September 2011
Volume 52, Issue 10
Free
Retinal Cell Biology  |   September 2011
The TAg-RB Murine Retinoblastoma Cell of Origin Has Immunohistochemical Features of Differentiated Müller Glia with Progenitor Properties
Author Affiliations & Notes
  • Sanja Pajovic
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
  • Timothy W. Corson
    Eugene and Marilyn Glick Eye Institute, Department of Ophthalmology, and
    Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana;
  • Clarellen Spencer
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
  • Helen Dimaras
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
    Departments of Molecular and Medical Genetics and
    the Vision Science Research Program, Toronto Western Research Institute, Toronto, Ontario, Canada.
  • Marija Orlic-Milacic
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
    Departments of Molecular and Medical Genetics and
    the Vision Science Research Program, Toronto Western Research Institute, Toronto, Ontario, Canada.
  • Mellone N. Marchong
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
    Medical Biophysics, University of Toronto, Toronto, Ontario, Canada; and
    the Vision Science Research Program, Toronto Western Research Institute, Toronto, Ontario, Canada.
  • Kwong-Him To
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
    Departments of Molecular and Medical Genetics and
    the Vision Science Research Program, Toronto Western Research Institute, Toronto, Ontario, Canada.
  • Brigitte Thériault
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
  • Mark Auspitz
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
  • Brenda L. Gallie
    From the Division of Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario, Canada;
    Departments of Molecular and Medical Genetics and
    Medical Biophysics, University of Toronto, Toronto, Ontario, Canada; and
    the Vision Science Research Program, Toronto Western Research Institute, Toronto, Ontario, Canada.
  • Corresponding author: Brenda L. Gallie, Ontario Cancer Institute/Princess Margaret Hospital, Division of Applied Molecular Oncology, 610 University Avenue, Toronto, ON, Canada M5G 2M9; gallie@attglobal.net
  • Footnotes
    2  These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.
  • Footnotes
    7  Present affiliation: Department of Ophthalmology and Visual Sciences, University of Toronto, Toronto, Ontario; and Division of Hematology/Oncology, Hospital for Sick Children, Toronto, Ontario.
Investigative Ophthalmology & Visual Science September 2011, Vol.52, 7618-7624. doi:10.1167/iovs.11-7989
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Sanja Pajovic, Timothy W. Corson, Clarellen Spencer, Helen Dimaras, Marija Orlic-Milacic, Mellone N. Marchong, Kwong-Him To, Brigitte Thériault, Mark Auspitz, Brenda L. Gallie; The TAg-RB Murine Retinoblastoma Cell of Origin Has Immunohistochemical Features of Differentiated Müller Glia with Progenitor Properties. Invest. Ophthalmol. Vis. Sci. 2011;52(10):7618-7624. doi: 10.1167/iovs.11-7989.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Human retinoblastoma arises from an undefined developing retinal cell after inactivation of RB1. This is emulated in a murine retinoblastoma model by inactivation of pRB by retinal-specific expression of simian virus 40 large T-antigen (TAg-RB). Some mutational events after RB1 loss in humans are recapitulated at the expression level in TAg-RB, supporting preclinical evidence that this model is useful for comparative studies between mouse and human. Here, the characteristics of the TAg-RB cell of origin are defined.

Methods.: TAg-RB mice were killed at ages from embryonic day (E)18 to postnatal day (P)35. Tumors were analyzed by immunostaining, DNA copy number PCR, or real-time quantitative RT-PCR for TAg protein, retinal cell type markers, and retinoblastoma-relevant genes.

Results.: TAg expression began at P8 in a row of inner nuclear layer cells that increased in number through P21 to P28, when clusters reminiscent of small tumors emerged from cells that escaped a wave of apoptosis. Early TAg-expressing cells coexpressed the developmental marker Chx10 and glial markers CRALBP, clusterin, and carbonic anhydrase II (Car2), but not TuJ1, an early neuronal marker. Emerging tumors retained expression of only Chx10 and carbonic anhydrase II. As with human retinoblastoma, TAg-RB tumors showed decreased Cdh11 DNA copy number and gain of Kif14 and Mycn. It was confirmed that TAg-RB tumors lose expression of tumor suppressor cadherin-11 and overexpress oncogenes Kif14, Dek, and E2f3.

Conclusions.: TAg-RB tumors displayed molecular similarity to human retinoblastoma and origin in a cell with features of differentiated Müller glia with progenitor properties.

