preconditioned and light-exposed; “Pyr-Post” for pyruvate postconditioned after light exposure. ROS, rod outer segment; RIS, rod inner segment; ONL, outer nuclear layer. Scale bar, 30 μm. (B) Spidergraph showing the change of ONL thickness in whole retina. The inferior hemisphere was most affected by light exposure. Pyruvate treatment essentially preserved ONL thickness both with preconditioning and with postconditioning. (C) Apoptotic cell death with ELISA-based free nucleosomes measurement in the entire retina. Pyruvate treatments both significantly reduced retinal cell death. Indications are the same as in (A). “Ctrl” value is set arbitrarily to 1 on the ordinate. The differences between bars were examined by Student's t-test, and the statistical significance is indicated. *P < 0.05, **P < 0.01. NS, nonsignificant. n = 4 per group; means ± SD are shown.

The Differential Accumulation of HIF-1α and -2α with Pyruvate Treatment Was Possibly Due to the Distinct Preference of Enzyme Activity of PHD2 and PHD1 on HIFs

Copy numbers of the three HIF-α and of the three PHD mRNAs were determined by quantitative real-time PCR. In the BALB/c mouse retina, HIF-1α was expressed at the highest level, while HIF-2α was at approximately 20% and HIF-3α below 5% that of HIF-1α (Fig. 4A). Both PHD1 and PHD2 were expressed at a similar level, whereas the PHD3 mRNA level was significantly lower (Fig. 4D). We used only mRNA to represent PHD levels because PHD protein levels generally match their mRNA levels as previously reported. ¹⁶ Their abundance directly determines the action ratio because these enzymes catalyze only the forward reaction but not the reverse reaction. ¹⁷  

Figure 4.

 

In vivo mRNA levels of HIFs and PHDs with real-time PCR. (A, D) HIFs and PHDs profiling in the normal BALB/c retina. HIF-1α was the predominant HIF isoform; PHD1 and PHD2 were the predominant PHD isoforms; HIF-1α and PHD1 levels are set to “1.” (B, C, E, F) Changes of HIF-1α, HIF-2α, and PHD1, PHD2 mRNA in response to pyruvate treatment. PHD2 mRNA was significantly increased as shown in (F). HIF-1α and -2α remained unchanged (B, C). *P < 0.05, **P < 0.01. NS, nonsignificant. n = 4 per group with triplicate reactions measurement; means ± SD are shown.

To understand the interregulation between HIF and PHD isoforms, we studied their changes both in vivo and in vitro retinal explant system. In vivo, the results showed that PHD2 mRNA increased significantly by approximately threefold after pyruvate treatment, while PHD1 expression remained unchanged (Figs. 4F, E). Neither mRNA of HIF-1α and -2α was affected by pyruvate (Figs. 4B, C). Similar results were observed in the explant system. Incubation of the retinas for 4 hours in 250 μM pyruvate resulted in a moderate accumulation of HIF-1α protein (Fig. 5B, bar 1). This HIF-1α stabilization was boosted in response to the second addition of pyruvate (1 mM, 2 hours) in the medium (Fig. 5B, bar 2). PHD2 mRNA increased significantly at this step (Fig. 6B, bar 2). If at this time the pyruvate in the medium was depleted, HIF-1α level dropped back quickly to basal level (Fig. 5B, bar 3). Western blotting quantification showed that HIF-2α was not significantly affected by pyruvate treatments (Fig. 5C, bars 1, 2, 3). Similarly, PHD1 mRNA did not respond to pyruvate changes in the medium either (Fig. 6A, bars 1, 2, 3). 

Figure 5.

 

In vitro protein accumulation of HIF-1α and -2α with pyruvate treatment and hypoxia. (A) Western blotting analysis. Retina was treated with 250 uM pyruvate or 2% oxygen, then pyruvate in the medium was increased to 1 mM or depleted (–Pyr). (B, C) Densitometric quantification of Western blotting data respectively. Bars are corresponding to the lanes in (A), black bars indicating under normoxia; gray bars for hypoxia. HIF-1α continuously accumulated with increased pyruvate concentration (B, bars 1, 2) and dropped back to control level when pyruvate was depleted from the medium (B, bar 3). In comparison, HIF-2α was not responsive to any change of pyruvate (C, bars 1, 2, and 3). Both HIF-1α and -2α were highly stabilized by hypoxia (B, C, bars 4); HIF-2α but not HIF-1α increased further in response to additional pyruvate treatment under hypoxia (B, C, bars 5). n = 4 per group, *P < 0.05, **P < 0.01. NS, nonsignificant. Means ± SD are shown.

Figure 6.

 

In vitro mRNA changes of PHD1 and PHD2 in response to pyruvate and hypoxia. Bars are corresponding to those in Figure 5. Under normoxia, PHD1 mRNA was not responsive to addition or withdrawal of pyruvate in the medium (A, bars 1, 2, and 3), whereas PHD2 was raised significantly in response to the second addition of pyruvate at 4 hours (B, bar 2). Under hypoxia condition (gray bars), both PHD1 and PHD2 mRNAs were highly upregulated (A, B, bars 4). *P < 0.05, **P < 0.01, NS, nonsignificant. n = 4 per group with triplicate reactions for each measurement. Means ± SD are shown.