The pediatric intraocular tumor retinoblastoma is initiated by loss of the prototypic tumor suppressor RB1, which encodes the cell cycle regulator pRB. 1 However, the specific cell type(s) in the developing human retina dependent on pRB to suppress tumor development remains unknown. The properties of this extremely cancer-susceptible cell are important to understand not only for retinoblastoma but also cancer initiation in general. 
Knowledge of the molecular mechanisms responsible for progression of retinoblastoma after RB1 loss has come from retinoblastoma mouse models. Complete knockout of Rb1 in mice is embryonically lethal. 2 5 Conditional inactivation of Rb1 and inactivation of additional pRB family members (p107 or p130) are necessary for retinoblastoma development in mice. 6 8 Several murine retinoblastoma models use early retinal gene promoters that direct conditional Rb1 inactivation in a subset of retinal cells, combined with constitutional inactivation of p107 or p130. Such approaches have created retinoblastoma models with tumors displaying amacrine and glial cell characteristics. 7 9 In each of these models, the specific cell populations affected by Rb1 loss varies and many more cells are rendered Rb1 −/− than in human disease, where the loss of both RB1 alleles is a stochastic event in presumably relatively few developing retinal cells. 
The simian virus 40 large T antigen (TAg) provides a biochemical means of functionally knocking out pRB family members, along with p53 and other protein targets, and has been used in various mouse tumor models. 10 One planned mouse pituitary tumor model was designed to express TAg under the control of the β-luteinizing hormone promoter, but instead developed completely penetrant, heritable retinoblastoma (TAg-RB). Like human retinoblastoma, TAg-RB tumors contain Homer-Wright rosettes and are the only murine retinoblastoma tumors reported to also show Flexner-Wintersteiner rosettes. 11 The presence of both types of rosette is a hallmark of human retinoblastoma. 12 Because of its high penetrance and histologic 11,13 and molecular similarity 14 17 to human retinoblastoma, this model has been frequently used by several groups to test retinoblastoma chemotherapies. In fact, approximately 20 studies using this mouse have been published in the past five years alone, spanning drug testing, 18 27 imaging, 28 30 and basic tumor biology. 14,16,31 34 However, the origin of TAg-RB tumors has not been characterized beyond the discovery that they arise within the inner nuclear layer (INL) of the retina. 11 Less than 1% of TAg-RB tumor cells display markers of stem cells or progenitors, such as ALDH1, SCA-1 and p63. 35  
Here, we have used TAg protein expression in the retina to track tumor development from the earliest stages. We show that the cell of origin belongs to a subpopulation of progenitor-like Müller glia that undergoes transformation upon the expression of TAg. 
Methods
Mice
Wild type and TAg-RB mice 11 (a gift from the laboratory of Joan O'Brien) were maintained on a pure C57/B6 background and studied using protocols approved by the Animal Care Committee of the Ontario Cancer Institute, in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Timed pregnancies were determined by vaginal plug observation, with midday of plug observation counted as embryonic day (E)0.5. 
Bromodeoxyuridine Incorporation Assay
Animals were injected (1 mL reagent per 100 g body weight) with bromodeoxyuridine (BrdU) reagent (Zymed, San Francisco, CA) and killed after 2 hours. 
Immunohistochemistry (IHC)
Formalin-fixed, paraffin-embedded (FFPE) sections (5 μm) of whole embryos, neonates, or adult TAg-RB eyes were studied. For antigen retrieval, sections were treated with 0.1% trypsin for 30 minutes or heated in PBS citrate for 5 minutes in a pressure cooker, followed by 30 minutes in blocking solution (DAKO, Glostrup, Denmark), overnight incubation with primary antibody (Table 1) and 1-hour incubation with biotin-labeled secondary antibody (1:200, Vector Labs, Burlington, ON, Canada). Immunoreactivity was detected using a substrate kit (ImmunoPure Fab Preparation kit; Pierce, Rockford, IL) and/or fluorescent detection with streptavidin linked to Alexa 488 or Alexa 594. Staining was observed with a microscope (DMLB; Leica, Concord, ON, Canada) and images recorded using a high-resolution camera (CoolSNAP; Photometrics, Tucson, AZ). For double-label experiments, images were superimposed using image-manipulation software (Photoshop; Adobe, San Jose, CA). 
Table 1.
 
Antibodies Used for Immunohistochemistry
Table 1.
 
Antibodies Used for Immunohistochemistry
Antibody Marker for Source Dilution
SV40 TAg TAg-RB Santa Cruz, Santa Cruz, CA 1:200
Activated Caspase 3 Apoptosis R&D Systems, Minneapolis, MN 1:50
BrdU Proliferation BD Biosciences, Mississauga, ON, Canada 1:500
TuJ1 Early neurons Stemcell Technologies, Vancouver, BC, Canada 1:50
Ki-67 Proliferation Lab Vision, Fremont, CA 1:200
HPC-1 Amacrine cells Sigma, Oakville, ON, Canada 1:100
NEFM Horizontal cells Sigma 1:40
Chx10 Progenitors/Müller subpopulation Bremner laboratory 9 1:2000
CRALBP Müller glia Saari laboratory 9 1:1000
PKC Bipolar cells BD Biosciences 1:50
Gln synthetase Mature Müller glia Santa Cruz 1:200
Car2 Mature Müller glia Novus, Oakville, ON, Canada 1:50
Clusterin Mature Müller glia Santa Cruz 1:100
p75NTR Lost in retinoblastoma Chemicon, Temecula, CA 1:200
DEK Gained in retinoblastoma BD Biosciences 1:200
RNA Analysis
Total RNA was isolated from wild type C57/B6 mouse retinas and TAg-RB tumors using reagent (TRIzol; Invitrogen, Burlington, ON, Canada), and first-strand synthesis performed with reverse transcriptase (SuperScript II; Invitrogen) according to manufacturer's protocols. Sequence detection (TaqMan qRT-PCR) was performed using gene expression assays for Kif14 (Mm01291391_ml), Hprt (Mm00446968_ml) and reference Tbp (Mm00446973_ml). All reactions were performed in triplicate (TaqMan Master Mix in a 12.5 μL volume in a 384-well plate in an SDS 7900H; Applied Biosystems, Foster City, CA). Raw PCR cycle number required to reach a fluorescence threshold (C t), ΔC t, and ΔΔC t were calculated using commercial software (SDS 2.0; Applied Biosystems). 
DNA Analysis
Genomic DNA was isolated from 30 TAg-RB tumors and mouse liver (normal control) using a proteinase K and phenol-chloroform extraction method. Semi-quantitative PCR was performed using 50 ng of DNA and polymerase (KOD DNA polymerase; Novagen, San Diego, CA). Reactions were performed for 28 cycles using two primer pairs for each gene: Tbp 5′ (forward: gccttacggcacaggactta; reverse: tgtgtgggttgctgagatgt), Tbp 3′ (forward: ccccacaactcttccattct; reverse: tggtgtggcaggagtgatag), Cdh11 5′ (forward: acattcatgccaccaagaca; reverse: caggcacattggcatgatag), Cdh11 3′ (forward: ctgaagccttcgacatagcc; reverse: tcgtccacatccacactgtt), Dek 5′ (forward: ccctcatccgagaaggaac; reverse: ttttcttcctcctcgtcctct), Dek 3′ (forward: agtctgaatctgaagacagtt; reverse: ctctttgcaaatctgcttcat), E2f3 5′ (forward: ggcacgtacatccagatcct; reverse: gactctgctggagggtcctt), E2f3 3′ (forward: agggcccattgaggtttact; reverse: gaagtgggcttgggatatt), Kif14 5′ (forward: ctgaccgagagcaagtctga, reverse: atgccttggtgtccatctgt), Kif14 3′ (forward: ggatgctgttcggatatttca; reverse: tgggtactggagactttgctg), Mycn 5′ (forward: cctcactcctaatccggtca; reverse: gtggccgtgctgtagttttt), Mycn 3′ (forward: gttccagcaaaagcgaagag, reverse: gccttctcgttcttcaccag). PCR products were visualized on agarose gels and band intensity was analyzed using ImageJ software (developed by Wayne Rasband, National Institutes of Health, Bethesda, MD; available at http://rsbweb.nih.gov/ij/). Mean values for the two primer pairs per gene were compared with liver (two-copy control) to calculate gain or loss. 
Results
TAg Expression Begins at P8 in the Inner Nuclear Layer of TAg-RB Retina
We followed the expression pattern of TAg protein in the developing retina of TAg-RB mice by immunohistochemistry (Fig. 1A). TAg expression was first observed in the nuclei of sparse cells within the INL at P8. At P12, an increased number of TAg-positive cells formed a single row of cells in the center of the INL. At P21, TAg-positive cells occupied much of the INL, after which numbers of single cells declined and clusters of TAg-positive cells were observed at P28. At P35, multiple large tumor foci were observed. The reduction in TAg-expressing cells from P21 to P28 prompted us to examine whether this decline was due to cell death rather than loss of TAg expression. We double-stained P21 TAg-RB retina for the presence of activated caspase-3 and TAg (Fig. 1B). The majority of TAg-positive cells expressed activated caspase-3 at P21, suggestive of widespread apoptosis. 
Figure 1.
 
Distinct pattern of TAg expression in the TAg-RB developing retina. (A) Immunohistochemical analysis shows expression of TAg (red) in developing retina from postnatal day (P)5 to P35. Expression of TAg started in single cells at P8, localized to the inner nuclear layer (original magnification, ×400). (B) Expression of activated caspase 3 (green) and TAg (red) at P21, low (×200) (left) and high (×400) (right) magnification. The majority of cells expressed both proteins; rare cells expressed TAg only (arrow).
Figure 1.
 
Distinct pattern of TAg expression in the TAg-RB developing retina. (A) Immunohistochemical analysis shows expression of TAg (red) in developing retina from postnatal day (P)5 to P35. Expression of TAg started in single cells at P8, localized to the inner nuclear layer (original magnification, ×400). (B) Expression of activated caspase 3 (green) and TAg (red) at P21, low (×200) (left) and high (×400) (right) magnification. The majority of cells expressed both proteins; rare cells expressed TAg only (arrow).
TAg-RB Cells Express Proliferation Markers
Retinal cells from P8 and P9 wild type mice were rarely positive for proliferation markers Ki-67 (stains cells in G1, S, G2, and M phases) or incorporated BrdU (incorporated into DNA during S phase), suggesting that cells had already undergone or were in the process of undergoing terminal mitosis (data not shown). However, in the TAg-RB littermates of these animals, Ki-67 expression and BrdU incorporation were observed in a subset of TAg-positive cells (Fig. 2). At most time points, we observed similar regions of staining for BrdU and TAg, suggesting that the cells in S-phase at the time of BrdU exposure expressed TAg. Interestingly, at P9 and P12 we observed cells that were positive for Ki-67 but not for TAg expression (Fig. 2). 
Figure 2.
 
Expression of proliferation markers in the course of TAg-RB development. Adjacent retinal sections from mice injected with BrdU were immunostained for BrdU (brown), TAg (green), or Ki-67 (red). Although the majority of the cells that were proliferating (BrdU or Ki-67 positive) were TAg-positive, there were a number of cells that showed proliferation marker or TAg expression only. Original magnification, ×400.
Figure 2.
 
Expression of proliferation markers in the course of TAg-RB development. Adjacent retinal sections from mice injected with BrdU were immunostained for BrdU (brown), TAg (green), or Ki-67 (red). Although the majority of the cells that were proliferating (BrdU or Ki-67 positive) were TAg-positive, there were a number of cells that showed proliferation marker or TAg expression only. Original magnification, ×400.
TAg-Expressing Cells Are Negative for Neuronal Marker TuJ1
To determine whether TAg-expressing cells display neuronal properties, we double stained TAg-RB retinas for TAg and TuJ1, a marker of early neuronal development that is absent in differentiated glia. 36,37 TAg-expressing cells were negative for TuJ1 at both early (Fig. 3) and late (data not shown) stages of tumor development. 
Figure 3.
 
TAg expressing cells do not express neuronal marker TuJ1. There was no expression of TuJ1 (green) in TAg (red) positive cells at P9 and P12, suggesting a nonneuronal origin of these cells. Original magnification, ×1000.
Figure 3.
 
TAg expressing cells do not express neuronal marker TuJ1. There was no expression of TuJ1 (green) in TAg (red) positive cells at P9 and P12, suggesting a nonneuronal origin of these cells. Original magnification, ×1000.
TAg-Positive Cells Express Markers of Mature Müller Glia
To investigate whether TAg-positive cells represent a distinct retinal cell type, we performed double immunostaining for TAg and individual markers of the cells that compose the INL of the mature retina (Table 1). We studied both the initiating stages of tumor development (P8, P9) to assess the cell of origin before TAg transformation could potentially affect gene expression of the cell, and later stages (P12, P21, P29) during tumorigenesis. 
At P8 and P9, TAg expression overlapped with CRALBP (Müller glia), and Chx10 (bipolar cells and a subpopulation of mature Müller glia), clusterin (mature Müller glia 38 ), carbonic anhydrase II (mature Müller glia 38 ), and glutamine synthetase (mature Müller glia 38 ), but not with HPC-1 (amacrine cells), neurofilament 160 kDa (Nefm) (horizontal cells) or PKC (bipolar cells 39 ) (Figures 4, 5, and 6). The same pattern was observed in the later stages of development, except that CRALBP was absent from TAg-positive cells at P29 and TAg-RB tumors (Fig. 4), and clusterin staining in large tumors was inconclusive (data not shown). 
Figure 4.
 
Expression of TAg overlaps with expression of Müller glial markers. Expression of all major retinal cell type markers (green) and TAg (red) from P9 to P29. No overlap was found for HPC-1 (amacrine cells), or neurofilament 160 kDa (Nefm) (horizontal cells) and complete overlap at all time points was found for Chx10 (retinal progenitors and bipolar cells). Coexpression of CRALBP (Müller glia) and TAg was found only at the very early time point (P9) and by P12, the majority of TAg-positive cells did not express CRALBP. Original magnification, ×1000.
Figure 4.
 
Expression of TAg overlaps with expression of Müller glial markers. Expression of all major retinal cell type markers (green) and TAg (red) from P9 to P29. No overlap was found for HPC-1 (amacrine cells), or neurofilament 160 kDa (Nefm) (horizontal cells) and complete overlap at all time points was found for Chx10 (retinal progenitors and bipolar cells). Coexpression of CRALBP (Müller glia) and TAg was found only at the very early time point (P9) and by P12, the majority of TAg-positive cells did not express CRALBP. Original magnification, ×1000.
Figure 5.
 