Retinal explants were also put into hypoxia to observe HIFs and PHDs changes. Incubation of the explants in 2% oxygen resulted in strong accumulation of both HIF-2α and -1α (Figs. 5B, C, bar 4), and both PHD1 and PHD2 mRNA were increased (Figs. 6A, B, bar 4). Interestingly, addition of pyruvate under hypoxic condition further increased HIF-2α levels but not HIF-1α (Figs. 5C, B, bar 5), which was an opposite case to the normoxic condition. 

Discussion

It has been established that there exists a negative feedback mechanism between HIFs and their degrading enzymes, PHDs. As reported, PHD2 can be induced by HIF-1α and causes degradation of HIFs. ¹⁶ This is a balancing mechanism in the body to adapt to sustained hypoxia condition. However, in terms of successfully mimicking hypoxia pre-conditioning by using, for example, chemicals targeting PHDs, this negative feedback becomes a hurdle to be overcome. Our specific pyruvate treatment was then developed for this purpose. Pyruvate, as a competitive PHD inhibitor, is supposed to possess better biomembrane permeability than other chemicals. ¹⁸ In our study the initial HIF-1α accumulation after first pyruvate injection was probably due to the inhibition of the existing PHD in naive retina (Fig. 1B, first). As expected, HIF-1α accumulation led to PHD2 increase (in vivo, Fig. 4F; in vitro, Fig. 6B). The newly synthesized PHD-2 was inhibited by the second and third injections of pyruvate. As a result, HIF-1α was able to be continuously accumulated (Fig. 1B, second and third). Preliminary investigations revealed that if one of the injections was skipped, HIF-1α levels in the retina did not increase (data not shown). The dosage and timing of pyruvate administration were optimized and eventually become a specific injection protocol. Moreover, the real-time PCR data showed that HIFs mRNA was not affected by pyruvate, which implies that this HIF-1α accumulation was from protein stabilization, rather than transcriptionally induced by pyruvate (Figs. 4B, C). 

Since the HIF-PHD system was identified, precise understanding of PHD regulation on HIFs has become intriguing. In one study using siRNA, a significant bias was observed that one isoform PHD3 appeared to selectively regulate HIF-2α rather than other HIF isoforms. ¹⁹ Our data demonstrated a similar selectivity, that is, PHD2 apparently contributed more to the regulation of HIF-1α than HIF-2α. In the explant system, addition or withdrawal of pyruvate in the medium caused only increase or decrease of HIF-1α and PHD2 (Figs. 5B, 6B) but not HIF-2α and PHD1 (Figs. 5C, 6A). If PHD2 also preferred HIF-2α for degradation, then the HIF-2α level should have also been changed. Moreover, in physiological situation, PHD2 is reported to be the most abundant HIF prolyl-hydroxylase in various rodent tissues. ²⁰ In the retina of our BALB/c mice, however, the PHD1 level compared to in other tissues was extraordinarily high (Fig. 4D). At the same time, the level of HIF-2α was relatively low (Fig. 4A). This distinctive basal level under a physiological condition also implies a differential preference of PHD1 to HIF-2α rather than HIF-1α. A recent protein structure study showed that PHD2 appeared more effective on binding to the HIF-1 NODD protein domain for degradation, ²¹ which might explain the observed selectivity in our experiment. Interestingly, under hypoxia, addition of pyruvate in the explant system caused increase of HIF-2α but not HIF-1α (Fig. 5, bars 5), which is opposite to that of normoxia as described above. As HIF-regulating enzymes, PHD themselves are supposed to retain activity at low oxygen tension; ²² the reason for this reversion of normoxia and hypoxia might be that hypoxia caused changes in PHD protein structure, reversing the accessibility of pyruvate to the reaction center of PHD1 and PHD2. ²³ Consequently, only HIF-2α protein further accumulated under hypoxia, but not HIF-1α (Fig. 5C, bar 5). 

In our study the accumulated HIF-1α was transcriptionally active. This was evidenced by the correlative increase of HIF-1α (Figs. 1A, B) and its downstream gene hemoxygenase-1 (Figs. 2A, B). The expression of the downstream genes was supposed to give protection to the retina against white light damage (Fig. 3). Importantly, with not only preconditioning but also postconditioning, pyruvate was protective to the retina (Fig. 3C, bar 3). We also investigated the effect of another metabolic intermediate, lactate, using similar methodology and dosage as pyruvate. Lactate had no obvious effect on HIFs, indicating that the effect of pyruvate on HIF-1α accumulation was not likely a systemic effect (osmotic or metabolic) due to the relatively large amounts of injected material (data not shown). Remarkably as a hypoxia responsive gene, erythropoietin was not upregulated along with HIF-1α (Figs. 2C, D). A recent gene study in liver revealed the preferential binding of HIF-2α to the DNA of erythropoietin, instead of HIF-1α as previously believed. ²⁴ In line with this report, through the differential stabilization of HIF-1α and -2α with pyruvate, our data also demonstrated that erythropoietin was probably not regulated by HIF-1α. In summary, this study provides evidence that by specific administration of pyruvate, HIFs can be stabilized in the retina. This method protects the retina against strong white light damage not only with preconditioning but also with postconditioning. Further studies to explore other chemicals with similar hypoxia-mimetic effect to pyruvate and in other tissues seem warranted. 

Footnotes

 Supported by the Research Fund for the Doctoral Program of Higher Education of China (No. 200801590016).

Footnotes

 Disclosure: H. Ren, None; N.-Y. Liu, None; X.-F. Song, None; Y.-S. Ma, None; X.-Y. Zhai, None

The authors thank Dong-Juan Liu for excellent technical assistance with sectioning, Bin Ning with animal experiments, and Christian Grimm for critical reading of the article.