Cells expressing TAg are not mature bipolar cells. Mature bipolar marker PKC (green) showed no overlap with TAg (red) expression. Original magnification, ×1000.
Figure 5.
 
Cells expressing TAg are not mature bipolar cells. Mature bipolar marker PKC (green) showed no overlap with TAg (red) expression. Original magnification, ×1000.
Figure 6.
 
Late Müller cell type markers are expressed in TAg positive cells. (A) A subset of cells expressing three markers of mature Müller cells (glutamine synthetase, carbonic anhydrase II [Car2], and clusterin) (green) expressed TAg (red) at P9. (B) Tumors in TAg retinas expressed TAg and retained the expression of Car2. Original magnification, ×1000.
Figure 6.
 
Late Müller cell type markers are expressed in TAg positive cells. (A) A subset of cells expressing three markers of mature Müller cells (glutamine synthetase, carbonic anhydrase II [Car2], and clusterin) (green) expressed TAg (red) at P9. (B) Tumors in TAg retinas expressed TAg and retained the expression of Car2. Original magnification, ×1000.
Cells positive for both TAg and Chx10 showed less intense Chx10 staining than cells that were positive for only Chx10 (Fig. 4). The double-stained population was confined to a distinct location within the INL, different from the more intensely stained Chx10 population at the external edge of the INL where bipolar cells are normally found. At P9 and P12 the TAg positive cells were negative for PKC, a marker of mature bipolar cells (Fig. 5). 
TAg-RB Tumors Express Retinoblastoma-Associated Tumor Suppressor Genes during Initiation, and Overexpress Oncogenes during Progression of Tumorigenesis
We have identified a number of genes involved in the progression of human retinoblastoma after loss of RB1. 14 16,40,41 We evaluated their role in the TAg-RB model by measuring gene copy number for Cdh11, Mycn, Kif14, E2f3, and Dek in TAg-RB tumors compared with the liver control using semiquantitative PCR (Fig. 7A). Loss of Cdh11 occurred in 45% of TAg-RB tumors. Gain in copy number was evident in TAg-RB tumors for Kif14 (33%), Mycn (19%), and E2f3 (18%). Kif14 genomic gain was reinforced at the expression level: Kif14 mRNA was higher in 9 of 11 large tumors than at any point in normal retinal development (Fig. 7B). 
Figure 7.
 
Post-Rb1 mutation genomic changes in TAg-RB. (A) TAg-RB showed copy number variation for four of five gene candidates tested: Cdh11, Mycn, Kif14, and E2f3. (B) Kif14 mRNA is overexpressed in TAg-RB compared with developing or adult (A) retina. Hprt was used as an endogenous control. (C) Expression of p75NTR (green) and Dek (green) was confirmed in TAg-expressing (red) cells at P9. Original magnification, ×1000.
Figure 7.
 
Post-Rb1 mutation genomic changes in TAg-RB. (A) TAg-RB showed copy number variation for four of five gene candidates tested: Cdh11, Mycn, Kif14, and E2f3. (B) Kif14 mRNA is overexpressed in TAg-RB compared with developing or adult (A) retina. Hprt was used as an endogenous control. (C) Expression of p75NTR (green) and Dek (green) was confirmed in TAg-expressing (red) cells at P9. Original magnification, ×1000.
Early expression of TAg in single cells at P9 coincided with expression of tumor suppressor genes p75NTR and Cdh11, and oncogenes Dek and E2f3 (Fig. 7C and data not shown). Expression of E2f3 and Dek remained high throughout tumor development. We have previously shown that expression of the tumor suppressor genes p75NTR and Cdh11 is lost from progressing large tumors starting at P28. 14,15  
Discussion
The Value of the TAg-RB Model
The TAg-RB tumors have striking histologic and molecular similarity to human retinoblastoma, including focal initiation, lost expression of tumor suppressor genes Cdh11 15 and p75NTR, 14 overexpression of oncogenes DEK and E2F3 16 and presence of Homer-Wright and Flexner-Wintersteiner rosettes. 11 Approximately 20 different mouse models have been created in an attempt to recapitulate human retinoblastoma (reviewed in Ref. 42), however TAg-RB has the closest histologic resemblance to human tumors. In addition, most other models do not recreate the sporadic nature of human RB1 mutation in a susceptible retinal cell. The TAg-RB model achieves this by inactivating pRB and related proteins in specific cells in the context of an otherwise normal retina. 
The functional consequences of TAg expression depend on the cell type and context in which it is expressed; for example, TAg can cause degeneration 43,44 or tumor formation 43 in photoreceptors and apoptosis in horizontal cells. 45 Thus, the expression of TAg in mature neurons does not necessarily lead to oncogenesis. In TAg-RB, TAg expression is governed by an unknown, retinal-specific genomic element that directs expression of TAg to only one cellular population during a narrow window of time during development. Identifying this population was a major goal of the current work. 
Regulation of TAg Expression in TAg-RB Mice
Because the expression of TAg was restricted to the INL at all time points studied (Fig. 1), an INL origin of the tumors is certain. TAg expression was tightly regulated developmentally, beginning with only a few TAg-positive cells at P8 and gradually expanding by P13. Active proliferation and the initial steady increase in numbers of TAg-RB cells (Fig. 1) suggest that when TAg is expressed, this trait is maintained in the TAg-expressing lineage. Although at P9, early TAg-expressing cells expressed CRALBP (Fig. 4), later TAg-positive cells and progressing tumors did not express this glial marker. 
The majority of TAg-expressing cells also expressed the apoptotic signaling molecule p75NTR 14 and activated caspase-3 (Fig. 1B) at P21, suggesting that the expression of TAg results in the activation of cell death, accounting for the decrease in TAg-expressing cell number, as we suggested previously. 14 Occasional TAg-expressing cells escaped cell death (Fig. 1B, arrow) and formed clusters of early tumors by P28. This defined, clonal regulation of tumor initiation and development, together with complete disease penetrance and retinoblastoma-like histology, justifies the use of the TAg-RB model to test therapies. 
The Cell of Retinoblastoma Origin
The cell of retinoblastoma origin is being actively sought (reviewed in Ref. 46). Its identity has been inferred by examining expression of markers of retinal cell type and developmental stage (precursor/stem cell, mature/differentiated) within pathologic specimens of human retinoblastoma. Rod- and cone-specific genes are expressed most frequently, interpreted to indicate that retinoblastoma originates in photoreceptors, 47,48 consistent with the presence of rosettes with histologic similarities to photoreceptor outer segments. 49,50 Other studies, however, show that retinoblastoma tumors express many other cell type markers, including Müller glia, amacrine, and ganglion cell markers. 51,52 To our knowledge, the expression of only one neuronal stem cell marker, MCM2, has been demonstrated in human retinoblastoma, however its expression was mainly restricted to tumor adjacent to blood vessels. 35 Although clinical retinoblastoma specimens are invaluable for such studies, they are usually large, advanced tumors necessitating enucleation (retinoblastoma diagnosed early in its development can be successfully treated without enucleation), and often display promiscuous expression of various cell type markers. 
Mouse models that use genetic inactivation of Rb1 in combination with p107 or p130 loss 7,9 develop tumors emerging from the INL that express amacrine and glial cell markers, consistent with observations of the early pRB/p107-deficient chimeric retinoblastoma model. 8 As in human retinoblastoma, marker expression in late-stage tumors is promiscuous. TAg is an unambiguous marker of TAg-RB tumor cells, enabling us to follow and analyze characteristics of the cell of origin from the onset of tumor initiation, before transformation could potentially corrupt the normal patterns of gene expression. 
The TAg-RB Cell of Origin
We show that the TAg-RB cell of origin displays characteristics of mature Müller glia (Figures 4, 5, and 6). Although gene expression in Müller glia is very similar to that observed in retinal progenitors, 38 expression of Müller glial-specific clusterin and carbonic anhydrase II 38 in TAg-expressing cells provides definitive evidence of a Müller glial origin for these cells. The absence of expression of the early neuronal marker TuJ1 (Fig. 3) suggests that the TAg-RB cell of origin is not an early progenitor cell (Fig. 2). 
TAg-positive Müller glia expressed Chx10 at a low level from their first emergence at P9 throughout transformation (Fig. 4). This expression was lower in the TAg-expressing cells than in neighboring mature bipolar cells. A subpopulation of postmitotic Müller glia that expresses Chx10 has been identified and proposed as more progenitor-like than non–Chx10-expressing Müller glia. 53 Alternatively, it has been proposed that all Müller glia retain neural stem cell properties, and are capable of reversing their differentiation. 54 The TAg expression in Chx10-positive cells from the earliest time point studied (P8) is consistent with the cell of origin of the TAg-RB tumors being such Chx10-expressing Müller glia with the capacity of progenitors. TAg could also directly inactivate transcription factors to alter the expression of retinal cell type markers. 
We propose that the TAg-RB cell of origin is a sparse, Chx10-expressing differentiated Müller glial cell that is extremely sensitive to TAg oncogenic insult because of its dormant progenitor capabilities. The combination of strong oncogenic stimulation by TAg and the progenitor characteristics of this cell may reduce the minimum number of post-Rb1 loss events needed to achieve malignant transformation. In fully differentiated brain neurons without progenitor features, continuous overexpression of TAg stimulates cell cycle re-entry 55 followed by cellular degeneration. 56  
Evasion of Apoptosis and Promotion of TAg-RB Tumorigenesis
The TAg- and Chx10-positive cells proliferated within the INL of the retina, and by P21 expressed activated caspase-3 (Fig. 1B). We showed previously that the TAg-expressing cells are p75NTR-positive at P21 and display pyknotic nuclei, indicative of apoptosis. 14 Cells that lose expression of p75NTR escape apoptosis and give rise to tumors. By P28, TAg was restricted to foci from which tumors emerge. The activation of apoptosis days after initial TAg expression suggests that a few rounds of uncontrolled proliferation occur without activation of an apoptotic pathway. It has been suggested that the human retinoblastoma cell of origin evades apoptosis by functional inactivation of p53, either by increased MDM2 57 and/or MDM4 58 or posttranscriptional inactivation of p14ARF. 59 Because p53 is inactivated by TAg in our model, we could not assess this in our study. 
The eventual TAg-RB tumors arose from the less common cells that escape apoptosis. The time delay between initial TAg expression and eventual tumor formation implies the need for the accumulation of other mutations for complete malignant transformation. Indeed, we found that several genomic changes characteristic of human retinoblastoma 14 16,40,41 were also evident in TAg-RB at both the genomic and expression levels (Fig. 7). Our findings complement a recent microarray study of TAg-RB tumors that demonstrates overlap with some genes (including KIF14) found to be dysregulated in human retinoblastoma. 17 The post-RB1 loss genetic changes common to the TAg-RB tumors and human retinoblastoma confirms their universal role in retinoblastoma progression in a susceptible retinal cell irrespective of the mechanism of RB1 family inactivation. It will be interesting to examine these changes in other murine retinal tumor models. 
We identify the developing retinal cell with features of progenitor-like Müller glia, in which TAg is expressed in the TAg-RB model. This cell is induced by TAg to die, or escapes death by acquiring secondary genomic and gene expression changes similar to those found in human retinoblastoma, that result in murine retinoblastoma. TAg-RB is thus a good model of human retinoblastoma that recapitulates both molecular and histologic features of the human disease, supporting its use to study therapies for early and late stages of retinoblastoma. 
Footnotes
 Supported by National Institutes of Health/National Cancer Institute Grant R01CA118830.
Footnotes
 Disclosure: S. Pajovic, None; T.W. Corson, None; C. Spencer, None; H. Dimaras, None; M. Orlic-Milacic, None; M.N. Marchong, None; K.-H. To, None; B. Thériault, None; M. Auspitz, None; B.L. Gallie, None
The authors thank former and present members of the Gallie Laboratory for their contributions to this manuscript, Lucy Fuccillo for administrative assistance, Joan O'Brien for the TAg-RB mice, and Rod Bremner and John Saari for antibodies. 
References
DiCiommo D Gallie BL Bremner R . Retinoblastoma: the disease, gene and protein provide critical leads to understand cancer. Semin Cancer Biol. 2000;10:255–269. [CrossRef] [PubMed]
Clarke AR Maandag ER van Roon M . Requirement for a functional Rb-1 gene in murine development. Nature. 1992;359:328–330. [CrossRef] [PubMed]
Jacks T Fazeli A Schmitt EM Bronson RT Goodell MA Weinberg RA . Effects of an Rb mutation in the mouse. Nature. 1992;359:295–300. [CrossRef] [PubMed]
Lee EY Chang CY Hu N . Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature. 1992;359:288–294. [CrossRef] [PubMed]
Wu L de Bruin A Saavedra HI . Extra-embryonic function of Rb is essential for embryonic development and viability. Nature. 2003;421:942–947. [CrossRef] [PubMed]
Macpherson D Conkrite K Tam M Mukai S Mu D Jacks T . Murine bilateral retinoblastoma exhibiting rapid-onset, metastatic progression and N-myc gene amplification. EMBO J. 2007;26:784–794. [CrossRef] [PubMed]
MacPherson D Sage J Kim T Ho D McLaughlin ME Jacks T . Cell type-specific effects of Rb deletion in the murine retina. Genes Dev. 2004;18:1681–1694. [CrossRef] [PubMed]
Robanus-Maandag E Dekker M van der Valk M . p107 is a suppressor of retinoblastoma development in pRb-deficient mice. Genes Dev. 1998;12:1599–1609. [CrossRef] [PubMed]
Chen D Livne-bar I Vanderluit JL Slack RS Agochiya M Bremner R . Cell-specific effects of RB or RB/p107 loss on retinal development implicate an intrinsically death-resistant cell-of-origin in retinoblastoma. Cancer Cell. 2004;5:539–551. [CrossRef] [PubMed]
Ali SH DeCaprio JA . Cellular transformation by SV40 large T antigen: interaction with host proteins. Semin Cancer Biol. 2001;11:15–23. [CrossRef] [PubMed]
Windle JJ Albert DM O'Brien JM . Retinoblastoma in transgenic mice. Nature. 1990;343:665–669. [CrossRef] [PubMed]
Ts'o MO Fine BS Zimmerman LE . The Flexner-Wintersteiner rosettes in retinoblastoma. Arch Pathol. 1969;88:664–671. [PubMed]
O'Brien JM Marcus DM Bernards R . A transgenic mouse model for trilateral retinoblastoma. Arch Ophthalmol. 1990;108:1145–1151. [CrossRef] [PubMed]
Dimaras H Coburn B Pajovic S Gallie BL . The loss of p75 neurotrophin receptor expression accompanies malignant progression to human and murine retinoblastoma. Mol Carcinogen. 2006;45:333–343. [CrossRef]
Marchong MN Chen D Corson TW . Minimal 16q genomic loss implicates cadherin-11 in retinoblastoma. Mol Cancer Res. 2004;2:495–503. [PubMed]
Orlic M Spencer CE Wang L Gallie BL . Expression analysis of 6p22 genomic gain in retinoblastoma. Genes Chromosomes Cancer. 2006;45:72–82. [CrossRef] [PubMed]
Houston SK Pina Y Clarke J . Regional and temporal differences in gene expression of LHBETATAG retinoblastoma tumors. Invest Ophthalmol Vis Sci. 2011.
Bajenaru ML Pina Y Murray TG . Gelatinase expression in retinoblastoma: modulation of LH(BETA)T(AG) retinal tumor development by anecortave acetate. Invest Ophthalmol Vis Sci. 2010;51:2860–2864. [CrossRef] [PubMed]
Boutrid H Jockovich ME Murray TG . Targeting hypoxia, a novel treatment for advanced retinoblastoma. Invest Ophthalmol Vis Sci. 2008;49:2799–2805. [CrossRef] [PubMed]
Boutrid H Pina Y Cebulla CM . Increased hypoxia following vessel targeting in a murine model of retinoblastoma. Invest Ophthalmol Vis Sci. 2009;50:5537–5543. [CrossRef] [PubMed]
Hayden B Jockovich ME Murray TG . Iontophoretic delivery of carboplatin in a murine model of retinoblastoma. Invest Ophthalmol Vis Sci. 2006;47:3717–3721. [CrossRef] [PubMed]
Jockovich ME Bajenaru ML Pina Y . Retinoblastoma tumor vessel maturation impacts efficacy of vessel targeting in the LH(BETA)T(AG) mouse model. Invest Ophthalmol Vis Sci. 2007;48:2476–2482. [CrossRef] [PubMed]
Jockovich ME Murray TG Escalona-Benz E Hernandez E Feuer W . Anecortave acetate as single and adjuvant therapy in the treatment of retinal tumors of LH(BETA)T(AG) mice. Invest Ophthalmol Vis Sci. 2006;47:1264–1268. [CrossRef] [PubMed]
Jockovich ME Suarez F Alegret A . Mechanism of retinoblastoma tumor cell death after focal chemotherapy, radiation, and vascular targeting therapy in a mouse model. Invest Ophthalmol Vis Sci. 2007;48:5371–5376. [CrossRef] [PubMed]
Kang SJ Durairaj C Kompella UB O'Brien JM Grossniklaus HE . Subconjunctival nanoparticle carboplatin in the treatment of murine retinoblastoma. Arch Ophthalmol. 2009;127:1043–1047. [CrossRef] [PubMed]
Pina Y Houston SK Murray TG . Focal, periocular delivery of 2-deoxy-D-glucose as adjuvant to chemotherapy for treatment of advanced retinoblastoma. Invest Ophthalmol Vis Sci. 2010;51:6149–6156. [CrossRef] [PubMed]
Suarez F Jockovich ME Hernandez E Feuer W Parel JM Murray TG . Paclitaxel in the treatment of retinal tumors of LH beta-Tag murine transgenic model of retinoblastoma. Invest Ophthalmol Vis Sci. 2007;48:3437–3440. [CrossRef] [PubMed]
Dimaras H Marchong MN Gallie BL . Quantitative analysis of tumor size in a murine model of retinoblastoma. Ophthalmic Genet. 2009;30:84–90. [CrossRef] [PubMed]
Ruggeri M Tsechpenakis G Jiao S . Retinal tumor imaging and volume quantification in mouse model using spectral-domain optical coherence tomography. Opt Express. 2009;17:4074–4083. [CrossRef] [PubMed]
Ruggeri M Wehbe H Jiao S . In vivo three-dimensional high-resolution imaging of rodent retina with spectral-domain optical coherence tomography. Invest Ophthalmol Vis Sci. 2007;48:1808–1814. [CrossRef] [PubMed]
Landreville S Ma D Wu J Harbour JW . Loss of Id2 potentiates the tumorigenic effect of Rb inactivation in a mouse model of retinoblastoma. Curr Eye Res. 2010;35:435–439. [CrossRef] [PubMed]
Marchong MN Yurkowski C Ma C Spencer C Pajovic S Gallie BL . Cdh11 acts as a tumor suppressor in a murine retinoblastoma model by facilitating tumor cell death. PLoS Genet. 2010;6:e1000923. [CrossRef] [PubMed]
Pina Y Boutrid H Murray TG . Impact of tumor-associated macrophages in LH(BETA)T(AG) mice on retinal tumor progression: relation to macrophage subtype. Invest Ophthalmol Vis Sci. 2010;51:2671–2677. [CrossRef] [PubMed]
Pina Y Boutrid H Schefler A . Blood vessel maturation in retinoblastoma tumors: spatial distribution of neovessels and mature vessels and its impact on ocular treatment. Invest Ophthalmol Vis Sci. 2009;50:1020–1024. [CrossRef] [PubMed]
Seigel GM Campbell LM Narayan M Gonzalez-Fernandez F . Cancer stem cell characteristics in retinoblastoma. Mol Vis. 2005;11:729–737. [PubMed]
Vinores SA Derevjanik NL Mahlow J . Class III beta-tubulin in human retinal pigment epithelial cells in culture and in epiretinal membranes. Exp Eye Res. 1995;60:385–400. [CrossRef] [PubMed]
Katsetos CD Legido A Perentes E Mork SJ . Class III beta-tubulin isotype: a key cytoskeletal protein at the crossroads of developmental neurobiology and tumor neuropathology. J Child Neurol. 2003;18:851–866. [CrossRef] [PubMed]
Blackshaw S Harpavat S Trimarchi J . Genomic analysis of mouse retinal development. PLoS Biol. 2004;2:E247. [CrossRef] [PubMed]
Negishi K Kato S Teranishi T . Dopamine cells and rod bipolar cells contain protein kinase C-like immunoreactivity in some vertebrate retinas. Neurosci Lett. 1988;94:247–252. [CrossRef] [PubMed]
Corson TW Huang A Tsao MS Gallie BL . KIF14 is a candidate oncogene in the 1q minimal region of genomic gain in multiple cancers. Oncogene. 2005;24:4741–4753. [CrossRef] [PubMed]
Bowles E Corson TW Bayani J . Profiling genomic copy number changes in retinoblastoma beyond loss of RB1. Genes Chromosomes Cancer. 2007;46:118–129. [CrossRef] [PubMed]
Pacal M Bremner R . Insights from animal models on the origins and progression of retinoblastoma. Curr Mol Med. 2006;6:759–781. [PubMed]
al-Ubaidi MR Font RL Quiambao AB . Bilateral retinal and brain tumors in transgenic mice expressing simian virus 40 large T antigen under control of the human interphotoreceptor retinoid-binding protein promoter. J Cell Biol. 1992;119:1681–1687. [CrossRef] [PubMed]
Penna D Schmidt A Beermann F . Tumors of the retinal pigment epithelium metastasize to inguinal lymph nodes and spleen in tyrosinase-related protein 1/SV40 T antigen transgenic mice. Oncogene. 1998;17:2601–2607. [CrossRef] [PubMed]
Peachey NS Roveri L Messing A McCall MA . Functional consequences of oncogene-induced horizontal cell degeneration in the retinas of transgenic mice. Vis Neurosci. 1997;14:627–632. [CrossRef] [PubMed]
Dyer MA Bremner R . The search for the retinoblastoma cell of origin. Nat Rev Cancer. 2005;5:91–101. [CrossRef] [PubMed]
Mirshahi M Boucheix C Dhermy P Haye C Faure JP . Expression of the photoreceptor-specific S-antigen in human retinoblastoma. Cancer. 1986;57:1497–1500. [CrossRef] [PubMed]
Ohira A Yamamoto M Honda O Ohnishi Y Inomata H Honda Y . Glial-, neuronal- and photoreceptor-specific cell markers in rosettes of retinoblastoma and retinal dysplasia. Curr Eye Res. 1994;13:799–804. [CrossRef] [PubMed]
Ts'o MO Fine BS Zimmerman LE . The nature of retinoblastoma. II. Photoreceptor differentiation: an electron microscopic study. Am J Ophthalmol. 1970;69:350–359. [CrossRef] [PubMed]
Ts'o MO Zimmerman LE Fine BS . The nature of retinoblastoma. I. Photoreceptor differentiation: a clinical and histopathologic study. Am J Ophthalmol. 1970;69:339–349. [CrossRef] [PubMed]
Nork TM Schwartz TL Doshi HM Millecchia LL . Retinoblastoma. Cell of origin. Arch Ophthalmol. 1995;113:791–802. [CrossRef] [PubMed]
Perentes E Herbort CP Rubinstein LJ . Immunohistochemical characterization of human retinoblastomas in situ with multiple markers. Am J Ophthalmol. 1987;103:647–658. [CrossRef] [PubMed]
Rowan S Cepko CL . Genetic analysis of the homeodomain transcription factor Chx10 in the retina using a novel multifunctional BAC transgenic mouse reporter. Dev Biol. 2004;271:388–402. [CrossRef] [PubMed]
Das AV Mallya KB Zhao X . Neural stem cell properties of Muller glia in the mammalian retina: regulation by Notch and Wnt signaling. Dev Biol. 2006;299:283–302. [CrossRef] [PubMed]
Park KH Hallows JL Chakrabarty P Davies P Vincent I . Conditional neuronal simian virus 40 T antigen expression induces Alzheimer-like tau and amyloid pathology in mice. J Neurosci. 2007;27:2969–2978. [CrossRef] [PubMed]
Feddersen RM Ehlenfeldt R Yunis WS Clark HB Orr HT . Disrupted cerebellar cortical development and progressive degeneration of Purkinje cells in SV40 T antigen transgenic mice. Neuron. 1992;9:955–966. [CrossRef] [PubMed]
Xu XL Fang Y Lee TC . Retinoblastoma has properties of a cone precursor tumor and depends upon cone-specific MDM2 signaling. Cell. 2009;137:1018–1031. [CrossRef] [PubMed]
Laurie NA Donovan SL Shih CS . Inactivation of the p53 pathway in retinoblastoma. Nature. 2006;444:61–66. [CrossRef] [PubMed]
Guo Y Pajovic S Gallie BL . Expression of p14ARF, MDM2, and MDM4 in human retinoblastoma. Biochem Biophys Res Commun. 2008;375:1–5. [CrossRef] [PubMed]
Figure 1.
 
Distinct pattern of TAg expression in the TAg-RB developing retina. (A) Immunohistochemical analysis shows expression of TAg (red) in developing retina from postnatal day (P)5 to P35. Expression of TAg started in single cells at P8, localized to the inner nuclear layer (original magnification, ×400). (B) Expression of activated caspase 3 (green) and TAg (red) at P21, low (×200) (left) and high (×400) (right) magnification. The majority of cells expressed both proteins; rare cells expressed TAg only (arrow).
Figure 1.
 
Distinct pattern of TAg expression in the TAg-RB developing retina. (A) Immunohistochemical analysis shows expression of TAg (red) in developing retina from postnatal day (P)5 to P35. Expression of TAg started in single cells at P8, localized to the inner nuclear layer (original magnification, ×400). (B) Expression of activated caspase 3 (green) and TAg (red) at P21, low (×200) (left) and high (×400) (right) magnification. The majority of cells expressed both proteins; rare cells expressed TAg only (arrow).
Figure 2.
 
Expression of proliferation markers in the course of TAg-RB development. Adjacent retinal sections from mice injected with BrdU were immunostained for BrdU (brown), TAg (green), or Ki-67 (red). Although the majority of the cells that were proliferating (BrdU or Ki-67 positive) were TAg-positive, there were a number of cells that showed proliferation marker or TAg expression only. Original magnification, ×400.
Figure 2.
 
Expression of proliferation markers in the course of TAg-RB development. Adjacent retinal sections from mice injected with BrdU were immunostained for BrdU (brown), TAg (green), or Ki-67 (red). Although the majority of the cells that were proliferating (BrdU or Ki-67 positive) were TAg-positive, there were a number of cells that showed proliferation marker or TAg expression only. Original magnification, ×400.
Figure 3.
 
TAg expressing cells do not express neuronal marker TuJ1. There was no expression of TuJ1 (green) in TAg (red) positive cells at P9 and P12, suggesting a nonneuronal origin of these cells. Original magnification, ×1000.
Figure 3.
 
TAg expressing cells do not express neuronal marker TuJ1. There was no expression of TuJ1 (green) in TAg (red) positive cells at P9 and P12, suggesting a nonneuronal origin of these cells. Original magnification, ×1000.
Figure 4.
 
Expression of TAg overlaps with expression of Müller glial markers. Expression of all major retinal cell type markers (green) and TAg (red) from P9 to P29. No overlap was found for HPC-1 (amacrine cells), or neurofilament 160 kDa (Nefm) (horizontal cells) and complete overlap at all time points was found for Chx10 (retinal progenitors and bipolar cells). Coexpression of CRALBP (Müller glia) and TAg was found only at the very early time point (P9) and by P12, the majority of TAg-positive cells did not express CRALBP. Original magnification, ×1000.
Figure 4.
 
Expression of TAg overlaps with expression of Müller glial markers. Expression of all major retinal cell type markers (green) and TAg (red) from P9 to P29. No overlap was found for HPC-1 (amacrine cells), or neurofilament 160 kDa (Nefm) (horizontal cells) and complete overlap at all time points was found for Chx10 (retinal progenitors and bipolar cells). Coexpression of CRALBP (Müller glia) and TAg was found only at the very early time point (P9) and by P12, the majority of TAg-positive cells did not express CRALBP. Original magnification, ×1000.
Figure 5.
 
Cells expressing TAg are not mature bipolar cells. Mature bipolar marker PKC (green) showed no overlap with TAg (red) expression. Original magnification, ×1000.
Figure 5.
 
Cells expressing TAg are not mature bipolar cells. Mature bipolar marker PKC (green) showed no overlap with TAg (red) expression. Original magnification, ×1000.
Figure 6.
 
Late Müller cell type markers are expressed in TAg positive cells. (A) A subset of cells expressing three markers of mature Müller cells (glutamine synthetase, carbonic anhydrase II [Car2], and clusterin) (green) expressed TAg (red) at P9. (B) Tumors in TAg retinas expressed TAg and retained the expression of Car2. Original magnification, ×1000.
Figure 6.
 
Late Müller cell type markers are expressed in TAg positive cells. (A) A subset of cells expressing three markers of mature Müller cells (glutamine synthetase, carbonic anhydrase II [Car2], and clusterin) (green) expressed TAg (red) at P9. (B) Tumors in TAg retinas expressed TAg and retained the expression of Car2. Original magnification, ×1000.
Figure 7.
 
Post-Rb1 mutation genomic changes in TAg-RB. (A) TAg-RB showed copy number variation for four of five gene candidates tested: Cdh11, Mycn, Kif14, and E2f3. (B) Kif14 mRNA is overexpressed in TAg-RB compared with developing or adult (A) retina. Hprt was used as an endogenous control. (C) Expression of p75NTR (green) and Dek (green) was confirmed in TAg-expressing (red) cells at P9. Original magnification, ×1000.
Figure 7.
 
Post-Rb1 mutation genomic changes in TAg-RB. (A) TAg-RB showed copy number variation for four of five gene candidates tested: Cdh11, Mycn, Kif14, and E2f3. (B) Kif14 mRNA is overexpressed in TAg-RB compared with developing or adult (A) retina. Hprt was used as an endogenous control. (C) Expression of p75NTR (green) and Dek (green) was confirmed in TAg-expressing (red) cells at P9. Original magnification, ×1000.
Table 1.
 
Antibodies Used for Immunohistochemistry
Table 1.
 
Antibodies Used for Immunohistochemistry
Antibody Marker for Source Dilution
SV40 TAg TAg-RB Santa Cruz, Santa Cruz, CA 1:200
Activated Caspase 3 Apoptosis R&D Systems, Minneapolis, MN 1:50
BrdU Proliferation BD Biosciences, Mississauga, ON, Canada 1:500
TuJ1 Early neurons Stemcell Technologies, Vancouver, BC, Canada 1:50
Ki-67 Proliferation Lab Vision, Fremont, CA 1:200
HPC-1 Amacrine cells Sigma, Oakville, ON, Canada 1:100
NEFM Horizontal cells Sigma 1:40
Chx10 Progenitors/Müller subpopulation Bremner laboratory 9 1:2000
CRALBP Müller glia Saari laboratory 9 1:1000
PKC Bipolar cells BD Biosciences 1:50
Gln synthetase Mature Müller glia Santa Cruz 1:200
Car2 Mature Müller glia Novus, Oakville, ON, Canada 1:50
Clusterin Mature Müller glia Santa Cruz 1:100
p75NTR Lost in retinoblastoma Chemicon, Temecula, CA 1:200
DEK Gained in retinoblastoma BD Biosciences 1:200
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×